PARTIAL CHARACTERIZATION OF CUCUMBER MOSAIC VIRUS ISOLATES FROM CITRUS AND GRAPEVINE

Transcription

1 Journal of Plant Pathology (2000), 82 (2), Edizioni ETS Pisa, PARTIAL CHARACTERIZATION OF CUCUMBER MOSAIC VIRUS ISOLATES FROM CITRUS AND GRAPEVINE F. Paradies 1, M. Finetti Sialer 1, D. Gallitelli 1, M.A. Castellano 1, A. Di Franco 1, M. Digiaro 2, G.P. Martelli 1 and M.A. Yilmaz 3 1 Dipartimento di Protezione delle Piante e Microbiologia Applicata, Università degli Studi and Centro di Studio del CNR sui Virus e le Virosi delle Colture Mediterranee, Via G. Amendola 165/A, I Bari, Italy 2 Istituto Agronomico Mediterraneo, I Valenzano, Bari, Italy 3 Department of Plant Protection, University of Çukurova, TK Adana, Turkey SUMMARY Three mechanically transmissible viruses recovered from grapevine (isolate YA200) and lemon (isolate L43) in Turkey and from sweet orange (isolate OR) in Italy, were identified as new strains in the subgroup IA of Cucumber mosaic virus (CMV). Particle morphology, electrophoretic pattern of viral nucleic acids, molecular hybridization with CMV-specific riboprobes, and reactions of experimental test plants, conformed to those of CMV. However, differences were observed in the cytopathology. Furthermore, unlike most CMV isolates, none of the strains under study induced the typical fern leaf symptom in tomato, and all systemically infected Chenopodium quinoa and Vigna unguiculata. In the latter, local infection by YA200 was characterized by very few necrotic lesions, whereas no local lesions were induced by L43 and OR. Partial sequencing of RNA-2 showed that amino acid changes occur in the gene coding for protein 2a of all three isolates, a condition that, as shown with other virus strains (CMV-B, CMV-L) seems to confer ability to infect V. unguiculata systemically. YA200, L43 and OR supported replication of a necrogenic satellite RNA, when added to the inoculum as a biologically active transcript. However, the expected necrotic phenotype was co-determined in Rutgers tomato seedlings only by YA200. Unlike YA200, L43 and OR were destabilized by organic solvents used for purification and were thermosensitive, since symptom appearance in herbaceous hosts was strongly inhibited at temperatures above 25 C. CMV has already been recorded from grapevine, but citrus (sweet orange and lemon) represents an addition to the already very wide natural host range of this virus. Key words: Cucumovirus, citrus, grapevine, CMV, cytopathology. Corresponding author: G.P. Martelli Fax: martelli@agr.uniba.it INTRODUCTION In attempts to isolate the agent of citrus chlorotic dwarf (CCD), a putative virus disease of Eastern Mediterranean Turkey (Çinar et al., 1993) transmitted by the whitefly Parabemisia myricae (Çinar et al., 1995), total nucleic acids (TNAs) were extracted according to White and Kaper (1989) from cortical scrapings and leaf tissues of 125 samples collected in 1996 from lemon, sweet orange, Minneola tangelo, and grapefruit trees from different groves of the province of Içel (Mediterranean Turkey), and were mechanically inoculated to herbaceous hosts (Chenopodium quinoa, Gomphrena globosa and Nicotiana clevelandii). About four weeks after inoculation, TNAs from three lemon and two sweet orange samples induced apical stunting and mottling of top leaves of C. quinoa. Sap transmission from symptomatic plants to other C. quinoa seedlings resulted in the slow development of similar symptoms. Concentrated extracts from infected C. quinoa contained isometric virus particles with rounded contour and ca 30 nm in diameter which resembled those of Cucumber mosaic virus (CMV) and that were recognized by an antiserum to CMV (G.P. Martelli, unpublished information). TNAs were stored in ethanol and 2% sodium acetate at -70 C for further studies. In the course of routine surveys in 1998 of citrus viruses in the Ionian coastal plains of Apulia (Southern Italy), a virus was recovered from flowers of a symptomless sweet orange tree by mechanical inoculation to Vigna unguiculata. Subculturing onto C. quinoa induced symptoms that developed slowly and were very similar to those elicited by the Turkish virus isolates in the same host. Moreover, infected herbaceous plants contained isometric CMV-like particles which reacted with an antiserum to this virus (M.A. Castellano, unpublished information). In the grapevine (Vitis vinifera), CMV was first recorded from plants grown in a Danish glasshouse (Petersen, 1978). For many years this record was regarded as a mere scientific curiosity until, in the course of a recent survey of virus diseases in Turkish Thrace (Koklu et al., 1998), CMV was isolated from field-grown

2 134 CMV in citrus and grapevine Journal of Plant Pathology (2000), 82 (2), grapevines of cv. Yapinçap in two different localities (Koklu et al., 1999). This CMV strain had biological traits (e.g. slow invasion of experimental herbaceous hosts, systemic infection of V. unguiculata) that recalled those of the viruses isolated from citrus. The unusual hosts from which these CMV isolates had been recovered and the fact that they seemed to differ biologically from ordinary CMV strains (Kaper and Waterworth, 1981) motivated a comparative study for their characterization. MATERIALS AND METHODS Virus isolates. The viruses used in this investigation came from a Turkish lemon tree (isolate L43), an Apulian sweet orange tree (isolate OR), and a Turkish grapevine of cv. Yapinçap (YA200). CMV- Fny (supplied by Dr. Peter Palukaitis), CMV-S, CMV-FL (Crescenzi et al., 1993) and CMV-77 (Grieco et al., 1997) were used as controls in various experiments. Experimental host range. All isolates were inoculated to plant species of the family Chenopodiaceae (C. quinoa and C. amaranticolor), Amaranthaceae (G. globosa), Leguminosae (Vicia faba, Phaseolus aureus, and V. unguiculata), Cucurbitaceae (Cucumis sativus), and Solanaceae (Nicotiana glutinosa, N. benthamiana, N. occidentalis, N. tabacum Xanthi, Lycopersicon esculentum and Capsicum annuum). Unless otherwise stated, plants were grown in a climatized glasshouse at C, and their reaction to infection was recorded two weeks after inoculation. Effect of temperature on symptom development. Occurrence of thermophobic CMV strains has been reported in several instances (Palukaitis et al., 1992; Gallitelli, 1998). In the course of this study, we noted a strong reduction of symptom severity of isolates L43 and OR in host plants when glasshouse temperature rose accidentally to 30 C. A group of plants of N. glutinosa, V. unguiculata and pepper infected with the three isolates was exposed to C whereas a sister group was kept at C. Virus purification. All viruses were maintained in N. glutinosa from whose systemically infected leaves they were purified days after inoculation. The YA200 isolate was purified as described by Lot et al. (1972) whereas isolates L43 and OR where purified as described by Mossop et al. (1976) avoiding use of organic solvents. Final pellets were suspended in 50 mm NaCl and stored at -20 C in the presence of 30% glycerol and trace amounts of sodium azide. Nucleic acid extraction and analysis. Total nucleic acid (TNA) preparations were obtained from 100 mg of infected tissues according to White and Kaper (1989), whereas viral RNA was extracted from purified virus particles as described by Gallitelli et al. (1988). After ethanol precipitation, nucleic acids were dried under vacuum, resuspended in RNAse-free water (Promega, USA) and stored at -70 C until used. Nucleic acid preparations were analyzed by electrophoresis in 1.2% agarose gel in Tris-borate-EDTA (TBE) (Sambrook et al., 1989) after partial denaturation with 50% deionized formamide at 95 C for 2 min. After electrophoresis, nucleic acid bands were stained with ethidium bromide and observed under U.V. light. Molecular hybridization. Leaves collected from herbaceous hosts days after inoculation, were ground in a plastic bag with a roll press in the presence of 6 vol. (w/v) of 50 mm NaOH, 2.5 mm EDTA. The extract was incubated at room temperature for 5 min, then 5 ml were spotted onto a Nylon membrane (Hybond N +, Amersham Pharmacia Biotech, Sweden) and nucleic acid fixed by U.V. cross-linking. Spotted membranes were pre-hybridized and hybridized with a specific CMV RNA-3 Digoxigenin (DIG)-labelled riboprobe according to Gallitelli and Saldarelli (1996). Hybrid molecules were detected by the DIG luminescent detection kit (Roche, Germany) according to manufacturer s instructions. For Northern analysis, nucleic acid preparations were blotted onto Hybond N + Nylon filters, bound by U.V. and hybridized with a 32 P-labelled riboprobe specific for CMV ORF2b, transcribed with T7 RNA polymerase from clone pspt18 linearized at the BamHI site (L. Barbarossa and D. Gallitelli, unpublished results) according to standard protocols (Gallitelli and Saldarelli, 1996). Synthesis of biologically active transcripts of CMV satellite RNA. A biologically active transcript of CMV- PG satrna (Kaper et al., 1990; Grieco et al., 1997), was synthesised from a psptpg5 plasmid containing cdna of CMV-PG satrna. Ten ng of plasmid were mixed with 50 pmol each of the primer 5 AAGGATC- CGGGTCCTG(CGT)(AGT)(AGT)(AGT)GGAATG3 complementary to 3 end of PG-satRNA and of the primer 5 GGATCCTAATACGACTCACTATA- GTTTTGTTTGTTGGAGACCCGC3 homologous to the 5 end, containing the T7 RNA polymerase promoter (underlined) and amplified with 2.5 units of Taq polymerase (Promega Corp., USA). The mixture was

3 Journal of Plant Pathology (2000), 82 (2), Paradies et al. 135 incubated for 4 min at 94 C followed by 35 cycles at 94 C for 30 sec, 60 C for 1 min, 72 C for 2 min in a Perkin Elmer Cetus Thermal cycler. In the last cycle, extension time was 72 C for 10 min. The amplicons of four separate reactions were pooled and purified by chromatography with Microcon-100 (Millipore, USA) according to manufacturer s instructions. Transcription was performed with the mmessage mmachine Kit (Ambion Inc., USA) using 1 mg of amplified cdna of PG satrna. Transcript size was estimated by agarose gel electrophoresis. The CMV isolates and the satrna transcript were inoculated to C. quinoa, N. occidentalis, and tomato cv. Rutgers. Plants were grown in a climatized glasshouse at C, and kept in the dark for 18 h prior to inoculation with 5 µl per leaf of TE (10 mm Tris-HCl, 1 mm EDTA, ph 7.4) containing 100 ng of either viral RNA alone or in mixture with 200 ng of PG-satRNA. A satrna-free strain of CMV (CMV-FL) (Crescenzi et al., 1993) and plants mock-inoculated with TE buffer served as control. Replication of the PG-satRNA transcript was assessed at two weeks postinoculation by dot blot hybridization analysis with a 32 P-labelled riboprobe specific for PG-satRNA, as described above. Identification of isolate subgroup. A new rapid method based on genome amplification followed by enzymatic digestion (RT-PCR-RFLP) of the RNA-2 5 region was used to establish the subgroup of the isolates. Discrimination is possible because in this region of CMV RNA-2, MluI restriction sites are either not present or occur once or twice. Therefore, after enzymatic digestion of amplicons, electrophoretic profiles in a 2% agarose gel reveal the presence of one, two or three bands respectively, which characterize CMV subgroups IA, IB or II (Finetti Sialer et al., 1999). Primers used for RT-PCR of the 650 nt fragment of the RNA-2 5 region were the degenerate complementary primer 3 RW8 (5 GGTTCGAA(AG)(AG) (AT)ATAACCGGG3, position 618 to 637 in CMV- Fny) and the homologous primer 5 RV11 (5 GTT- TATTTACAAGAGCGTACGG3, position 1 to 22 in CMV-Fny). A similar approach was also used to target RNA-1. A comparative analysis of published CMV RNA-1 sequences, showed (unpublished observation) that in a 408 nt fragment, comprised between positions in CMV-Fny (Acc. no. D00356) a SspI site occurs in all IB strains [CMV-NT9 (Acc. no. D28778), CMV- Tfn (Acc. no. Y16924), CMV-Ixora (Acc. no. U20220), and CMV-SD (Acc. no. AF071551)], a MluI site is present in all subgroup II strains [CMV-S (Acc. no. Y10884), CMV-Q (Acc. no. X02733), CMV-LS (P. Palukaitis, unpublished), and CMV-Trk7 (P. Palukaitis, unpublished)], whereas IA strains [CMV-Fny, CMV-Y (Acc. no. D12537), CMV-L (Acc. no. D16403), and CMV-O (P. Palukaitis, unpublished)] do not carry either restriction site. Primers used for RT-PCR of the 408 nt fragment of the selected RNA-1 region were the degenerate complementary primer R1-3 (5 CATAGTC(CT)TT (GATC)ATAGAGGGGAACC3, position 1121 to 1098 in CMV-Fny) and the homologous primer R1-5 (5 TGAAGGGAACGATGATGTTCG3, position 714 to 734 in CMV-Fny). RNA-3-based subgroup identification was carried out using the RT-PCR RFLP method described by Rizos et al. (1992). For all above RT-PCR assays, 3 µl of extracted viral RNA (1 µg) or TNA (3 µg) were mixed with 50 pmol of primer 3 and denatured at 95 C for 3 min. Reverse transcription was performed in a reaction mixture containing 15 units of avian myeloblastosis virus retrotranscriptase (AMV-RT, Amersham Pharmacia Biotech, Sweden) for 75 min at 42 C. Then 2.5 µl of first strand reaction mixture were added to 47.5 µl PCR mixture containing 25 pmol of primer 3, 25 pmol of primer 5 and 2.5 units of Taq polymerase (Promega Corp., USA). PCR conditions were as described above. Amplified products were digested with 1.75 unit of either MluI or SspI restriction enzyme at 37 C for 90 min and analysed by electrophoresis in 2% agarose in TBE buffer. Response of V. unguiculata to infection and partial sequence of RNA-2. While most CMV strains induce only localized infection in V. unguiculata (hypersensitive response, HR), all the strains presently investigated can infect this host systemically. With CMV-B this trait correlates with two mutations in codons 631 and 641 in the 2a polymerase gene (Kim and Palukaitis, 1997). With CMV-L it seems to correlate with mutation in codon 631 even though both mutations were present (Karasawa et al., 1999). To investigate if this was also the case with our isolates, TNA preparations from V. unguiculata plants infected with the three isolates were reverse transcribed and cdna amplified by standard RT-PCR using the degenerate primer 5 TTACC(AG)AACTCATCAGAGAGTA3 complementary to position of CMV-Fny and the primer 5 TTTGC(ACT)TGGTG(CT) TA(CT)GACAC3, homologous to position of CMV-Fny. The resulting amplicon of 194 bp was inserted in plasmid pgemt (Promega, USA), cloned in E. coli, strain DH5α, and its sequence determined

4 136 CMV in citrus and grapevine Journal of Plant Pathology (2000), 82 (2), by the chain-termination method (Sanger et al., 1977), using Thermo Sequenase (Amersham Pharmacia Biotech, Sweden). Electron microscopy. Partially purified virus preparations were stained with 2% aqueous uranyl acetate and observed directly in a Philip 201 C electron microscope, or were first treated with a polyclonal antiserum to CMV diluted 1:100, as described by Milne and Luisoni (1977). The intracellular behaviour of isolates L43 and YA200 was investigated in N. clevelandii, a host that reacted to infection with stunting, severe mottling and yellowing of the leaves. The fine structure of YA200 infections in N. benthamiana was also studied. Tissue excised from systemically infected leaves was processed according to standard procedures (Martelli and Russo, 1984), i.e. fixation in 4% glutaraldehyde in 50 mm phosphate buffer, post-fixation in 1% osmium tetroxide for 2 h at 4 C and staining overnight in 2% aqueous uranyl acetate in the cold (4 C). Embedding was in Spurr s resin after dehydration in graded ethanols. Thin sections were stained with lead citrate before viewing. RESULTS Reaction of herbaceous hosts. As shown in Table 1, all virus isolates induced similar reactions in herbaceous hosts, except that isolate YA200, but not L43 and OR, infected V. faba locally and was more severe in certain hosts (e.g. N. occidentalis, N. tabacum, V. unguiculata, C. annuum). YA200 conformed to the biological behaviour of ordinary CMV strains (Kaper and Waterworth, 1981) more than the citrus isolates (L43 and OR), for it was the only one inducing local lesions in N. benthamiana, V. unguiculata, P. aureus and G. globosa. However the symptoms of the three isolates differed from ordinary CMV strains in tomato which was infected very slowly and showed mild leaf mosaic, instead of the typical fern-leaf. C. quinoa reacted with systemic deformation and necrosis, and V. unguiculata with systemic mosaic and leaf curl rather than only with local lesions in inoculated leaves. Dot blot hybridization analysis with the CMV-RNA3 riboprobe demonstrated local latent infection of L43 and OR in V. unguiculata (Fig. 1, lane a), latent systemic infection of YA200 and L43 in G. globosa (Fig. 1, lane f) and confirmed absence of infection by L43 and OR in P. aureus (Fig. 1, lanes c, d). Table 1. Reaction of herbaceous hosts to infection by CMV isolates YA200, OR and L43. YA-200 OR L43 Host Local Systemic Local Systemic Local Systemic C. quinoa LLc Cp, Mo, Cu LLc Cp, Mo, Cu LLc Mo, Cu C. amaranticolor LLc LLc LLc L. esculentum mmo mmo mmo N. glutinosa Mo, Di Mo, Di Mo, Di N. benthamiana LLc Mo, Cu mmo, Cu mmo, Cu N. occidentalis Mo Mo mmo N. tabacum Xanthi Mo, Ne Mo mmo V. unguiculata LLn Mo, Cu Mo, Cu mmo P. aureus LLn C. sativus Vc Vc Vc G. globosa LLn V. faba LLr C. annuum Mo Mo mmo : no symptoms; Cp: chlorotic patches; Cu: leaf curling; Di: leaf distortion; LLc: chlorotic local lesions; LLr: reddish local lesions; LLn: necrotic local lesions; Mo: mosaic; mmo: mild mosaic; Ne: necrosis; Vc: vein clearing.

5 Journal of Plant Pathology (2000), 82 (2), Paradies et al. 137 Fig. 1. Detection of latent infection in herbaceous plants inoculated with CMV-YA 200, CMV-L43 and CMV-OR by dot blot hybridization with a CMV-RNA3 Dig-labelled riboprobe.v. unguiculata local (lane a), systemic (lane b); P. aureus local (lane c), systemic (lane d); G. globosa local (lane e), systemic (lane f). Effect of temperature on symptom development. Seven days after inoculation, plants infected with YA200 developed severe symptoms regardless of the host and temperature at which they were grown, whereas plants infected with OR and L43 expressed symptoms when held at C but not at C. However, symptom attenuation did not correlate with virus RNA titre, in that TNA extracts from the two groups of plants yielded essentially the same signal in dot blot hybridization analysis (not shown). Virus purification and analysis of viral RNA. The purification method by Lot et al. (1972) proved suitable for YA200 but not for L43 and OR since no virus was recovered after chloroform clarification. Partially purified preparations of these isolates were obtained with the method of Mossop et al. (1976). Electrophoretic bands corresponding to the four encapsidated RNAs of CMV were clearly visible in agarose gels with nucleic acid preparations extracted from purified virus particles (Fig. 2, lanes a, b, c) of isolates YA200, L43 and OR. Bands corresponding to genomic RNA-3 and subgenomic RNA-4 were recognized by a CMV RNA-3 riboprobe (not shown). None of the isolates showed bands with electrophoretic mobility corresponding to that of CMV satrna (Fig. 2, lane d). Absence of satrna was also confirmed in Northern blots with a satrna riboprobe (not shown). To further demonstrate absence of satr- NA, all isolates were serially passaged in Xanthi tobacco, a host species highly permissive to CMV-satRNA replication. Northern blots of TNA preparations from this host confirmed absence of satrna in all three isolates (not shown). Fig. 2. Electrophoretic pattern of viral RNA extracted from purified particles of CMV-L43 (lane, a), CMV-OR (lane b), CMV-YA200 (lane c) and CMV-77 used as marker (lane d). An ORF 2b-specific riboprobe hybridized RNA-2 of all isolates, whereas accumulation of the putative subgenomic RNA-4A was found only in TNA preparations of N. glutinosa infected with OR (not shown). Encapsidation of subgenomic RNA-4A was not investigated. Identification of isolate subgroup. RT-PCR with a single pair of CMV-specific primers coupled with RFLP analysis of amplified sequences of RNA-1 and RNA-2 of YA200, L43, and OR yielded a restriction profile characterized by a single band, thus indicating absence of MluI sites in both RNA-1 and RNA-2 and of SspI site in RNA-1 (Fig. 3a, b, c) This was taken as evidence that all three strains belong to CMV subgroup IA. The restriction profile obtained from YA200, L43, and OR RNA-3 amplicons after digestion with MspI showed two fragments with an apparent size of 330 and 535 bp, characteristic of subgroup I CMV strains (Rizos et al., 1992) (not shown). Electron microscopy. Particles from purified preparations of both citrus isolates (L43 and OR) were about 30 nm in diameter, had a rounded profile (Fig. 4A, C), and were uniformly decorated by a polyclonal antiserum to CMV (Fig. 4B, D). These particles were indistiguishable from those of YA200 (Koklu et al., 1999).

6 138 CMV in citrus and grapevine Journal of Plant Pathology (2000), 82 (2), Fig. 3. Electrophoretic analysis in 1.2% agarose gel of restriction patterns of amplified products of RNA-1 and RNA- 2 of different CMV strains. Panel a: MluI digests of RNA-2 from CMV-YA200 (Ya), CMV-OR (OR), CMV-L43 (L43) and CMV-FL (subgroup IB) (FL). Panels b and c: MluI (panel b) and SspI (panel c) digests of RNA-1 from CMV-YA200 (Ya), CMV-OR (OR), CMV-L43 (L43) and CMV-S (subgroup II) (S). M = 100 bp DNA ladder (BRL). Fig. 4. Negatively stained particles of citrus virus isolates L43 and OR before (A and C) and after (B and D) exposure to a CMV antiserum for decoration. Bars = 100 nm. Ability to support replication of satellite RNA. All plants tested for the presence of PG-sat RNA reacted positively to the CMV-RNA-3 probe (Fig. 5A). All three isolates supported replication of PG-satRNA in C. quinoa and N. occidentalis (Fig. 5B, lanes b, c, d), although symptoms elicited in these plants were indistinguishable from those induced in the absence of satrna. In two separate experiments, PG-satRNA supported by YA200 (Fig. 5B, lane b), co-determined the characteristic lethal necrosis disease in tomato within two weeks from inoculation whereas in the same host, isolates OR and L43 failed to support replication of PG-satRNA to detectable levels (Fig. 5B, lanes c, d). In the two experiments, tomato plants infected with isolates OR and L43 showed only mild discolouration of the leaves and a low titre of virus genomic RNAs, as estimated by dot blot hybridization analysis (Fig. 5A, lanes c, d). Partial sequence of RNA-2. The sequenced genome fragment of the three isolates contained both nucleotide substitutions found in CMV-B and CMV-L at position 1978 and 2007 in codons 631 and 641, according to which tyrosine substituted for phenylalanine and serine for alanine, as reported by Kim and Palukaitis (1997), and Karasawa et al. (1999). Cytopathology. Cells of N. clevelandii mesophyll tissues infected with isolate L43, showed very severe modifications; the ground cytoplasm was heavily altered by secondary vacuolation, leading to fragmentation of the protoplast (Fig. 6). Most of the secondary vacuoles had a single-membraned tonoplast, indicating their possible origin from swellings of endoplasmic reticulum (ER) cisternae. Some of the vacuoles, however, had a double limiting membrane (Fig. 6, inset a), suggesting their

7 Journal of Plant Pathology (2000), 82 (2), Paradies et al. 139 Fig. 5. Demonstration that CMV isolates from grapevine (YA200) and citrus (L43 and OR) support the replication of CMV sat RNA. Dot blot of TNA extracted from C. quinoa, N. occidentalis and tomato cv. Rutgers two weeks after inoculation with CMV- FL (lane a), YA200 (lane b), OR (lane c) and L43 (lane d) plus transcript of PG-satRNA hybridized with a CMV-RNA3 DIG-labelled riboprobe (A) and a PG-satRNA 32 P-labelled riboprobe (B). Fig. 6. Mesophyll cell of N. clevelandii infected by CMV-L43 showing extensive secondary vacuolation, virus microcrystals, membranous vesicles with a single bounding membrane, either scattered (arrow heads) or clustered in membrane-bound enclaves. Inset a shows two heavily damaged mitochondria with a few residual cristae (arrows). Inset b shows an electron-lucent structure bound by a double membrane, as clearly shown at higher magnification (inset c), possibly representing an emptied mitochondrion. Bars = 200 nm.

8 140 CMV in citrus and grapevine Journal of Plant Pathology (2000), 82 (2), derivation from mitochondria that underwent swelling and progressive loss of matrix and cristae (Fig. 6, insets b, c). These modifications were accompanied by increased development of cytoplasmic membranes in the form of massive accumulations of convoluted ER (Fig. 7A) and of a great number of more or less rounded membranous vesicles. A few of these vesicles were isolated and single-membraned (Fig. 6), other vesicles were isolated and double-membraned (Fig. 7B), and still others were in membrane-bound clusters (Figs 6 and 7B). Fig. 7. CMV-L43 infection in N. clevelandii. A. Massive accumulation of convoluted membranes and altered mitochondria (m) with electron dense amorphous material within the cristae. B. Double-membraned vesicles in the cytoplasm of an infected cell, which contains normal (M) and deranged mitochondria (m) and a chloroplast (P) with modified internal lamellar system. Bars = 200 nm.

9 Journal of Plant Pathology (2000), 82 (2), Paradies et al. 141 Fig. 8. A and B. Different stages of mitochondrial derangement observed in N. clevelandii cells infected by CMV-L43. Bars = 200 nm. Major organelles were also severely affected. Chloroplasts were often misshapen with deranged internal membranes (Figs 7B and 9). Mitochondria also showed a great variety of modifications, such as accumulation of amorphous electron dense material within the cristae, followed by a progressive dilation of the cristae, disruption of the limiting membrane, and fragmentation of the organelle (Figs 7 and 8) with loss of contents. Many nuclei showed heterochromatin depletion, had a wavy contour or were strongly lobated, and contained a few double-membraned vesicles either internal to the nucleoplasm or at the periphery near the nuclear membrane (Fig. 9). The impression was that peripheral vesicles were in the process of being driven from the cytoplasm into the nucleoplasm (Fig. 9, insets). Virus particles were plentiful, appearing solid or hollow, rounded and with a diameter of ca 23 nm. They were either scattered in the ground cytoplasm or, more often, in crystalline aggregates of various size (Fig. 6). The cytology of both Nicotiana species infected with isolate YA200 was less affected, for most of the organelles retained an apparently normal aspect, except for chloroplasts which were swollen and clumped. The most striking feature was the presence in both hosts of prominent whorls of virus particles lining cytoplasmic membranes (Fig. 10, inset), giving rise to unusual aggregates that were mixed with accumulations of virions in dispersed or crystalline form (Fig. 10A, B, C). Virus particles could also line the tonoplast and the bounding membrane of clustered plastids (Fig. 10C). Occasional clumps of darkly staining amorphous material were observed, especially in the cytoplam of N. clevelandii (Fig. 10C). DISCUSSION Results of molecular hybridization analysis and of RT-PCR RFLP unequivocally identify YA200, OR and L43 as members of CMV subgroup IA. Virus particle morphology, electrophoretic pattern of encapsidated nucleic acids, experimental herbaceous host range and symptomatology conformed to those typical of CMV. However, each of these viruses possesses a number of properties differing enough from those of other characterized CMV isolates to be regarded as three new strains, for which the names of CMV-YA200, CMV-OR and CMV-L43 are proposed.

10 142 CMV in citrus and grapevine Journal of Plant Pathology (2000), 82 (2), Fig. 9. A longitudinally sectioned N. clevelandii cell infected by CMV-L43 showing a range of cytological modifications. The ground cytoplasm is filled with virus particles and contains many double-membraned vesicles, modified mitochondria (m) and chloroplasts (P). The nucleus is depleted of heterochromatin and has an envelope with a wavy contour. Membranous vesicles are contained within apparent invaginations of the nuclear envelope (arrow heads and insets a and b) and in the nucleoplasm (arrows and inset c). Bars = 200 nm.

11 Journal of Plant Pathology (2000), 82 (2), Paradies et al. 143 Fig. 10. A and B. Whorls of virus particles lining cytoplasmic membranes (A, inset) and virus crystal in N. benthamiana cells infected by CMV-YA200. C. A virus particle whorl surrounding an accumulation of electron-dense amorphous material and clumped chloroplasts with virus particles lining the bounding membrane (arrows) in a N. clevelandii cell infected by CMV- YA2OO. Bars = 200 nm.

12 144 CMV in citrus and grapevine Journal of Plant Pathology (2000), 82 (2), Biological and physicochemical properties of OR and L43 suggest that they are more similar to each other than to CMV-YA200. Unlike the grapevine isolate CMV-YA200, the citrus isolates (L43 and OR) induce in tomato very mild and slow-developing symptoms which do not appear earlier than three weeks after inoculation, possess virions that do not withstand organic solvents at slightly acidic ph, elicit milder and remarkably different cytological modifications, and are both thermosensitive. However, symptom attenuation at high temperature did not seem to correlate with a lower titre of genomic RNAs in infected tissues, contrary to other reported instances in which thermosensitivity caused in tomato a 5-fold reduction in viral RNA (White et al., 1995). Although thermophobicity is thought to be typical of subgroup II CMV strains, yet CMV-PG, a subgroup II strain involved in the aetiology of tomato lethal necrosis in Italy is thermophilic (Gallitelli et al., 1988). L43 and OR were unable to support replication of the necrogenic PG-satRNA in tomato although they did in other species. This behaviour requires further analysis as it might be due to the reduced ability to induce disease in tomato (e.g. slow progressing infection) and might not be true for other satrna variants. For example, the latter is the case of CMV-Ixora which in tomato does not support replication of most CMV-satRNAs, except for the T-satRNA variant (McGarvey et al., 1995). Most CMV strains give local lesions in V. unguiculata but do not become systemic. In contrast, L43 and OR do not give local lesions, and YA200 gives very few, whereas all three become systemic. This behaviour, as suggested by Kim and Palukaitis (1997) and Karasawa et al. (1999) may correlate with the presence of one of the two changes (position 631) in the aminoacid sequence of the 2a polymerase gene, which were found in all three strains. When the cytopathology of Nicotiana infected by L43 and YA200 is compared with that reported for other CMV isolates (reviewed by Francki et al., 1985; Martelli et al., 1985) differences far supersede similarities. Protoplast fragmentation caused by heavy secondary vacuolation, increased development of cytoplasmic membranes, derangement of chloroplasts and mitochondria (loss of matrix and cristae), presence of darkly staining amorphous material in the cytoplasm, and virus accumulation in crystalline arrays have been frequently described as determined by infection of different CMV isolates (Martelli et al., 1985). However, the most striking ultrastructural changes induced by L43, such as the modifications to mitochondria (Fig. 8A, B) and the presence of double-membraned vesicles in the cytoplasm (Figs 6 and 7B) and in connection with altered nuclei (Fig. 9), have not, apparently, been reported earlier. In fact, the observed nuclear modifications are more similar to those associated with luteoviruses (reviewed by Martelli and Russo, 1984) than cucumoviruses (Martelli et al., 1985). The apparent affinity of YA200 virions for cytoplasmic and organellar membranes was also unusual and gave rise, in two different hosts, to impressive arrays of virus in the cytoplasm and clumping of the chloroplasts. CMV has a very wide host range which includes some fruit trees (Kaper and Waterworth, 1981). However, this seems to be its first record from citrus (sweet orange and lemon) and the second record from grapevine (Koklu et al., 1999). CMV does not seem to be a threatening pathogen to citrus and grapes, as infections are apparently symptomless. Nevertheless, the role of these hosts, if any, in the complex ecology of the virus may merit further investigation. ACKNOWLEDGEMENTS This work was supported by a grant of the Italian Ministry for the University and the Scientific and Technological Research (MURST) PNR Virosi e fitoplasmosi di colture agrarie di rilevante importanza economica: caratterizzazione biologica e possibilità di prevenzione and by a grant from the University of Bari Studio delle interazioni virus-ospite e caratterizzazione biologico-molecolare di virus di rilevante importanza per le colture meridionali. The authors thank Dr. P. Palukaitis, Scottish crop research Institute, Invergowrie, UK for supplying CMV-FnY and the unpublished sequences of several CMV strains. REFERENCES Çinar A., Kesrting U., Onelge N., Korkmaz S., Sas G., Citrus virus and virus-like diseases in the Eastern Mediterranean region of Turkey. In: Proceedings 12th Conference of International Organization of Citrus Virologists, Riverside 1993, Çinar A., Korkmaz S., Kersting U., Presence of a new withefly-borne citrus disease of possible viral aetiology in Turkey. FAO Plant Protection Bulletin 42: Crescenzi A., Barbarossa L., Cillo F., Di Franco A., Vovlas N., Gallitelli D., Role of cucumber mosaic virus and its satellite RNA in the etiology of tomato fruit necrosis in Italy. Archives of Virology 131: Finetti Sialer M.M., Cillo F., Barbarossa L., Gallitelli D., Differentiation of cucumber mosaic virus subgroups by RT-PCR RFLP. Journal of Plant Pathology 81:

13 Journal of Plant Pathology (2000), 82 (2), Paradies et al. 145 Francki R.I.B., Milne R.G., Hatta T., Atlas of plant viruses, Vol. 2, CRC Press, Boca Raton. Gallitelli D., Present status of controlling cucumber mosaic virus. In: Khetarpal R.K., Koganezawa H., Hadidi A. (eds.). Control of plant virus diseases, pp APS Press, St. Paul, MN. Gallitelli D., Di Franco A., Vovlas C., Kaper J.M., Infezioni miste del virus del mosaico del cetriolo (CMV) e di potyvirus in colture ortive di Puglia e Basilicata. Informatore Fitopatologico 38: Gallitelli D., Saldarelli P., Molecular identification of phytopathogenic viruses. Methods in Molecular Biology 50: Grieco F., Lanave C., Gallitelli D., Evolutionary dynamics of cucumber mosaic virus satellite RNA during natural epidemics in Italy. Virology 229: Kaper J.M., Gallitelli D., Tousignant M., Identification of a 334-ribonucleotide viral satellite as principal aetiological agent in a tomato necrosis epidemic. Research in Virology 141: Kaper J.M., Waterworth H.E., Cucumoviruses. In: Kurstak E. (ed.). Handbook of plant virus infections and comparative diagnosis, pp Elsevier/North Holland Biomedical Press, Amsterdam. Karasawa A., Okada I., Akashi K., Chida Y., Hase S., Nakazawa-Nasu Y., Ito A., Ehara Y., One amino acid change in cucumber mosaic virus RNA polymerase determines virulent/avirulent phenotypes on cowpea. Phytopathology 89: Kim C.H., Palukaitis P., The plant defense response to cucumber mosaic virus in cowpea is elicited by the viral polymerase gene and affects virus accumulation in single cells. The EMBO Journal 16: Koklu G., Digiaro M., Sabanadzovic S., Savino V., Natural infections by cucumber mosaic virus in Turkish grapevines. Phytopathologia Mediterranea 38: Koklu G., Digiaro M., Savino V., A survey of grapevine viruses in Turkish Thrace. Phytopathologia Mediterranea 37: Lot H., Marrou J., Quiot J.B., Esvan C.H., Contribution à l étude du virus de la mosaïque du concombre (CMV). II. Méthode rapide de purification du virus. Annales de Phytopathologie 4: Martelli G.P., Russo M., Use of thin sectioning for the visualization and identification of plant viruses. Methods in Virology 8: Martelli G.P., Russo M., Virus-host relationships. Symptomatological and Ultrastructural aspects. In: Francki R.I.B. (ed.). The plant viruses. Polyhedral virions with tripartite genomes, pp Plenum Press, New York. McGarvey P., Tousignant M., Geletka L., Cellini F., Kaper J.M., The complete sequence of a cucumber mosaic virus from Ixora that is deficient in the replication of satellite RNAs. Journal of General Virology 76: Milne R.G., Luisoni E., Rapid immune electron microscopy of virus preparations. Methods in Virology 6: Mossop D.W., Francki R.I.B., Grivell C.J., Comparative studies on tomato aspermy and cucumber mosaic viruses. V. Purification and properties of a cucumber mosaic virus inducing severe chlorosis. Virology 74: Palukaitis P., Roossinck M., Dietzgen R.G., Francki R.I.B., Cucumber mosaic virus. Advances in Virus Research 41: Petersen H.I., Plant diseases in Denmark in 1997, 94th annual survey. State Plant Pathology Institute, Lyngby, Denmark. Rizos H., Gunn L.V., Peres R.D., Gillings M.R., Differentiation of cucumber mosaic virus isolates using the polymerase chain reaction. Journal of General Virology 73: Sambrook J., Fritsch E.F., Maniatis T., Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory Press, New York, USA. Sanger F., Nichlen S., Coulson A.R., DNA sequencing with chain terminating inhibitors. Proceedings of the National Academy of Sciences, USA 74: White J.L., Kaper J.M., A simple method for the detection of viral satellite RNAs in small tissue samples. Journal of Virological Methods 23: White J.L., Tousignant M.E., Geletka L.M., Kaper J.M., The replication of a necrogenic cucumber mosaic virus satellite is temperature-sensitive in tomato. Archives of Virology 140: Received 7 February 2000 Accepted 9 May 2000