CD4 CD25 Foxp3 T-Regulatory Cells Produce both Gamma Interferon and Interleukin-10 during Acute Severe Murine Spotted Fever Rickettsiosis

Transcription

1 INFECTION AND IMMUNITY, Sept. 2009, p Vol. 77, No /09/$ doi: /iai Copyright 2009, American Society for Microbiology. All Rights Reserved. CD4 CD25 Foxp3 T-Regulatory Cells Produce both Gamma Interferon and Interleukin-10 during Acute Severe Murine Spotted Fever Rickettsiosis Rong Fang, 1 Nahed Ismail, 1,3 Thomas Shelite, 1 and David H. Walker 1,2 * Department of Pathology, University of Texas Medical Branch, Galveston, Texas 1 ; Center for Biodefense and Emerging Infectious Diseases, 301 University Blvd., Galveston, Texas ; and Department of Pathology, Meharry Medical College, 1005 Dr. D. B. Todd Jr. Blvd., Nashville, Tennessee Received 26 March 2009/Returned for modification 25 April 2009/Accepted 18 June 2009 Spotted fever group rickettsiae cause life-threatening human infections worldwide. Until now, the immune regulatory mechanisms involved in fatal rickettsial infection have been unknown. C3H/HeN mice infected with PFU of Rickettsia conorii developed an acute progressive disease, and all mice succumbed to this infection. A sublethal infection induced protective immunity, and mice survived. Compared to splenic T cells from sublethally infected mice, splenic T cells from lethally infected mice produced significantly lower levels of interleukin-2 (IL-2) and gamma interferon (IFN- ) and a higher level of IL-10, but not of IL-4 or transforming growth factor, and there was markedly suppressed CD4 T-cell proliferation in response to antigen-specific stimulation with R. conorii. Furthermore, lethal infection induced significant expansion of CD4 CD25 Foxp3 T cells in infected organs compared to the levels in naïve and sublethally infected mice. In a lethal infection, splenic CD4 CD25 Foxp3 T cells, which were CTLA-4 high T-bet and secreted both IFN- and IL-10, suppressed the proliferation of and IL-2 production by splenic CD4 CD25 Foxp3 T cells in vitro. Interestingly, depletion of CD25 T cells in vivo did not change the disease progression, but it increased the bacterial load in the lung and liver, significantly reduced the number of IFN- -producing Th1 cells in the spleen, and increased the serum levels of IFN-. These results suggested that CD4 CD25 T cells generated in acute murine spotted fever rickettsiosis are Th1-cell-related adaptive T-regulatory cells, which substantially contribute to suppressing the systemic immune response, possibly by a mechanism involving IL-10 and/or cytotoxic T-lymphocyte antigen 4. Downloaded from Rickettsiae are gram-negative, obligately intracellular, arthropod-transmitted bacteria. Patients with severe, life-threatening human rickettsial infections, such as Rocky Mountain spotted fever and Mediterranean spotted fever, often present with fever, severe headache, malaise, myalgia, nausea, vomiting, and abdominal pain (45). Approximately 5% of infected persons succumb to the disease, while other people develop permanent sequelae, including amputation, neurological deficits, or permanent learning impairment, despite the availability of effective treatment (8). Although endothelial cells are the main target cells, rickettsiae can infect other cell types, such as macrophages and dendritic cells (DCs) (10, 14). Infection of C3H/HeN (C3H) mice with Rickettsia conorii, the agent of Mediterranean spotted fever, closely mimics lifethreatening human rickettsioses; it produces similar disseminated vascular injury and has dose-dependent outcomes (47). Depletion and adoptive transfer experiments have indicated that CD8 T cells mediate their effector function against rickettsiae through both gamma interferon (IFN- ) production and cytotoxic killing of infected target cells (11, 13, 46). IFN- is an essential defense against infection with rickettsiae, and * Corresponding author. Mailing address: Department of Pathology, Center for Biodefense and Emerging Infectious Diseases, 301 University Blvd., Galveston, TX Phone: (409) Fax: (409) dwalker@utmb.edu. Supplemental material for this article may be found at Published ahead of print on 29 June mice that lack this cytokine develop an overwhelming infection and succumb to an ordinarily sublethal dose of rickettsiae (12, 46). Recently, we have shown that rickettsia-infected bone marrow-derived DCs promote the expansion of Foxp3 CD4 T-regulatory (T-reg) cells in vitro. Expansion of T-reg cells in cocultures of naïve T cells with bone marrow-derived DCs was associated with a suppressed Rickettsia-dependent Th1 response. Since IFN- mediates protection against Rickettsia, these findings suggest that generation of T-reg cells might be a potential mechanism contributing to host susceptibility to severe spotted fever group rickettsiosis (10). However, whether a suppressed immune response is generated in severe rickettsial infection in vivo remains unclear. Furthermore, the type of CD4 T-cell response in lethal infections with R. conorii in vivo also remains unclear. Previous studies have shown that infections with various pathogens induce development of immunosuppression, which is usually associated with progressive and severe disease. For example, infection with pathogens such as Trypanosoma cruzi (40, 41), dengue virus (23), Friend murine leukemia virus (48), Mycobacterium tuberculosis (22), and Helicobacter pylori (25) give rise to immunosuppression mediated by either anergic T cells or T-reg cells. T-reg cells have a crucial role in the control of immune responses to both self-antigen and foreign infectious pathogens (27, 33) which cause acute (16, 23) and chronic infections (3, 5, 25). In healthy humans and naïve mice, T-reg cells coexpress CD25 (interleukin-2r [IL-2R ]) antigen and represent 5 to 10% of the CD4 T cells (36); however, CD25 on December 14, 2018 by guest 3838

2 VOL. 77, 2009 T-REG CELLS IN RICKETTSIAL INFECTION 3839 is not a unique marker for T-reg cells and is also expressed on activated effector T cells (29). Based on their origins, two types of CD4 T-reg cells have been described: naturally occurring T-reg cells and inducible T-reg cells (32, 37). The unique transcription factor Foxp3 is the most specific marker of natural T-reg cells identified so far and is required for generation of these cells (15). Another immune regulatory mechanism that influences effector T-cell responses is mediated by cytotoxic T lymphocyte antigen 4 (CTLA-4). Although the requirement for CTLA-4 in regulatory cell function is still controversial, there is a strong correlation between CTLA-4 expression and the suppressive function of CD4 CD25 T-reg cells (4, 34, 49). The goals of this study were to determine whether immunosuppression occurs in severe murine rickettsial infection in vivo and to further identify the regulatory immune mechanisms involved in this acute severe intracellular bacterial infection. This study shed substantial light on the importance of regulatory immune mechanisms in the pathogenesis of fatal spotted fever rickettsiosis. MATERIALS AND METHODS R. conorii and animal infections. R. conorii (Malish 7 strain) was obtained from the American Type Culture Collection (ATCC VR 613). For animal inoculation, rickettsiae were cultivated in specific-pathogen-free embryonated chicken eggs. After homogenization, rickettsiae were diluted to obtain a 10% suspension in sucrose-phosphate-glutamate (SPG) buffer (0.218 M sucrose, 3.8 mm KH 2 PO 4, 7.2 mm K 2 HPO 4, 4.9 mm monosodium glutamic acid; ph 7.0). For cell stimulation, rickettsiae were propagated in Vero cells and purified by Renografin density gradient centrifugation, as described previously (18). Purified viable rickettsiae were suspended in SPG buffer. The concentration of rickettsiae from either a yolk sac or cell culture was determined by a plaque assay and quantitative real-time PCR as described below (13). The rickettsial stock was stored at 80 C until it was used. Wild-type C3H mice were purchased from Harlan Laboratories (Indianapolis, IN) and used when they were 6 to 9 weeks old. Mice were housed in a biosafety level 3 facility at the University of Texas Medical Branch, Galveston. All experiments and procedures were approved by the University of Texas Medical Branch Animal Care and Use Committee, and mice were used according to the guidelines in the Guide for the Care and Use of Laboratory Animals (28a). C3H mice were infected intravenously as described previously using a lethal dose of PFU (3 50% lethal doses) or a sublethal dose of PFU (0.3 50% lethal doses) of R. conorii (13). Negative control mice were inoculated with 100 l of SPG buffer alone. Mice were monitored daily for signs of illness. In vivo depletion of CD4 CD25 T-reg cells. For in vivo depletion of CD4 CD25 cells, mice were inoculated with purified rat anti-mouse CD25 monoclonal antibody (MAb) PC61 (1 mg in 500 l phosphate-buffered saline; BioXcell, West Lebanon, NH) intraperitoneally 3 days prior to infection with a lethal dose of R. conorii. The efficacy of CD25 depletion was measured by flow cytometry. Flow cytometry. Flow cytometry was performed to characterize the lymphocyte subpopulations during the infection. Cells were suspended in FACS buffer (phosphate-buffered saline containing 0.1% bovine serum albumin and 0.01% NaN 3 ). Fc receptors were blocked with anti-cd16/32 (clone 2.4G2). The following conjugated antibodies (Abs) were purchased from BD Bioscience (San Diego, CA), unless indicated otherwise: fluorescein isothiocyanate (FITC)- or peridininchlorophyll-protein (PercP)-Cy5-labeled anti-cd3 (clone 145-2C11), allophycocyanin (APC)- or APC-Cy7-labeled anti-cd4 (clone RM4-5), PercP-Cy5- or APC-labeled anti-cd25 (clone PC 61), phycoerythrin (PE)-labeled anti-ifn- (clone XMG1.2), PE-labeled anti-il-4 (clone 11B11), FITC-labeled anti-il-10 (clone JES5-16E3), PE-labeled anti-ctla-4 (clone UC10-4F10-11), FITC-labeled anti-cd 103 (clone M290), and APC-labeled anti-il-2 (clone JES6-5H4). The isotype control Abs included FITC-, PE-, PercP-Cy5.5-, and APC-conjugated hamster immunoglobulin G1 (IgG1) (clone A19-3), rat IgG1 (clone R3-34), rat IgG2a (clone R35-95), mouse IgG1 (clone X40), and rat IgG2b (clone A95-1). For intracellular cytokine staining, cells were incubated at 37 C for 6 h in complete medium in the presence of Golgi plug or Golgi stop (BD Bioscience) according to the manufacturer s recommendations. Staining with an anti-foxp3 PE-conjugated Ab (FJK-16S) or an anti-t-bet Alexa Fluor 647-conjugated Ab (ebio 4B10) was performed according to the manufacturer s protocol (ebioscience). Stained cells were analyzed using the FACSCalibur or FACSCanto system (Becton-Dickinson, BD Biosciences). For characterization of lymphocytes, at least 20,000 events were collected. Data were analyzed with FlowJo software (TreeStar, San Carlos, CA). Cell preparation, purification, and culture conditions. Spleens were removed from mice infected with R. conorii on day 6 postinfection. Splenic CD4 CD25 cells were purified as described previously (21). Briefly, CD4 T cells were purified by positive selection using anti-cd4 MAb L3T4-coated Dynal beads (Dynal & Invitrogen, Carlsbad, CA) according to the manufacturer s instructions. Purified cell preparations usually contained 90% CD4 T cells. To further separate CD4 T cells into CD25 and CD25 populations, CD4 T cells were incubated with biotin-conjugated anti-cd25 MAb 7D4 (BD Biosciences) for 30 min at 4 C. After washing, cells were incubated with streptavidincoated microbeads (Miltenyi Biotec) for 30 min at 4 C. Magnetic separation was performed using a MACS separation column according to the manufacturer s protocol. The flowthrough was collected and used as CD4 CD25 T cells. The retained cells were eluted from the column as purified CD4 CD25 T cells. The levels of purity of CD4 CD25 and CD4 CD25 T-cell preparations determined by FACS analysis (FACSCalibur; BD Labware) were routinely 90% and 92%, respectively. Purified splenic CD4 CD25 cells ( cells) were cocultured with irradiated naïve syngeneic splenocytes in the absence of splenic CD4 CD25 cells or in the presence of increasing numbers of splenic CD4 CD25 cells for 3 days in 96-well, round-bottom plates. Anti-CD3 (0.25 g/ml) or rickettsial antigen (multiplicity of infection [MOI], 5) was added to the culture for stimulation. Supernatants were collected from the culture of CD4 CD25 and/or CD4 CD25 cells at 24 h (for IL-2) or 72 h (for other cytokines). Proliferation assay. Single-cell suspensions of the spleen or purified CD4 T-cell subset (CD4 CD25 ) were labeled with the tracking fluorochrome carboxyfluorescein diacetate succinimidyl ester (CFSE) (Molecular Probes, Eugene, OR) as described previously (38). Cells were suspended in culture medium at a concentration of cells/well and stimulated with anti-cd3 (0.5 g/ml), R. conorii (MOI, 5), or anti-cd3 (0.5 g/ml) plus IL-2 (10 ng/ml) in the presence of irradiated naïve splenocytes. At 60 h after stimulation, cells were harvested, washed with FACS buffer (Dulbecco s phosphate-buffered saline without magnesium chloride or calcium chloride [Gibco, Burlington, VT] containing 1% heat-inactivated fetal bovine serum and 0.09% [w/v] sodium azide), and labeled with Abs. CFSE dilution upon T-cell proliferation was measured by flow cytometric analysis. In vitro splenocyte culture and cytokine ELISA. Infected mice were sacrificed on day 5 or 6 postinfection, and spleens and sera were collected. Splenocytes or purified T-cell subsets were cultured in 96-well round-bottom plates containing cells/well. Cells were stimulated with R. conorii, concanavalin A (ConA) (3 g/ml), anti-cd3, and anti-cd28 as indicated below in the presence of irradiated naïve syngeneic splenocytes. After 24 h (for IL-2) or 72 h (for IFN-, IL-10, and transforming growth factor [TGF- ]), supernatants were collected. Cytokine concentrations in the culture supernatant or serum were measured by using Quantikine enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN). The limits of detection of the ELISA for cytokine measurements were as follows: IL-2, 3 pg/ml; IFN-, 20 pg/ml; IL-10, 4 pg/ml; and TGF-, 4.6 pg/ml. Real-time PCR quantification of rickettsial loads. To determine the rickettsial loads in infected organs, approximately 10-mg portions of liver and lung tissues were collected on day 5 postinfection and homogenized. DNA was extracted using a DNeasy tissue kit (Qiagen, Valencia, CA), and rickettsial burdens were determined using an icycler IQ from Bio-Rad (Hercules, CA). The following primers (Sigma-Genosys, St. Louis, MO) and probes (Biosearch Technologies, Novato, CA) targeting R. conorii and mouse glyceraldehyde-3-phosphate dehydrogenase (gapdh) genes were used as described previously (43): ompb forward primer ACACATGCTGCCGAGTTACG, ompb reverse primer AATTGTAG CACTACCGTCTAAGGT, ompb probe CGGCTGCAAGAGCACCGCCA ACAA (5 6-carboxyfluorescein and 3 Black Hole Quencher 1TM), gapdh forward primer CAACTACATGGTCTACATGTTC, gapdh reverse primer CTCG CTCCTGGAAGATG, and gapdh probe CGGCACAGTCAAGGCCGAGAAT GGGAAGC (5 6-carboxytetramethylrhodamine and 3 Black Hole Quencher 2TM). The results were normalized using gapdh data for the same sample and expressed as the number of copies per 10 5 copies of gapdh. Statistical analysis. For comparison of mean values for two experimental groups, the two-tailed t test was used, and P values were calculated using Sigma- Plot software (SPSS, Chicago, IL). A difference in mean values was deemed significant if the P value was 0.05 or highly significant if the P value was The three experimental groups were compared using a one-way analysis of variance. Post hoc group pairwise comparisons were conducted using the Bon-

3 3840 FANG ET AL. INFECT. IMMUN. FIG. 1. Inhibition of IFN- production, but enhancement of IL-10 production, in lethally infected mice compared with uninfected and sublethally infected mice. On day 5 postinfection, uninfected and infected mice were sacrificed. (A) Splenocytes were isolated from mice and stimulated with R. conorii (MOI, 5) or medium. The IFN- and IL-10 in the supernatant were assayed using an ELISA after 3 days of culture. (B) Sera were collected, and the IFN- and IL-10 in the sera were assayed using an ELISA. The data represent the results of two similar independent experiments in which there were three mice per group. The bars and error bars indicate the means and standard deviations of the results for three individual mice (, P 0.01;, P 0.05). Post hoc group pairwise comparisons were conducted using the Bonferroni procedure (alpha 0.05). uninfect, uninfected. ferroni procedure and an overall alpha level of significance of We used the GLM procedure in SAS (SAS/STAT 9.1 user s guide, SAS Institute Inc., Cary, NC) (MEANS statement with the Bonferroni option). For testing the difference in survival between different mouse groups, data were analyzed by the product limit (Kaplan-Meier) method using GraphPad Prism software. RESULTS Lethally infected mice show suppressed IFN- production but enhanced IL-10 production during the early stages of infection. As we demonstrated previously (10), C3H mice infected intravenously with a lethal dose of R. conorii developed a progressive, overwhelming disseminated endothelial cell infection that resulted in 100% mortality on day 6 or 7 postinfection (data not shown). In contrast, C3H mice infected with a sublethal dose of R. conorii developed self-limited disease, effectively eliminating rickettsiae with 100% survival. To determine antigen-specific T-cell responses in sublethal and lethal infection models, we first examined the cytokine profiles of splenocytes from infected and naïve mice in response to antigen stimulation. Surprisingly, splenocytes from naïve mice produced significant amounts of IFN- and IL-10 after stimulation with R. conorii for 3 days in vitro (Fig. 1A), suggesting that there was strong immunogenicity of rickettsial antigens. Splenocytes from sublethally infected mice induced a strong protective IFN- production type 1 immune response upon in vitro stimulation with rickettsial antigens (Fig. 1A). In contrast, splenocytes from lethally infected mice produced a significantly lower level of IFN- in response to rickettsial stimulation, suggesting that the type 1 immune response in lethally infected mice was suppressed in an antigen-specific manner. Interestingly, the suppressed Rickettsia-specific type 1 immune response in lethally infected mice was associated with elevated IL-10 production by splenocytes restimulated in vitro with Rickettsia (Fig. 1A). It is noteworthy that spontaneous production of IL-10 was also detected in culture supernatant of unstimulated immune splenocytes from lethally infected mice. No significant level of TGF- was detected in the supernatants from the spleen cell cultures stimulated with Rickettsia, suggesting that TGF- was not associated with a suppressed type 1 immune response (data not shown). To assess whether local cytokine profiles in the spleens of infected mice were consistent with systemic cytokine levels in vivo, we determined the levels of IFN- and IL-10 in the sera of both sublethally

4 VOL. 77, 2009 T-REG CELLS IN RICKETTSIAL INFECTION 3841 FIG. 2. Proliferation of antigen-specific CD4 T cells and IL-2 production by splenocytes due to a lethal infection were markedly suppressed compared to the results for a sublethal infection. Splenocytes were isolated from uninfected, sublethally infected, or lethally infected mice on day 5 postinfection. (A) Splenocytes were labeled with CFSE and stimulated with anti-cd3 (0.5 g/ml), R. conorii (MOI, 5), or anti-cd3 (0.5 g/ml) plus IL-2 (10 ng/ml) in the presence of irradiated naïve splenocytes. After 60 h, cells were collected, and the proliferation of CD4 T cells was examined by CFSE dilution on gated CD4 CD3 T cells by flow cytometric analysis. (B) Splenocytes were stimulated with ConA (3 g/ml), anti-cd3 (1 g/ml) plus anti-cd28 (1 g/ml), or medium for 24 h. Supernatants were collected for measurement of IL-2 secretion by ELISA. Each group included three mice, and the data are representative of data from three independent experiments in which similar results were obtained. The error bars indicate standard deviations., statistically significantly different (P 0.05, as determined using a two-tailed t test). uninfect, uninfected. and lethally infected mice. Lethal rickettsial infection was associated with lower levels of IFN- but higher levels of IL-10 in the spleen (local site of infection) and sera (systemically) compared to the levels associated with sublethal infection (Fig. 1B). These results suggested that lethal infection resulted in local and systemic suppression of the type 1 T-cell immune response, which was associated with enhanced production of IL-10 in an antigen-specific manner. Lethal infection results in suppressed CD4 T-cell proliferation and IL-2 production. To determine the regulatory mechanisms that contribute to the suppressed type 1 immune response in a fatal infection, we first examined CD4 T-cell proliferation using CFSE staining in response to anti-cd3 or rickettsial stimulation. On day 5 postinfection, CFSE-labeled CD4 T cells from sublethally infected mice exhibited evident proliferation in response to in vitro polyclonal or antigenspecific stimulation (Fig. 2A). In contrast, lethal rickettsial infection induced suppressed CD4 T-cell proliferation in response to a T-cell receptor stimulus compared to the proliferation in uninfected and sublethally infected mice. Splenic CD4 T cells from a lethal infection showed a lack of responsiveness or anergy to antigen-specific stimulation as subsequent in vitro rickettsial stimulation for 60 h did not result in any detectable cell proliferation. The suppressed CD4 T-cell proliferation in lethal infections was linked with the failure to produce IL-2. Splenocytes from lethally infected C3H mice produced a significantly lower concentration of IL-2 than splenocytes from sublethally infected mice in response to polyclonal stimulation with ConA or anti-cd3 plus anti-cd28 (Fig. 2B). To determine whether suppression of CD4 T-cell proliferation in lethally infected mice was due to the absence or consumption of IL-2 by T-reg cells, we measured T-cell proliferation in response to polyclonal stimulation in the presence of IL-2. Our data showed that the suppressed proliferation of splenic CD4 T cells in lethally infected mice was not restored by addition of IL-2 (Fig. 2A). The unresponsive state of CD4 T cells in lethally infected mice was also not due to deletion of T cells because the spleens and livers of lethally infected mice consistently contained levels of CD4 T cells comparable to those detected in naïve and sublethally infected C3H mice (Fig. 3A). These results suggested that lethal infection induces CD4 T-cell unresponsiveness or anergy, which may contribute to suppressed protective immunity against Rickettsia. Expansion of CD4 CD25 T cells in infected sites induced by lethal infection with R. conorii. To further investigate if the CD4 unresponsiveness and suppressed type 1 response in lethal infections with R. conorii are possibly mediated by T-reg cells, we next examined the frequencies of total CD4 CD25 and natural CD4 Foxp3 T cells at sites of infection, the liver, and the spleen. On day 5 postinfection, the percentages of CD4 CD25 cells in CD4 T cells from the liver in lethally and sublethally infected mice were significantly greater than the percentages in uninfected mice (Fig. 3B). Although we

5 3842 FANG ET AL. INFECT. IMMUN. Downloaded from FIG. 3. R. conorii induced substantial expansion of CD4 CD25 T cells, but not CD4 Foxp3 T cells, in infected sites compared to the results for uninfected and sublethally infected mice. Mice were inoculated intravenously with a lethal or sublethal dose of R. conorii. (A) The absolute numbers of CD4 T cells in livers or spleens from uninfected and infected mice were analyzed on day 6 postinfection by flow cytometry and were calculated by multiplying the percentage of CD4 T cells by the total number of live splenocytes. (B) The frequencies of CD4 CD25 T cells and CD4 Foxp3 T cells in spleens and livers were determined by flow cytometry on day 5 postinfection. (C) Percentages of splenic CD4 Foxp3 and CD4 CD25 T cells at the indicated time points. Each mouse group included three mice. The bars and error bars indicate the means and standard deviations for three mice in each group ( *, P 0.05; **, P 0.01). Post hoc group pairwise comparisons were conducted using the Bonferroni procedure (alpha 0.05). uninfect, uninfected. on December 14, 2018 by guest observed expansion of CD4 CD25 cells in spleens of sublethally and lethally infected mice compared to spleens of uninfected mice, the expansion was not statistically significant. Both lethally and sublethally infected mice had significantly lower percentages of CD4 Foxp3 T-reg cells in their spleens but not in their livers than uninfected mice. Kinetic analysis demonstrated that there was a progressive decrease in the percentage of CD4 Foxp3 T cells compared to CD4 CD25 T cells in the spleens of lethally infected mice with the development of disease (Fig. 3C), which could have been due to either deletion or migration of CD4 Foxp3 T-reg cells to peripheral sites of infection. The possibility of migration of Foxp3 T-reg cells to the liver is less likely because the numbers of Foxp3 cells in the liver were comparable in lethally and sublethally infected mice (Fig. 3B). Since no significant differences were observed in the total numbers of splenic CD4 T cells between lethally and nonlethally infected mice (Fig. 3A), our data suggested that the majority of splenic CD4 CD25 T cells in lethally infected mice might be Foxp3 T cells, which is consistent with the presence of either inducible T-reg cells or effector T cells. Antigen-specific CD4 T-cell responses in lethally infected mice are characterized by suppressed IFN- production but increased IL-10 production. To further characterize the phe-

6 VOL. 77, 2009 T-REG CELLS IN RICKETTSIAL INFECTION 3843 FIG. 4. Antigen-specific-, IFN- -producing CD4 T cells were suppressed in lethally infected mice. Mice were inoculated with different doses of R. conorii as described in Materials and Methods. Splenocytes were cultured with or without rickettsiae for 12 h in the presence of naïve syngeneic splenocytes and treated with Golgi stop for the last 6 h. Cells were collected, and intracellular production of IFN- and IL-10 (A) and IL-2 (B) by CD4 T cells was examined by flow cytometry. The numbers in the dot blots are percentages (means standard deviations for two or three mice in each group) ( *, P 0.05; **, P 0.06). The experiments were repeated two times with similar results. uninfect, uninfected. notype of the suppressed antigen-specific type 1 immune response in lethally infected mice, we analyzed the frequencies of Rickettsia-specific IL-2-, IL-4-, IFN- -, and IL-10-producing CD4 T cells in the spleens of both groups of infected mice by flow cytometry. Splenocytes were harvested from infected mice and cultured in vitro with naïve syngeneic splenocytes in the presence or absence of rickettsial antigen. On day 5 postinfection, a high frequency of IFN- -producing CD4 T cells was observed in sublethally infected mice directly ex vivo (Fig. 4A). More importantly, sublethal infection resulted in a significantly

7 3844 FANG ET AL. INFECT. IMMUN. higher level of IFN- -producing CD4 T cells after antigen restimulation in vitro than lethal infection (P 0.05) (Fig. 4A). In other words, a limited or inhibited IFN- -producing CD4 T-cell response, as measured directly ex vivo or following in vitro antigen stimulation, was observed in lethally infected mice compared to sublethally infected mice. A negligible number of IL-4-producing CD4 T cells were detected in both sublethally and lethally infected mice (data not shown). These results suggested that lethal rickettsial disease was not due to bias of the immune response toward the Th2 phenotype, but rather was due to a suppressed protective CD4 Th1 response. Interestingly, the suppressed CD4 Th1-cell response in the lethal infection was associated with a higher percentage of IL-10-producing CD4 T cells (P 0.06) (Fig. 4A) and a lower percentage of IL-2-producing CD4 T cells compared to the percentages in sublethally infected mice (Fig. 4B), as measured after in vitro antigen restimulation. These results suggested that a low or sublethal dose of R. conorii initiated a protective, substantial, antigen-specific Th1-type CD4 T-cell response that resulted in bacterial clearance, while a high or lethal dose of R. conorii induced a suppressed CD4 Th1 response and enhanced IL-10 production, which correlated with progressively increased bacterial propagation. Lethal R. conorii infection-induced CD4 CD25 T-reg cells have a suppressive function but also produce IFN- and IL-10 in vitro. To further investigate the mechanisms involved in immunosuppresssion in fatal rickettsiosis, we next examined whether R. conorii-induced CD4 CD25 cells in a lethal infection were suppressive T-reg cells. Since we found a suppressed type 1 immune response and inhibited proliferation of CD4 T cells with T-cell receptor stimulation in a lethal infection but not in a sublethal infection, we characterized only the suppressive activity of CD4 CD25 T cells from a lethal infection in vitro. We purified CD4 CD25 and CD4 CD25 cells from the spleens of lethally infected mice on day 6 postinfection. Purified CD4 CD25 T cells underwent significant proliferation after stimulation with anti-cd3 alone, as assessed using CFSE dilutions; however, the proliferation was suppressed by addition of CD4 CD25 T cells (see Fig. S1 in the supplemental material). Furthermore, IL-2 production by purified anti-cd3-stimulated CD4 CD25 T cells, CD4 CD25 T cells, and a mixture of the two populations was measured by ELISA. The presence of CD4 CD25 cells inhibited production of IL-2 by CD4 CD25 cells even at a ratio of CD25 cells to CD25 cells of 10:1 (Fig. 5A). The inhibitory function of CD4 CD25 cells was not dose dependent as similar inhibition of IL-2 production by CD4 CD25 cells was observed at a ratio of CD25 cells to CD25 cells of 4:1 or 1:1. The suppressive effects of CD4 CD25 T cells on cocultured CD4 CD25 T cells were consistent with decreased IL-2 production by splenocytes (Fig. 2B), IL-2 intracellular staining (Fig. 4B), and suppressed CD4 T-cell proliferation (Fig. 2A) in lethally infected mice. To further determine the phenotype of CD4 CD25 T-reg cells and whether these cells suppress rickettsia-specific cytokine production by effector CD4 CD25 T cells, we examined IFN- and IL-10 production by purified splenic CD4 CD25 cells stimulated with rickettsiae and irradiated accessory cells in the presence or absence of CD4 CD25 T cells. Interestingly, CD4 CD25 T cells produced significantly higher levels FIG. 5. Purified CD4 CD25 T cells from lethally infected C3H mice suppressed IL-2 production by CD4 CD25 cells but were also the major cells that produced IFN- and IL-10. Splenocytes were collected from lethally infected C3H mice on day 6 postinfection. CD4 CD25 and CD4 CD25 cells were purified as described in Materials and Methods. CD4 CD25 cells were cocultured with CD4 CD25 cells at ratios of 1:0, 10:1, 4:1, 1:1, and 0:1 in the presence of anti-cd3 (0.25 g/ml) and irradiated syngeneic splenocytes for 18 h. (A) IL-2 concentration in the supernatant measured by ELISA. Purified CD4 CD25 cells were cocultured with CD4 CD25 cells at ratios of 1:0, 10:1, and 0:1 and then stimulated with R. conorii (MOI, 5) for 3 days. The supernatants were collected for ELISA of IFN- (B) and IL-10 (C). The bars and error bars indicate the means and standard deviations for triplicate cultures. *, statistically significant difference (P 0.01, as determined using a two-tailed t test).

8 VOL. 77, 2009 T-REG CELLS IN RICKETTSIAL INFECTION 3845 of both IFN- and IL-10 than CD4 CD25 cells in response to rickettsial stimulation (P 0.05) (Fig. 5B and C). Our data suggest that CD4 CD25 cells are the major source of both IFN- and IL-10. Regardless of whether the IFN- - and IL- 10-producing CD4 CD25 T cells represent a heterogeneous population containing both effector T cells and inducible regulatory cells, it is likely that higher levels of IL-10 production by CD4 CD25 T cells than by CD4 CD25 T cells play a critical role in antigen-specific suppression of the immune response in lethally infected mice. Phenotypic characteristics and cytokine profiles of CD4 CD25 T-reg cells induced by R. conorii infection in vivo. To further characterize the phenotype of the heterogeneous IFN- - and IL-10-producing CD4 CD25 T-cell population in lethally infected mice, we examined multiple markers of effector and regulatory cells, such as T-bet (expressed in effector Th1 cells), Foxp3, CD103, and CTLA-4, as well as intracellular cytokine production directly ex vivo. Consistent with the data described above, both lethally and sublethally infected mice had lower but comparable percentages of Foxp3 CD4 CD25 T cells in the spleen than uninfected mice. However, splenic CD4 CD25 T cells from lethally infected mice expressed higher levels of T-bet, CD103, and CTLA-4, particularly intracellular CTLA-4, than splenic CD4 CD25 T cells from uninfected and sublethally infected mice (Fig. 6A). Analysis of intracellular cytokines in CTLA-4 Foxp3 CD4 CD25 T cells from lethally infected mice revealed that the majority of IFN- - and IL-10-producing cells were members of the CD4 CD25 cell population and that a small fraction of IFN- or IL-10 was produced by CD4 CD25 cells (Fig. 6B). More importantly, only similar small percentages of CD4 CD25 T cells were producers of both IFN- and IL-10 in sublethally (0.8%) and lethally (0.7%) infected mice (Fig. 6C). This observation suggested that IFN- and IL-10 were produced by different CD4 CD25 T cells in both groups of infected mice, with a very high ratio of IFN- to IL-10 ( 5:1) in sublethally infected mice but a low ratio of IFN- to IL-10 (1:1) in lethally infected mice. These results were consistent with the characteristics of CD4 CD25 T cells observed in vitro (Fig. 5B and C), which suggested that suppressive CD4 CD25 T cells from lethally infected mice were composed of two T-cell subsets: a low number of IFN- -producing Th1 effector cells and a high number of IL-10-producing adaptive T-reg cells. Depletion of CD25 T cells prior to lethal challenge did not change the disease progression but enhanced the systemic type 1 immune response. To further identify the contribution of CD4 CD25 cells to the suppressive immune response against R. conorii in vivo, we depleted CD25 cells in lethally infected mice by using anti-cd25 MAb. More than 90% depletion of CD4 CD25 T cells was achieved in uninfected mice, compared to 60% in infected mice, 8 days after anti- CD25 was administered (Fig. 7A). However, partial depletion of CD25 T cells did not significantly increase or decrease the survival rate (Fig. 7B), but it did result in significantly increased bacterial burdens in the lungs and liver (Fig. 7C) compared to the bacterial burdens in nondepleted lethally infected mice. Interestingly, although anti-cd25 MAb-mediated depletion of CD25 T cells significantly decreased the percentage of antigen-specific IFN- -producing CD4 T cells in the splenic site of infection (Fig. 7D), it significantly increased the systemic level of IFN-, but not the level of IL-10, compared to the levels in nondepleted lethally infected mice (Fig. 7E). DISCUSSION Our recent in vitro study demonstrated that rickettsiae can target DCs to promote T-reg cell expansion, resulting in suppressive adaptive immunity in susceptible C3H mice (10). Until now, there have been no reported studies of the role of CD4 T cells and the phenotypes of CD4 T cells that develop in a host defense against rickettsial infection and the mechanisms by which immunosuppression is generated and maintained in a fatal murine model of spotted fever rickettsiosis in vivo. On the basis of the inability of spleen cells to secrete IL-2 upon stimulation with mitogen, immunosuppression was suggested to occur during infection of C3H mice with a lethal dose of R. conorii (47). The animal models that we used in this study mimic the pathogenesis of severe and mild human rickettsial infection and provided valuable materials for mechanistic investigation (47). The results presented in this study indicate for the first time that marked antigen-specific suppression of the splenic CD4 T-cell response and the suppressed type 1 immune response account for the impaired immune response in acute murine severe spotted fever rickettsiosis. Acute severe human rickettsial diseases have been characterized as diseases that stimulate a dominant type 1 immunity and unresponsiveness or suppression of CD4 T cells with transient immune dysregulation (6, 7, 26). Our study provides strong evidence that supports the hypothesis that there is a suppressed CD4 Th1-cell response during lethal rickettsial infection in mice, including (i) inhibition of IFN- production by spleen cells in response to rickettsial stimulation compared to the production in sublethally infected mice (Fig. 1A); (ii) a serum level of IFN- significantly lower than that in sublethally infected mice (Fig. 1B); (iii) suppressed or unresponsive proliferation of CD4 T cells in response to anti-cd3 or specific antigen stimulation (Fig. 2A) and inhibition of IL-2 production by splenocytes (Fig. 2B); and (iv) a lower frequency of antigenspecific IFN- -producing CD4 T cells and CD4 CD25 T cells than that in sublethally infected mice (Fig. 4A and 6B). The immunosuppression induced by a high dose of rickettsiae may account for the uncontrolled bacterial burden, systemic dissemination, and overwhelming infection. The suppressed immune response observed in mice infected with a lethal dose of R. conorii was associated with substantial, significantly greater expansion of CD4 CD25 Foxp3 T-reg cells in the infection sites. Our previous in vitro study showed that DCs from susceptible C3H mice promote the expansion of Foxp3 CD4 T cells in a DC T-cell coculture system in response to R. conorii infection and in the presence of a high concentration of IL-2 (10). IL-2 is essential for development of natural Foxp3 T-reg cells (35). Thus, the decline in the number of Foxp3 T-reg cells in the spleen in vivo could be due to the low level of IL-2 in lethally infected mice produced by effector CD4 T cells (Fig. 2B and 4B). Very recently, Ertelt et al. indicated that selective priming proliferation of Foxp3 CD4 T cells is a distinguishing feature of acute bacterial infection (9), which is consistent with our observation. A lethal rickettsial infection induced a heterogeneous CD4

9 FIG. 6. Splenic CD4 CD25 T-reg cells induced by a lethal dose of R. conorii were CTLA-4 high Foxp3 T-bet IFN- IL-10. Mice were inoculated with different doses of R. conorii as described in Materials and Methods. On day 5 postinfection, spleen cells were collected and analyzed for surface expression of CD4 and CD25. (A) Cells were stained with anti-cd103 on the membrane and with anti-ctla-4, anti-foxp3, and anti-t-bet intracellularly. The histograms show expression profiles of gated CD4 CD25 cells from uninfected and infected spleens. The numbers indicate the percentages of cells expressing the regulatory markers. (B) Expression levels of CD25, IFN-, and IL-10 on gated splenic CD4 T cells. (C) Production of IFN- and IL-10 in gated splenic CD4 CD25 cells. Splenocytes were pooled from three mice in each group. The results are representative of two independent experiments with similar designs. uninfect, uninfected. 3846

10 VOL. 77, 2009 T-REG CELLS IN RICKETTSIAL INFECTION 3847 Downloaded from FIG. 7. Depletion of CD25 cells prior to lethal challenge with R. conorii did not improve survival but enhanced the systemic type 1 immune response. As described in Materials and Methods, 1 mg of rat anti-mouse CD25 MAb was inoculated intraperitoneally into mice 3 days before infection with a lethal dose of R. conorii to deplete CD25 cells in vivo. (A) Flow cytometric data showing the frequency of splenic CD4 CD25 T cells from uninfected and infected mice on day 8 after anti-cd25 MAb treatment. Nondepleted mice served as controls. The data are the data from one experiment with three mice per group. (B) Survival of mice inoculated with a lethal dose of R. conorii and treated with anti-cd25. (C) Bacterial loads in tissues from lethally infected mice with or without Ab treatment on day 5 postinfection as determined by quantitative real-time PCR. The bars and error bars indicate the means and standard deviations for three mice in each group. (D) Frequency of antigen-specific IFN- - and IL-10-producing splenic CD4 T cells as determined by flow cytometry following in vitro stimulation with rickettsial antigens. The frequency of antigen-specific cytokine-producing CD4 T cells was determined by subtracting the percentage of cytokine-producing CD4 T cells in cultures with medium only from the percentage of cytokine-producing CD4 T cells in cultures with rickettsial antigen stimulation. (E) Serum concentrations of IFN- and IL-10 in untreated or Ab-treated mice measured on day 5 after infection with a lethal dose of R. conorii. The data are the means and standard errors of the means for the results obtained from three mice per group. *, P uninfect, uninfected; GAPDH, glyceraldehyde-3-phosphate dehydrogenase gene copies. on December 14, 2018 by guest CD25 Foxp3 T-cell population consisting of IL-10-producing adaptive T-reg cells and IFN- -producing T-effector cells. In response to an infectious pathogen, adaptive T-reg cells in peripheral lymphoid tissues are frequently Foxp3 (31, 36). The splenic CD4 CD25 T-reg cell population in a lethal R. conorii infection is different from the Th1-like T-reg cell population due to the absence of Foxp3 expression (39) and different from IFN- - and IL-10-producing or multifunctional CD4 T cells described previously for microbial infections in humans and in mice (1, 17, 20, 30, 42). However, some IL-10- producing T-reg 1 cells that develop from conventional T cells also produce IFN- (32, 42, 44), and their induction is dependent on IL-10. Other studies have shown that murine T-reg 1 cells rarely secrete IFN- (2). Whether the induction and the

11 3848 FANG ET AL. INFECT. IMMUN. suppressive function of IL-10-producing adaptive CD4 CD25 T-reg cells in acute severe murine spotted fever rickettsiosis are dependent on IL-10 in vivo requires further investigation. Taken together, the data indicate that splenic CD4 CD25 T-reg cells induced by a lethal infection with R. conorii may represent a novel phenotype of adaptive cells that are Th1-like. Partial depletion of CD25 T-reg cells in vivo in a lethal infection with R. conorii did not change the disease progression but resulted in a significantly increased bacterial burden, decreased the local IFN- -producing CD4 Th1 cell response, and enhanced the systemic type 1 immune response. These data suggest that CD4 CD25 T-reg cells not only contribute greatly to suppressing the systemic type 1 immune response against rickettsial infection but also contribute to local bacterial control. We propose the following possibilities that explain the role of CD4 CD25 T-reg cells in a lethal infection with R. conorii. (i) CD4 CD25 T cells are the IFN- -producing T-effector cells, as well as suppressive T-reg cells in infection sites. Anti-CD25 MAb depleted the whole population of CD4 CD25 T cells, including IFN- -producing T-effector cells, which could explain the increased rickettsial burden in liver and lungs in Ab-treated mice compared to the burden in control mice group. (ii) CD4 CD25 T-reg cells may directly inhibit other IFN- -producing cells, such as CD8 T cells and/or NK cells, in response to rickettsial infection, which may explain the enhanced systemic type 1 immune response after depletion. (iii) CD4 CD25 T-reg cells may control trafficking of IFN- -producing effector cells to the sites of infection, such as the spleen, through production of chemokines. Interestingly, a recent study suggested that CD25 T-reg cells facilitate early immune responses to local viral infection, at least in part by regulating homing of immune effector cells to sites of infection via mediating production of CCL2 and CCR5 chemokines (24). Further experiments that examine the effect of CD25 cell depletion on local and systemic chemokine production and migration of other effector cells, such as IFN- producing CD8 T cells and NK cells, to peripheral sites of infection in lethally infected mice could distinguish between these possibilities. Finally, (iv) CD4 CD25 T-reg cells may be partially responsible for immunosuppresssion, while other immune regulatory molecules or cells, such as CD8 T-reg cells, are also involved. Protective immunity against Rickettsia is associated simultaneously with an increased level of IFN- and a reduced level of IL-10 in the serum (Fig. 1A). Antibodymediated CD25 T-reg cell depletion neither enhanced the IL-10-producing CD4 T-cell response nor reduced the IL-10 concentration in the serum (Fig. 7D and E), which suggests that IL-10 may contribute greatly to the immune regulatory mechanisms independent of CD4 CD25 T-reg cells. Thus, it is possible that IL-10-producing antigen-presenting cells, such as DCs, are involved in the immunosuppression, in addition to the suppression mediated by CD4 CD25 T-reg cells. Indeed, there is accumulating evidence that interactions between DCs and T-reg cells, rather than T-reg cells alone, play a crucial role in the balance between an efficient immune response and tolerance (19, 28). The latter conclusion is supported by our in vitro data showing greater production of IL-10 by DCs from susceptible C3H mice than by DCs from resistant B6 mice (data not shown). In addition, our previous in vitro study showed that rickettsia-infected DCs are the cells that induce the suppressive CD4 Th1-cell response (10). Further evidence for the potential role of other immune regulatory mechanisms in the immunosuppression includes the finding that suppressed proliferation of CD4 T cells was not reversed by addition of a high concentration of IL-2 in lethally infected mice (Fig. 2), which suggests that the suppressed proliferation and function of T cells are not just due to the competition for IL-2 by T-reg cells with T effector cells. CTLA-4 has been demonstrated to correlate with the suppressive function of CD4 CD25 T-reg cells (4, 34, 49). It is possible that CD4 CD25 T-reg cells mediated the immunosuppression via CTLA-4 in lethal infections with R. conorii. Taken together, the data obtained in this study demonstrated that immunosuppression developed in an acute severe infection caused by the intracellular bacterium R. conorii. This intracellular pathogen induced a novel phenotype of suppressive T-reg cells that produced both IFN- and IL-10, were CD4 CD25 T-bet Foxp3 CTLA-4 high, and were composed of different subsets, including effector and inducible regulatory T cells. Our studies provided strong evidence that this novel T-reg cell population contributed greatly to the profound immunosuppression via as-yet-unidentified mechanisms that may involve IL-10 production, CTLA-4, or an indirect process via an influence on DC functions. Understanding the mechanisms by which immunosuppression is generated and mediated would increase our understanding of the pathogenesis of rickettsial infection. Our results also emphasize the conclusion that when designing a safe and protective vaccine or immunotherapeutic strategies against rickettsiae, workers should avoid immunosuppressive mechanisms. ACKNOWLEDGMENTS This work was supported by grant AI from the National Institute of Allergy and Infectious Diseases. We thank Lynn Soong for helpful discussions, Doris Baker and Sherrill Hebert for their excellent secretarial assistance, and James J. Grady for his contribution of statistical expertise. We also express our gratitude to Emily Crossley, Thomas Bednarek, Donald Bouyer, and Patricia Crocquet-Valdes for their support and assistance during this project. We have no financial conflict of interest. REFERENCES 1. Anderson, C. F., M. Oukka, V. J. Kuchroo, and D. Sacks CD4 CD25 Foxp3 Th1 cells are the source of IL-10-mediated immune suppression in chronic cutaneous leishmaniasis. J. Exp. Med. 204: Battaglia, M., S. Gregori, R. Bacchetta, and M. G. Roncarolo Tr1 cells: from discovery to their clinical application. Semin. Immunol. 18: Belkaid, Y., and B. T. Rouse Natural regulatory T cells in infectious disease. Nat. Immunol. 6: Birebent, B., R. Lorho, H. Lechartier, S. de Guibert, M. Alizadeh, N. Vu, A. Beauplet, N. Robillard, and G. Semana Suppressive properties of human CD4 CD25 regulatory T cells are dependent on CTLA-4 expression. Eur. J. Immunol. 34: Cabrera, R., Z. Tu, Y. Xu, R. J. Firpi, H. R. Rosen, C. Liu, and D. R. Nelson An immunomodulatory role for CD4 CD25 regulatory T lymphocytes in hepatitis C virus infection. Hepatology 40: Cillari, E., S. Milano, P. D Agostino, F. Arcoleo, G. Stassi, A. Galluzzo, P. Richiusa, C. Giordano, P. Quartararo, P. Colletti, G. Gambino, C. Mocciaro, A. Spinelli, G. Vitale, and S. Mansueto Depression of CD4 T cell subsets and alteration in cytokine profile in boutonneuse fever. J. Infect. Dis. 174: de Sousa, R., N. Ismail, S. D. Nobrega, A. França, M. Amaro, M. Anes, J. Poças, R. Coelho, J. Torgal, F. Bacellar, and D. H. Walker Intralesional expression of mrna of interferon-gamma, tumor necrosis factoralpha, interleukin-10, nitric oxide synthase, indoleamine-2,3-dioxygenase, and RANTES is a major immune effector in Mediterranean spotted fever rickettsiosis. J. Infect. Dis. 196: