Supplementary Figure Legends. group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH2.1).
|
|
|
- Ethel Patrick
- 5 years ago
- Views:
Transcription
1 Supplementary Figure Legends Supplemental Figure : Naïve T cells express Siglec-G. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n= per group) and analyzed for Siglec-G expression utilizing a monoclonal antibody to Siglec-G (clone SH.). (a) isotype control, (b) B + B cells, (c) Siglec-G -/- T cells, (d) / dilution, (e) / dilution, (f) / dilution, (g) / dilution. Data shown are representative of one of three similar experiments. Supplemental Figure : Phenotypic analysis of various T cell subsets and activation markers in naïve Siglec-G -/- and WT B animals. Splenocytes were isolated from WT B or Siglec-G -/- animals that have not been transplanted (n=- per group) and analyzed for absolute total splenocyte numbers (a), the percentages and absolute numbers of CD + and CD8 + T cells (b), naïve (CD - CDL + ), effector memory (EM: CD + CD - ), central memory (CM: CD + CDL + ) subsets(c), activation marker expression (CD and CD9) in CD + or CD8 + T cells (d-g), and regulatory T cells (Treg: CD + CD + Foxp + )(h). Error bars show the mean ± SEM. Supplemental Figure : Siglec-G in T cells represses its responses in the presence of DAMP. (a) Isolated splenic CD9. + T cells from either B-WT or Siglec-G -/- animals were incubated with anti- CD (ug/ml) and anti-cd8 (ug/ml) antibodies in the presence or absence of HMGB (µg/ml) for 8 hours and analyzed for proliferation following H-thymidine incorporation during the last hours of incubation. Representative data from one of three independent experiments are shown. Unpaired t test, ***p<.. (b) Protein expression of phosphorylate (p)-stat, total STAT at hour (STAT-) was evaluated by western blot. Representative data from one of two independent experiments are shown. Representative image and quantification data are shown on top and bottom, respectively.
2 (c) Phosphorylated LCK levels were analyzed by FACS at hours after stimulation. Combined data from different experiments are shown. (d) Protein analyses of phosphorylate (p)-shp, total SHP- by western blot were performed at 8 hours after stimulation. Representative data from one of two independent experiments are shown. A representative image and quantification data are shown in the top and bottom, respectively. (e-f) TIGIT (e) and Lag (f) expression were analyzed by FACS at or 8 hours after stimulation. Pooled data from three independent experiments are shown. The bar shows the mean ± SEM. Supplemental Figure : Syngeneic Siglec-G -/- T cells showed equivalent donor T cell expansion and activation in allo-bmt. (a-c) B Ly. animals received Gy on day - and were transplanted with.7x CD9. + splenic T cells from syngeneic either B-WT or B-Siglec-G -/- animals along with x TCD-BM from B donors. (a) Donor T cell (CD. + CD + CD8 + ) expansion in the spleen and intraepithelial lymphocytes (IEL) at days 7 after BMT (n= per group). (b-c) CD9 + expression of donor T cells in spleen (b) or IEL at day 7 after BMT (n= per group). The bar shows the mean ± SEM. Supplemental Figure : Donor Siglec-G -/- T cells exacerbate GVHD in experimental model. (a-d) BALB/c animals received 8.Gy on day - and were transplanted with.7x CD9. + splenic T cells from either syngeneic BALB/c or allogeneic MHC-mismatched B-WT or B-Siglec-G -/- animals along with x TCD-BM from either BALB/c or B donors. (a-b) Donor CXCR + T cell expansion in the spleen (a) and CD9 + T cell in the liver (b) at day after allo-bmt (n=7-8 per group, pooled from two experiments). Unpaired t test, *p<., **p<.. The bar shows the mean ± SEM. (c) Serum IL-7A
3 levels at day after allo-bmt (n=8- per group, pooled from three experiments). (d) The representative figures in the lung at day after allo-bmt (n=- per group, pooled from two experiments). Supplemental Figure : Enhancing Siglec-G-CD axis by CDFc attenuates GVHD severity. BALB/c-WT animals were lethally irradiated with 8.Gy and infused with.7x CD9 + T cells along with x TCD-BM cells from either syngeneic BALB/c-WT or allogeneic MHC-mismatched B donors. The recipients were injected with the CDFc (mg/kg) or diluent control on day before allo-bmt. (a) Overall survival and (b) GVHD clinical score, n=- per group, pooled from three experiments. Unpaired t test p<. is considered significant following value Bonferroni correction ***p<., **p<., *p<. when control vs. CDFc treatment groups were compared. The bar shows the mean ± SEM.
4 Supplemental Figure isotype B cells Siglec-G -/- T cells a b c Sample() - R Sample() - R Sample() - R 7 R:.999% R: 99.% R:.% d e f g WT-T cells (/) WT-T cells (/) WT-T cells (/) WT-T cells (/) Sample() - R Sample(7) - R Sample(9) - R Sample() - R 7 R:.% R:.% R:.77% R:.%
5 Supplemental Figure a [x ] splenocytes b [%] [x ] B WT B Siglec-G -/- CD + CD8 + CD + CD8 + C [%] 8 [x ] d CD + CD + [%] [x ] 8 Naive EM CM Naive EM CM Naive EM CM Naive EM CM CD + CD8 + CD + CD8 + e CD + CD8 + f CD9 + CD + g CD9 + CD8 + [%] [x ] [%] [x ] [%] [x ] h CD + CD + Foxp + [%] [x ]......
6 Supplemental Figure a CD/CD8 (8hr) b c plck [CPM, x ] WT [CPM, Siglec-G -/- x ] *** P-STAT WT Sig WT Sig WT Sig. 8 STAT β-actin Ratio of pstat to total STAT MFI fold change... CD/CD HMGB (ug/ml) HMGB- (ug/ml) BWT BSiglec-G -/- BWT+HMGB- BSiglec-G -/- +HMGB- d P-SHP SHP WT Sig WT Sig WT Sig e [%] 8 TIGIT f [%] 8 Lag β-actin Ratio of pshp- to total SHP- CD/CD HMGB- (ug/ml) Naive hr 8hr Naive hr 8hr Naive hr 8hr Naive hr 8hr CD + T cell CD8 + T cell CD + T cell BWT BSiglec-G -/- BWT+HMGB- BSiglec-G -/- +HMGB- CD8 + T cell
7 Supplemental Figure a Donor T cell expansion (Day 7) b CD9 + (Spleen, Day 7) c CD9 + (IEL, Day 7) [x ] Spleen [x ] IEL CD + CD8 + [x ] [x ] CD + CD8 + [x ] [x ] BBM+BTàB BBM+BSiglec-G -/- TàB
![.8 b CD9 + (Liver, Day ) [%] CD + [%] CD8](/docs-images/95/123272950/images/8-1.jpg "+ ** * 8 c IL-7A (Day ) [pg/ml].")
8 Supplemental Figure a CXCR + (Day ) CD CD8 + [x + ] [x ]..8 b CD9 + (Liver, Day ) [%] CD + [%] CD8 + ** * 8 c IL-7A (Day ) [pg/ml] BBM+BTàBALB/c BBM+Siglec-G -/- TàBALB/c d Lung BALB/cBM+BALB/cTàBALB/c BBM+BTàBALB/c BBM+Siglec-G -/- TàBALB/c
9 Supplemental Figure a b Survival (%) 8 * GVHD Clinical Score *** ** ** * ** After BMT (d) BALB/cBM+BALB/cT àbalb/c BBM+BTàBALB/c BBM+BTàBALB/c+ CD Fc After BMT (w) BALB/cBM+BALB/cT àbalb/c BBM+BTàBALB/c BBM+BTàBALB/c+CDFc
10 Supplemental Table. Role of Siglec-G-CD axis and the results of CDFc treatment in BMT models. Donor T cells Host APCs Treatment GVHD B-WT BALB/c-WT (-) B-WT BALB/c-WT CDFc B-WT BALB/c-CD -/- (-) B-WT BALB/c-CD -/- CDFc B-Siglec-G -/- B-CD -/- (-) B-Siglec-G -/- B-CD -/- CDFc B-CD -/- BALB/c-CD -/- (-) B-CD -/- BALB/c-CD -/- CDFc
MATERIALS AND METHODS. Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All
MATERIALS AND METHODS Antibodies (Abs), flow cytometry analysis and cell lines Neutralizing antibodies specific to mouse Dll1, Dll4, J1 and J2 were prepared as described. 1,2 All other antibodies used
Siglec-G represses DAMP-mediated effects on T cells
Siglec-G represses DAMP-mediated effects on T cells Tomomi Toubai, 1 Corinne Rossi, 1 Katherine Oravecz-Wilson, 1 Cynthia Zajac, 1 Chen Liu, 2 Thomas Braun, 3 Hideaki Fujiwara, 1 Julia Wu, 1 Yaping Sun,
Supplemental Figure 1. Protein L
Supplemental Figure 1 Protein L m19delta T m1928z T Suppl. Fig 1. Expression of CAR: B6-derived T cells were transduced with m19delta (left) and m1928z (right) to generate CAR T cells and transduction
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with
Supplementary Figure S1. PTPN2 levels are not altered in proliferating CD8+ T cells. Lymph node (LN) CD8+ T cells from C57BL/6 mice were stained with CFSE and stimulated with plate-bound α-cd3ε (10µg/ml)
Supplementary Figure 1. Characterization of basophils after reconstitution of SCID mice
Supplementary figure legends Supplementary Figure 1. Characterization of after reconstitution of SCID mice with CD4 + CD62L + T cells. (A-C) SCID mice (n = 6 / group) were reconstituted with 2 x 1 6 CD4
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured
Supplemental Figure 1. Signature gene expression in in vitro differentiated Th0, Th1, Th2, Th17 and Treg cells. (A) Naïve CD4 + T cells were cultured under Th0, Th1, Th2, Th17, and Treg conditions. mrna
Supplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
SUPPLEMENTARY FIGURE 1
SUPPLEMENTARY FIGURE 1 A LN Cell count (1 ) 1 3 1 CD+ 1 1 CDL lo CD hi 1 CD+FoxP3+ 1 1 1 7 3 3 3 % of cells 9 7 7 % of cells CD+ 3 1 % of cells CDL lo CD hi 1 1 % of CD+ cells CD+FoxP3+ 3 1 % of CD+ T
B220 CD4 CD8. Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN
B220 CD4 CD8 Natarajan et al., unpublished data Figure 1. Confocal Image of Sensitized HLN. Representative image of a sensitized HLN showing B cell follicles and T cell areas. 20 µm thick. Image of magnification
SUPPLEMENTARY INFORMATION
doi:1.138/nature1554 a TNF-α + in CD4 + cells [%] 1 GF SPF 6 b IL-1 + in CD4 + cells [%] 5 4 3 2 1 Supplementary Figure 1. Effect of microbiota on cytokine profiles of T cells in GALT. Frequencies of TNF-α
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk
Supplementary Figure 1. Normal T lymphocyte populations in Dapk -/- mice. (a) Normal thymic development in Dapk -/- mice. Thymocytes from WT and Dapk -/- mice were stained for expression of CD4 and CD8.
D CD8 T cell number (x10 6 )
IFNγ Supplemental Figure 1. CD T cell number (x1 6 ) 18 15 1 9 6 3 CD CD T cells CD6L C CD5 CD T cells CD6L D CD8 T cell number (x1 6 ) 1 8 6 E CD CD8 T cells CD6L F Log(1)CFU/g Feces 1 8 6 p
Supplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
Canberra, Australia). CD11c-DTR-OVA-GFP (B6.CD11c-OVA), B6.luc + and. Cancer Research Center, Germany). B6 or BALB/c.FoxP3-DTR-GFP mice were
Supplemental Materials and Methods Mice Female C57BL/6 (B6, I-E null, H-2 b ), BALB/c (H-2 d ) + ), FVB/N (H-2 q, I-E null, CD45.1 + ), and B6D2F1 (H-2 b/d ) mice were purchased from the Animal Resources
Supplemental Figure Legends
Supplemental Figure Legends Supplemental Figure 1. SemaB / mice have normal immune cell populations. Cells were prepared from the spleens of WT and SemaB / mice, stained with various antibodies and then
Nature Immunology: doi: /ni Supplementary Figure 1. Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice.
Supplementary Figure 1 Cellularity of leukocytes and their progenitors in naive wild-type and Spp1 / mice. (a, b) Gating strategies for differentiated cells including PMN (CD11b + Ly6G hi and CD11b + Ly6G
activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows
Supplemental Data Supplemental Figure 1 compares CXCR4 expression in untreated CD8 + T cells, following activation with anti-cd3/cd28 beads and 3d following transduction. Supplemental Figure 2 shows the
Supplementary Figure 1
d f a IL7 b IL GATA RORγt h HDM IL IL7 PBS Ilra R7 PBS HDM Ilra R7 HDM Foxp Foxp Ilra R7 HDM HDM Ilra R7 HDM. 9..79. CD + FOXP + T reg cell CD + FOXP T conv cell PBS Ilra R7 PBS HDM Ilra R7 HDM CD + FOXP
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity
NKTR-255: Accessing IL-15 Therapeutic Potential through Robust and Sustained Engagement of Innate and Adaptive Immunity Peiwen Kuo Scientist, Research Biology Nektar Therapeutics August 31 st, 2018 Emerging
Supplemental Materials
Supplemental Materials Programmed death one homolog maintains the pool size of regulatory T cells by promoting their differentiation and stability Qi Wang 1, Jianwei He 1, Dallas B. Flies 2, Liqun Luo
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies
NKTR-255: Accessing The Immunotherapeutic Potential Of IL-15 for NK Cell Therapies Saul Kivimäe Senior Scientist, Research Biology Nektar Therapeutics NK Cell-Based Cancer Immunotherapy, September 26-27,
SUPPLEMENT Supplementary Figure 1: (A) (B)
SUPPLEMENT Supplementary Figure 1: CD4 + naïve effector T cells (CD4 effector) were labeled with CFSE, stimulated with α-cd2/cd3/cd28 coated beads (at 2 beads/cell) and cultured alone or cocultured with
Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD-
Supplementary Methods Blocking antibodies and peptides. Rat anti-mouse PD-1 (29F.1A12, rat IgG2a, k), PD- L1 (10F.9G2, rat IgG2b, k), and PD-L2 (3.2, mouse IgG1) have been described (24). Anti-CTLA-4 (clone
NK cell flow cytometric assay In vivo DC viability and migration assay
NK cell flow cytometric assay 6 NK cells were purified, by negative selection with the NK Cell Isolation Kit (Miltenyi iotec), from spleen and lymph nodes of 6 RAG1KO mice, injected the day before with
and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the
Supplementary Figure 1. LAG3 + Treg-mediated regulation of germinal center B cells and follicular helper T cells is Egr2-dependent. (a) Diagrammatic representation of the experimental protocol for the
W/T Itgam -/- F4/80 CD115. F4/80 hi CD115 + F4/80 + CD115 +
F4/8 % in the peritoneal lavage 6 4 2 p=.15 n.s p=.76 CD115 F4/8 hi CD115 + F4/8 + CD115 + F4/8 hi CD115 + F4/8 + CD115 + MHCII MHCII Supplementary Figure S1. CD11b deficiency affects the cellular responses
SUPPLEMENTARY INFORMATION
Supplemental Figure 1. Furin is efficiently deleted in CD4 + and CD8 + T cells. a, Western blot for furin and actin proteins in CD4cre-fur f/f and fur f/f Th1 cells. Wild-type and furin-deficient CD4 +
Supplemental Materials for. Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to. FTY720 during neuroinflammation
Supplemental Materials for Effects of sphingosine-1-phosphate receptor 1 phosphorylation in response to FTY7 during neuroinflammation This file includes: Supplemental Table 1. EAE clinical parameters of
Modulating STAT Signaling to Promote Engraftment of Allogeneic Bone Marrow Transplant
Modulating STAT Signaling to Promote Engraftment of Allogeneic Bone Marrow Transplant Jacopo Mariotti, M.D. Center for Cancer Research, NCI, NIH Istituto Nazionale Tumori, Milano Verona; May 22, 2009 Non-myeloablative
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs
Supplementary Fig. 1 p38 MAPK negatively regulates DC differentiation. (a) Western blot analysis of p38 isoform expression in BM cells, immature DCs (idcs) and mature DCs (mdcs). A myeloma cell line expressing
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-10. Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald,
Human and mouse T cell regulation mediated by soluble CD52 interaction with Siglec-1 Esther Bandala-Sanchez, Yuxia Zhang, Simone Reinwald, James A. Dromey, Bo Han Lee, Junyan Qian, Ralph M Böhmer and Leonard
Supplemental Table I.
Supplemental Table I Male / Mean ± SEM n Mean ± SEM n Body weight, g 29.2±0.4 17 29.7±0.5 17 Total cholesterol, mg/dl 534.0±30.8 17 561.6±26.1 17 HDL-cholesterol, mg/dl 9.6±0.8 17 10.1±0.7 17 Triglycerides,
Supplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
Supplementary Information:
Supplementary Information: Follicular regulatory T cells with Bcl6 expression suppress germinal center reactions by Yeonseok Chung, Shinya Tanaka, Fuliang Chu, Roza Nurieva, Gustavo J. Martinez, Seema
Supplementary Figure 1. Deletion of Smad3 prevents B16F10 melanoma invasion and metastasis in a mouse s.c. tumor model.
A B16F1 s.c. Lung LN Distant lymph nodes Colon B B16F1 s.c. Supplementary Figure 1. Deletion of Smad3 prevents B16F1 melanoma invasion and metastasis in a mouse s.c. tumor model. Highly invasive growth
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice
Supplementary Figure 1. Efficient DC depletion in CD11c.DOG transgenic mice (a) CD11c.DOG transgenic mice (tg) were treated with 8 ng/g body weight (b.w.) diphtheria toxin (DT) i.p. on day -1 and every
ASH 2011 aktualijos: MSC TPŠL gydyme. Mindaugas Stoškus VULSK HOTC MRMS
ASH 2011 aktualijos: MSC TPŠL gydyme Mindaugas Stoškus VULSK HOTC MRMS #3042. Yukiyasu Ozawa et al. Mesenchymal Stem Cells As a Treatment for Steroid-Resistant Acute Graft Versus Host Disease (agvhd);
Children's Hospital of Pittsburgh Annual Progress Report: 2011 Formula Grant
Children's Hospital of Pittsburgh Annual Progress Report: 2011 Formula Grant Reporting Period July 1, 2012 June 30, 2013 Formula Grant Overview The Children's Hospital of Pittsburgh received $228,401 in
Supplementary Data. Treg phenotype
Supplementary Data Additional Experiment An additional experiment was performed using cryopreserved peripheral blood mononuclear cells (PBMC) derived from five renal cell carcinoma (RCC) patients [see
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AWARD NUMBER: W81XWH-11-1-0294 TITLE: Modulation of Memory T Cells to Control Acquired Bone Marrow Failure PRINCIPAL INVESTIGATOR: Yi Zhang RECIPIENT: Temple University Philadelphia, PA 19140 REPORT DATE:
SUPPLEMENTARY INFORMATION
doi:10.1038/nature11095 Supplementary Table 1. Summary of the binding between Angptls and various Igdomain containing receptors as determined by flow cytometry analysis. The results were summarized from
Determinants of Immunogenicity and Tolerance. Abul K. Abbas, MD Department of Pathology University of California San Francisco
Determinants of Immunogenicity and Tolerance Abul K. Abbas, MD Department of Pathology University of California San Francisco EIP Symposium Feb 2016 Why do some people respond to therapeutic proteins?
T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice
SUPPLEMENTAL METHODS T cell protein tyrosine phosphatase attenuates T cell signaling to maintain tolerance in mice Florian Wiede 1, Benjamin J. Shields 1, Sock Hui Chew 1, Konstantinos Kyparissoudis 2,
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was
Supplementary Figure 1. mrna expression of chitinase and chitinase-like protein in splenic immune cells. Each splenic immune cell population was sorted by FACS. Surface markers for sorting were CD11c +
Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice
Supplementary Methods: Cell isolation. Spleen and lymph nodes (axillary, inguinal) were removed from mice and gently meshed in DMEM containing 10% FBS to prepare for single cell suspensions. CD4 + CD25
CD4 + T cells recovered in Rag2 / recipient ( 10 5 ) Heart Lung Pancreas
a CD4 + T cells recovered in Rag2 / recipient ( 1 5 ) Heart Lung Pancreas.5 1 2 4 6 2 4 6 Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas b Heart Lung Pancreas Ctla4 +/+ Ctla4 / Ctla4 / Lung Ctla4 / Pancreas
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
Supplement Material. Spleen weight (mg) LN cells (X106) Acat1-/- Acat1-/- Mouse weight (g)
Supplement Material A Spleen weight (mg) C Mouse weight (g) 1 5 1 2 9 6 3 2 5 2 1 5 Male LN cells (X16) 4 ** ** Female B 3 2 1 Supplemental Figure I. Spleen weight (A), Inguinal lymph node (LN) cell number
Clinical Translation of Immunotherapy using WT1 and CMV specific TCR Gene Transfer
Clinical Translation of Immunotherapy using WT1 and CMV specific Gene Transfer Dr Emma C Morris Reader, Dept of Immunology, UCL Consultant Haematologist (BMT), UCLH and RFH ISCT, 2/5/211 Gene Transfer
T cell manipulation of the graft: Yes
T cell manipulation of the graft: Yes J.H. Frederik Falkenburg Department of Hematology L M U C Allogeneic Hematopoietic Stem Cell Transplantation (SCT) for non-malignant disorders: no need for anti-tumor
L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity
Cell Reports Supplemental Information L-selectin Is Essential for Delivery of Activated CD8 + T Cells to Virus-Infected Organs for Protective Immunity Rebar N. Mohammed, H. Angharad Watson, Miriam Vigar,
Eosinophils are required. for the maintenance of plasma cells in the bone marrow
Eosinophils are required for the maintenance of plasma cells in the bone marrow Van Trung Chu, Anja Fröhlich, Gudrun Steinhauser, Tobias Scheel, Toralf Roch, Simon Fillatreau, James J. Lee, Max Löhning
Supplementary information. Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by. Repeated Stimulation of Antigen-Presenting B Cells
Chien 1 Supplementary information Manuscript: SREP-16-42480A Characterization of c-maf + Foxp3 - Regulatory T Cells Induced by Repeated Stimulation of Antigen-Presenting B Cells Chien-Hui Chien 1, Hui-Chieh
Umbilical Cord Blood-Derived T Regulatory Cells
Umbilical Cord Blood-Derived T Regulatory Cells David H. McKenna, M.D. PACT Workshop - University of Pittsburgh May 5, 2008 Slide 1 Outline Overview of T regulatory (T R ) cells Potential for clinical
Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS.
1 Supplementary Figure 1. Antibiotic partially rescues mice from sepsis. (ab) BALB/c mice under CLP were treated with antibiotic or PBS. (a) Survival curves. WT Sham (n=5), WT CLP or WT CLP antibiotic
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and
Supplementary Figure S1. Flow cytometric analysis of the expression of Thy1 in NH cells. Flow cytometric analysis of the expression of T1/ST2 and Thy1 in NH cells derived from the lungs of naïve mice.
Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression.
Relative Serpin expression 25 2 15 1 5 Serpina3f 1 2 3 4 5 6 8 6 4 2 Serpina3g 1 2 3 4 5 6 C57BL/6 DBA/2 Supplemental Figure 1. Activated splenocytes upregulate Serpina3g and Serpina3f expression. Splenocytes
SUPPLEMENTARY INFORMATION
a. Smo+/+ b. Smo+/+ 5.63 5.48 c. Lin- d. e. 6 5 4 3 Ter119 Mac B T Sca1 Smo+/+ 25 15 2 o BMT 2 1 5 * Supplementary Figure 1: Deletion of Smoothened does not alter the frequency of hematopoietic lineages
Belatacept: An Opportunity to Personalize Immunosuppression? Andrew Adams MD/PhD Emory Transplant Center
Belatacept: An Opportunity to Personalize Immunosuppression? Andrew Adams MD/PhD Emory Transplant Center Disclosure Research Funding from BMS. Learning Objectives -Define belatacept-resistant rejection
SUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES Supplementary Figure 1: Chemokine receptor expression profiles of CCR6 + and CCR6 - CD4 + IL-17A +/ex and Treg cells. Quantitative PCR analysis of chemokine receptor transcript abundance
Appendix Figure S1 A B C D E F G H
ppendix Figure S1 C D E F G H ppendix Figure S1. RT and chemotherapy alter PD-L1 expression in PDC cells. Flow cytometric analysis of PD-L1 expression in () KPC and () Pan02 cells following treatment with
b-catenin and PI3Kd inhibition expands precursor Th17 cells with heightened stemness and antitumor activity
b-catenin and PI3Kd inhibition expands precursor Th17 cells with heightened stemness and antitumor activity Kinga Majchrzak,, Sherine S.L. Chan, Chrystal M. Paulos JCI Insight. 2017;2(8):e90547.. Research
Natural Killer Cells: Development, Diversity, and Applications to Human Disease Dr. Michael A. Caligiuri
Natural Killer Cells: Development, Diversity, November 26, 2008 The Ohio State University Comprehensive Cancer Center The James Cancer Hospital and Solove Research Institute Columbus, Ohio, USA 1 Human
Supplementary Figures
Supplementary Figures Supplementary Figure 1. NKT ligand-loaded tumour antigen-presenting B cell- and monocyte-based vaccine induces NKT, NK and CD8 T cell responses. (A) The cytokine profiles of liver
Nature Medicine doi: /nm.3150
Nature Medicine doi:10.1038/nm.3150 Supplementary Table 1 Primer sequences used for q-pcr analysis Gene Forward primer Reverse primer Abca1 CAGCTTCCATCCTCCTTGTC CCACATCCACAACTGTCTGG Abcg1 GTACCATGACATCGCTGGTG
SDC (Supplemental Digital Content) Figure S1. Percentages of Granzyme B expressing CD8 + T lymphocytes
Figure S1. Percentages of Granzyme expressing D8 + T lymphocytes 13.5% 1.4%.6% 77% 21% 24% 76% 8 8 Granzyme + (%) 6 4 2 Granzyme + (%) 6 4 2 D8 + Tnaive Tcm Tem Temra D8 + D8 + D28 + D8 + D28 null We analyzed
Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver,
a. b. c. Supplementary Figure 1. mtor LysM and Rictor LysM mice have normal cellularity and percentages of hematopoe>c cells. a. Cell numbers of lung, liver, and spleen. b. Cell numbers of bone marrow
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538
Data Sheet TIGIT / NFAT Reporter - Jurkat Cell Line Catalog #60538 Background: TIGIT is a co-inhibitory receptor that is highly expressed in Natural Killer (NK) cells, activated CD4+, CD8+ and regulatory
CD8 CD44 hi but not CD4 CD44 hi memory T cells mediate potent graft antilymphoma activity without GVHD
TRANSPLANTATION From www.bloodjournal.org at STANFORD UNIV MED CTR on March 17, 2011. For personal use only. CD8 CD44 hi but not CD4 CD44 hi memory T cells mediate potent graft antilymphoma activity without
The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF
CORRECTION NOTICE Nat.Immunol. 12, 568 575 (2011) The encephalitogenicity of TH17 cells is dependent on IL-1- and IL-23- induced production of the cytokine GM-CSF Mohamed El-Behi, Bogoljub Ciric, Hong
Immunological alterations in mice irradiated with low doses
Immunological alterations in mice irradiated with low doses "Frédéric Joliot-Curie" National Research Institute for Radiobiology and Radiohygiene, Budapest, Hungary The structure of the immune system INNATE
SUPPLEMENTARY INFORMATION
DOI: 1.138/ncb3355 a S1A8 + cells/ total.1.8.6.4.2 b S1A8/?-Actin c % T-cell proliferation 3 25 2 15 1 5 T cells Supplementary Figure 1 Inter-tumoral heterogeneity of MDSC accumulation in mammary tumor
Dedicated to Gordon. Stem Cell Transplantation: The Journey
Dedicated to Gordon Stem Cell Transplantation: The Journey 1949 Jacobson et al: Radioprotection by lead shielding of the spleen of a lethally irradiated animal 1951 Lorenz et al: Radiation protection
Increased IL-12 induced STAT-4 signaling in CD8 T cells. from aged mice
Increased IL-2 induced STAT-4 signaling in CD8 T cells from aged mice Erin Rottinghaus * Abstract: Aging is associated with poor immune function leading to increased susceptibility to infectious diseases
Supplementary Figure 1
Supplementary Figure 1 Identification of IFN-γ-producing CD8 + and CD4 + T cells with naive phenotype by alternative gating and sample-processing strategies. a. Contour 5% probability plots show definition
NK1.1 þ CD8 þ T cells escape TGF-b control and contribute to early microbial pathogen response
Received 24 Apr 214 Accepted 5 Sep 214 Published 6 Oct 214 DOI: 1.138/ncomms615 NK1.1 þ CD8 þ T cells escape TGF-b control and contribute to early microbial pathogen response Anne L. Ruiz 1,2,3,4, Saidi
Supplementary Fig. 1 No relative growth advantage of Foxp3 negative cells.
Supplementary Fig. 1 Supplementary Figure S1: No relative growth advantage of Foxp3 negative cells. itreg were induced from WT (A) or FIR (B) CD4 + T cells. FIR itregs were then removed from the TCR signal
Rejuvenation of the ageing T cell compartment. Marcel R.M. van den Brink Departments of Medicine and Immunology
Rejuvenation of the ageing T cell compartment Marcel R.M. van den Brink Departments of Medicine and Immunology Conclusions IL-7, KGF and Leuprolide show promise in early clinical trials to enhance post-transplant
B6/COLODR/SPL/11C/83/LAP/#2.006 B6/COLODR/SPL/11C/86/LAP/#2.016 CD11C B6/COLODR/SPL/11C/80/LAP/#2.011 CD11C
CD3-specific antibody-induced immune tolerance and suppression of autoimmune encephalomyelitis involves TGF-β production through phagocytes digesting apoptotic T cells Sylvain Perruche 1,3, Pin Zhang 1,
Harnessing tolerance mechanisms with monoclonal antibodies Prof. Herman Waldmann
Harnessing tolerance mechanisms Herman Waldmann Sir William Dunn School of Pathology, Oxford University, UK 1 1. Transplantation 2 Lymphocyte depletion strategies to minimise drug immunosuppression in
Adoptive transfer strategies: impacting Tregs and vaccines. Carl June, M.D. Personalized Medicine
Adoptive transfer strategies: impacting Tregs and vaccines Personalized Medicine isbtc Oncology Biologics Development Primer Carl June, M.D. Professor of Pathology and Lab Medicine Abramson Cancer Center
Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells
ICI Basic Immunology course Effector mechanisms of cell-mediated immunity: Properties of effector, memory and regulatory T cells Abul K. Abbas, MD UCSF Stages in the development of T cell responses: induction
SUPPLEMENTARY INFORMATION
doi: 1.138/nature775 4 O.D. (595-655) 3 1 -ζ no antibody isotype ctrl Plated Soluble 1F6 397 7H11 Supplementary Figure 1 Soluble and plated anti- Abs induce -! signalling. B3Z cells stably expressing!
% of Cells A B C. Proliferation Index. T cell count (10 6 ) Division Index. % of Max CFSE. %Ki67+ cells. Supplementary Figure 1.
A B C T cell count (1 6 ) 3. 2. 1.. * % of Max CFSE ormoxia ypoxia o Stim. Proliferation Index 2.5 2. 1.5 1. * Division Index 2. 1.5 1..5. D E %Ki67+ cells 1 8 6 4 2 % of Cells 8 ormoxia 6 ypoxia 4 2 *
Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated
1 Supplementary Figure 1. Immune profiles of untreated and PD-1 blockade resistant EGFR and Kras mouse lung tumors (a) Total lung weight of untreated (U) EGFR TL mice (n=7), Kras mice (n=7), PD-1 blockade
L1 on PyMT tumor cells but Py117 cells are more responsive to IFN-γ. (A) Flow
A MHCI B PD-L1 Fold expression 8 6 4 2 Fold expression 3 2 1 No tx 1Gy 2Gy IFN Py117 Py117 Supplementary Figure 1. Radiation and IFN-γ enhance MHCI expression and PD- L1 on PyMT tumor cells but Py117 cells
SUPPLEMENTARY MATERIAL
SUPPLEMENTARY MATERIAL IL-1 signaling modulates activation of STAT transcription factors to antagonize retinoic acid signaling and control the T H 17 cell it reg cell balance Rajatava Basu 1,5, Sarah K.
A crucial role for HVEM and BTLA in preventing intestinal inflammation
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2008 A crucial role for HVEM and BTLA in preventing intestinal inflammation Marcos W. Steinberg La Jolla Institute
STAT3 Transcription Factor Promotes Instability of ntreg Cells and Limits Generation of itreg Cells during Acute Murine Graft-versus-Host Disease
Article STAT3 Transcription Factor Promotes Instability of ntreg Cells and Limits Generation of itreg Cells during Acute Murine Graft-versus-Host Disease Arian Laurence, 1,5, Shoba Amarnath,,5 Jacopo Mariotti,
Nature Immunology: doi: /ni Supplementary Figure 1. Cytokine pattern in skin in response to urushiol.
Supplementary Figure 1 Cytokine pattern in skin in response to urushiol. Wild-type (WT) and CD1a-tg mice (n = 3 per group) were sensitized and challenged with urushiol (uru) or vehicle (veh). Quantitative
Supplementary. presence of the. (c) mrna expression. Error. in naive or
Figure 1. (a) Naive CD4 + T cells were activated in the presence of the indicated cytokines for 3 days. Enpp2 mrna expression was measured by qrt-pcrhr, infected with (b, c) Naive CD4 + T cells were activated
Pearson r = P (one-tailed) = n = 9
8F4-Specific Lysis, % 1 UPN1 UPN3 8 UPN7 6 Pearson r =.69 UPN2 UPN5 P (one-tailed) =.192 4 UPN8 n = 9 2 UPN9 UPN4 UPN6 5 1 15 2 25 8 8F4, % Max MFI Supplementary Figure S1. AML samples UPN1-UPN9 show variable
A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design
A mechanism for glycoconjugate vaccine activation of the adaptive immune system and its implications for vaccine design Fikri Y. Avci 1,2, Xiangming Li 3, Moriya Tsuji 3, Dennis L. Kasper 1,2* Supplementary
Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung. Transplant Function via Depletion of Donor Dendritic Cells
Cytokine Complex Expanded Natural Killer Cells Improve Allogeneic Lung Transplant Function via Depletion of Donor Dendritic Cells Wolfgang Jungraithmayr, Laura Codarri, Gregory Bouchaud,Carsten Krieg,
Does NK cell alloreactivity prevent relapse? Yes!!! Andrea Velardi Bone Marrow Transplant Program University of Perugia
Does NK cell alloreactivity prevent relapse? Yes!!! Andrea Velardi Bone Marrow Transplant Program University of Perugia Recognition of missing self HLA triggers lysis NK Inhibitory receptor Activating
Induction of Immunity to Neuroblastoma Early after Syngeneic Hematopoietic Stem Cell Transplantation Using a Novel Mouse Tumor Vaccine
Biology of Blood and Marrow Transplantation 13:277-292 (2007) 2007 American Society for Blood and Marrow Transplantation 1083-8791/07/1303-0001$32.00/0 doi:10.1016/j.bbmt.2006.11.018 Induction of Immunity
Inability of memory T cells to induce graft-versus-host disease is a result of an abortive alloresponse
TRANSPLANTATION Inability of memory T cells to induce graft-versus-host disease is a result of an abortive alloresponse Benny J. Chen, 1 Divino Deoliveira, 1 Xiuyu Cui, 1 Ngocdiep T. Le, 1 Jessica Son,
A peripheral CD4 + T cell precursor for naive, memory, and regulatory T cells
Ar ticle A peripheral CD4 + T cell precursor for naive, memory, and regulatory T cells Chunfang Zhao and Joanna D. Davies Torrey Pines Institute for Molecular Studies, 3550 General Atomics Court, San Diego,
% of live splenocytes. STAT5 deletion. (open shapes) % ROSA + % floxed
Supp. Figure 1. a 14 1 1 8 6 spleen cells (x1 6 ) 16 % of live splenocytes 5 4 3 1 % of live splenocytes 8 6 4 b 1 1 c % of CD11c + splenocytes (closed shapes) 8 6 4 8 6 4 % ROSA + (open shapes) % floxed
Low Avidity CMV + T Cells accumulate in Old Humans
Supplementary Figure Legends Supplementary Figure 1. CD45RA expressing CMVpp65-specific T cell populations accumulate within HLA-A*0201 and HLA-B*0701 individuals Pooled data showing the size of the NLV/HLA-A*0201-specific