Modulation of interferon-specific gene expression by albumin interferon-α in interferon-α-experienced patients with chronic hepatitis C

Transcription

1 Modulation of interferon-specific gene expression by albumin interferon-α in interferon-α-experienced patients with chronic hepatitis C Vijayan Balan *, David R Nelson, Mark S Sulkowski, Gregory T Everson, Louis R Lambiase, Rusell H Wiesner, Rolland C Dickson 7, Andy Garcia, Paul A Moore, Ren Yu and G Mani Subramanian Mayo Clinic, Phoenix, AZ, USA University of Florida, Gainesville, FL, USA Johns Hopkins University, Baltimore, MD, USA University of Colorado, Denver, CO, USA University of Florida at Jacksonville, Jacksonville, FL, USA Mayo Clinic, Rochester, MN, USA 7 Mayo Clinic, Jacksonville, FL, USA Human Genome Sciences, Rockville, MD, USA Antiviral Therapy :9 9 *Corresponding author: Tel: + ; Fax: ; Balan.Vijayan@mayo.edu Albumin interferon-α (alb IFN) is a novel recombinant protein derived from IFN-αb genetically fused to human albumin. The resulting single polypeptide combines in one molecule the antiviral properties of IFN-α with the long serum half-life of albumin. IFN-mediated biological responses stem from the engagement of IFN-α with its target receptor and subsequent modulation of IFNspecific gene (ISG) expression. To evaluate the pharmacodynamics of alb-ifn during the Phase I/II study conducted in patients with chronic hepatitis C (CHC) who had previously failed IFN-α-containing regimens, ISG induction was evaluated in peripheral blood and compared with antiviral response. Whole blood was obtained at day, day 7 and day from patients enrolled in the higher dose ( 9 µg) alb-ifn cohort, who received two injections on day and day. Taqman real-time PCR was used to assess candidate ISG expression. There was sustained induction on day 7 and day of the ISG s OAS, IRF-7, IFI and IFI7. Although all patients showed a molecular response to alb-ifn, individual variability in pretreatment gene expression levels and fold of modulation during treatment was observed. At day, induction of OAS, IFI and IRF7 showed pairwise correlation in individual patients (P<.). Moreover, the induction of expression at day, and pretreatment levels of OAS and IFI correlated with hepatitis C virus RNA reduction at day (P<.). In conclusion, alb-ifn demonstrated robust induction of ISG that was consistent with the response associated with an IFN-α. Introduction The type- interferons (IFNs) including IFN-α mediate their immunomodulatory and antiviral actions by triggering a complex cascade of gene expression. IFN-α has potent antiviral activity, but does not act directly on the virus or replication complex. Instead, it induces IFN-specific genes (ISGs), which establish a non-virusspecific antiviral state within the cell [,]. Albumin IFN-α (alb IFN) is a novel recombinant protein translated from a gene produced from the fusion of the human genes for IFN-αb and human albumin. The resulting.7 kda polypeptide is a single molecule that has both the antiviral properties of IFN-α with the long serum half-life of albumin. In nonhuman primates, significant increases in the ISG s, - oligoadenylate synthetase (OAS) mrna were maintained for days after one subcutaneous dose when compared to IFN-α- or vehicle-treated animals []. In a sequential, dose-ranging Phase I/II study of alb IFN in patients with chronic hepatitis C (CHC) who had failed prior IFN-α therapy, alb IFN demonstrated a favourable safety profile at doses of up to 9 µg, an extended half-life of approximately days and evidence of dose-dependent antiviral activity in this treatment refractory CHC population []. Previous cdna array analysis of gene expression in whole blood obtained from CHC patients receiving pegylated IFN or alb IFN therapy identified several genes that were characteristically induced or repressed on days 7 and compared with pretreatment levels []. These include genes that are prominently up regulated International Medical Press 9-9

2 V Balan et al. and include representatives of ISGs, such as, OAS, IFIF7, IFI and IRF7. Granulysin, TR and ILb are immune response genes that tend towards down regulation by day. ALDHA and CDC are examples of genes that do not show significant modulation following IFN therapy. Here, we evaluated the induction of these genes in CHC patients enrolled to receive higher dose of alb IFN ( 9 µg) on day and day, in a dose-ranging Phase I/II study []. The objectives were to assess the modulation of ISG expression at day 7 and day, and to determine if any correlation exists between viral load change to alb IFN and gene expression responses. Materials and methods Study design This was a phase I/II, open-label, dose escalation, multicentre study conducted in CHC patients who had previously failed IFN-α therapy. Each patient was assigned to of cohorts to receive sequential subcutaneous doses of alb IFN ranging from 7 to 9 µg. In the study, all patients received either a single subcutaneous dose or two subcutaneous doses; however, for this study, only patients receiving two subcutaneous doses enrolled in the higher dose cohorts (,, 7 and 9 µg) were included in the analysis. Whole blood was drawn at days, 7 and. The institutional review boards of participating centres approved the protocol and all amendments. All patients provided written informed consent. Human Genome Sciences, Rockville, MD, USA, sponsored the study. The sponsor designed the study in collaboration with the authors and other expert hepatologists. The study was conducted according to the guideline provisions of Good Clinical Practices, as defined in the US Code of Federal Regulations on the Protection of Human Patients for the United States. Human Genome Sciences was responsible for the collection and statistical analysis of the data. The lead investigator had unlimited access to the data and interpreted the results. No limitations on publications were imposed. The first author made final decisions regarding all aspects of the manuscript, and all named authors participated in the interpretation of results and the writing of the manuscript. RNA isolation Whole blood (approximately ml) was drawn into a PAXgene Blood RNA tube (Qiagen, Valencia, CA, USA; Cat# 7) and RNA isolated using the PAXgene blood RNA kit (Qiagen; Cat# 7) was eluted in about µl of elution buffer. RNA was quantified using the Beckman (Fullerton, CA, USA) DU UV spectrophotometer. RNA yields range from. µg to 7 µg of total RNA. Real time Taqman PCR Quantitative one-step RT-PCR using ABI s Taqman 77 machine was performed using Taqman probes (See Table ). IRF7, IFI, Granulysin, ILbeta, ALDHA and CDC probes were obtained from ABI s (Foster City, CA, USA) Assay-on-Demand Catalogue. Data for each gene was normalized to S with the normalized value referred to as an expression ratio. The expression ratio is the number of copies of the target gene there are for each copy of the normalizing gene, in this case S. HCV RNA concentrations HCV RNA concentrations were determined by the Amplicor HCV Monitor Kit version (Roche Diagnostic Systems, Branchburg, NJ, USA), and Quest Diagnostics (Teterboro, NJ, USA) performed the assays. Statistical analysis Patients baseline characteristics and gene expression profiles were summarized using descriptive statistics. Correlation analysis was performed to assess the association between ISG-expression induction and HCV RNA reduction at day 7 and day. A linear regression model was used to reveal the effect of baseline gene expression on HCV RNA reduction. All statistical tests were two-sided and performed at a significance level of.. All statistical analyses were performed using the SAS (SAS Institute, Cary, NC, USA) and the R statistical package (The R Foundation for Statistical Computing, Chicago, IL, USA). Results Patients demographics were comparable for the patients enrolled in the four treatment groups as Table. Taqman probes used for real-time PCR Primer Primer Probe OAS CTTTGATGCCCTGGGTCAGT TCGGTGCACTCCTCGATGA TGGCAGCTATAAACCTAACCCCCAAATCTATGTC IFI7 TGGCCAGGATTGCTACAGTTG GTGAAGCCCATGGCACTGA ATGGGCACAGCCACAACTCCTCCAAT TR CCAACGCTTCCAACAATGAA CTGGTCATGGTGCAGGAACTT CTTGCTTCCCATGTACAGTTTGTAAATCAGATCAA s CGGCTACCACATCCAAGGAA GCTGGAATTACCGCGGCT TGCTGGCACCAGACTTGCCCTC 9 International Medical Press

3 Albumin interferon-α modulation of interferon-specific gene expression shown in Table. Overall, the groups had comparable demographic and baseline disease characteristics. The majority were male (%), had a BMI> kg/m (7%), and had genotype HCV (9%). This is consistent with a CHC population that has failed previous therapy with IFN-α. Of note, the µg cohort had a higher median BMI (.) compared to the other cohorts. The panel of genes chosen was based on genes previously identified from DNA array studies conducted on peripheral blood that showed modulation of gene expression following IFN therapy []. These include ISGs that either have been previously shown to be responsible for the antiviral effects of IFN-α (for example, OAS), regulators of ISG expression (for example, IRF-7) or known to be induced during viral infections (for example, IFI7 and IFI). Real-time PCR was performed on RNA extracted from peripheral blood to assess induction of gene expression over baseline at day 7 and day, as shown in Figure. A greater than fivefold up regulation over baseline levels was observed on day 7 and day for all the ISGs (OAS, IFI, IFI7 and IRF7). In particular, IFI7 showed >-fold induction with a continued increase in gene expression levels between day 7 and day. TR expression showed down regulation on day 7 and day. Both granulysin and ILb expression showed modest up regulation (approximately twofold over baseline) and the levels returned to near baseline expression by day. As expected, the levels of expression of CDC and ALDHA remain close to baseline values on day 7 and day. The baseline levels of expression vary significantly for each of the ISGs. IFI7 has the lowest median levels of pretreatment expression, whereas OAS has the highest median levels of pre-treatment expressions, as shown in Table. There is also substantial inter-patient variability in baseline levels of expression of the ISGs. The magnitude of ISG induction on days 7 and in each of the four treatment groups is shown in Figure. No dose response was observed for any ISG. Moreover, there was no correlation of baseline expression or fold induction with gender or BMI. Correlation analysis was performed in patients between the levels of gene induction on day and the HCV RNA reduction in response to alb IFN treatment, as shown in Figure. A positive correlation was observed for OAS and IF (P<.), but not for the other genes evaluated. No correlation was observed between levels of gene induction at day 7 with HCV RNA reduction at day 7. It is notable that IFI7 induction did not show any correlation with antiviral response at either day 7 or day despite having the greatest magnitude of induction. To further explore if ISG induction was correlated in individual patients, pairwise analysis of ISG induction on day was performed, as shown in Figure. OAS, IFI and IRF7 showed pairwise correlation. The correlation was most robust for OAS (P=.9) and IFI (P=.). There was no correlation of IFI7 induction with the other ISGs evaluated. Given that three patients had very high levels of IFI7 induction (>-fold) compared with the remaining patients, re-analysis after excluding these patients showed the same results (data not shown). Finally, a linear regression model was used to explore the relationship of baseline gene expression with HCV RNA Table. Baseline characteristics by treatment group µg (n=) µg (n=) 7 µg (n=) 9 µg (n=) Gender Male (%) (%) (%) (%) Female (%) (%) (7%) (%) Age, years Mean ±SD. ±7.7. ±.. ±9.. ±.7 Median (min, max) (, ) (, ) 7. (, 7) (, ) BMI, kg/m Mean ±SD. ±.. ±.7 9. ±.. ±. Median (min, max). (7.9, 7.). (.,9.) 9. (.,.). (9.,.) (%) (%) (7%) (%) < - (%) (%) (%) Genotype (%) (%) (%) (%) Other (%) - (7%) - Baseline HCV RNA, log IU/ml Mean ±SD.9 ±..7 ±..99 ±.. ±. Median (min, max). (.,.).7 (., 7.).7 (., 7.). (.77,.9) BMI, body mass index; HCV, hepatitis C virus. Antiviral Therapy :7 9

4 V Balan et al. Figure. Gene expression in whole blood on day 7 and day relative to baseline TR Granulysin ILb OAS IF IRF7 CDC ALDHA IF7 Induction of gene expression Baseline Day 7/Day Day /Day Baseline Day 7/Day Day /Day Median fold change in expression of ISGs (OAS, IFI7, IFI and IRF7) and TR, granulysin, ILb, CDC and ALDHA are shown. Table. Summary of interferon-specific gene expression OAS IFI IRF7 IFI7 Baseline (x - ) Mean ±SD. ±9. 9. ±.. ±.. ±. Median (min, max) (.,,) (.,,9) 99. (., ). (.,.) Day 7 fold induction Mean ±SD. ±..7 ±..9 ±.. ±. Median (min, max) 9. (.7,.).9 (.,.). (.,.) 7. (.,.7) Day fold induction Mean ±SD 7. ±.. ±.. ±.. ±. Median (min, max) 7. (., 7.). (.7,.7). (., 9.) 7.9 (.,.) reduction on day as shown in Figure. The baseline levels of three ISGs namely OAS, IFI and IRF7 correlated with day HCV RNA reduction. Higher baseline levels of gene expression of all three genes correlated with poor antiviral response. As OAS and IFI showed an inverse relationship of baseline ISG expression though a positive relationship of fold-induction at day with antiviral response also at day, further analysis was conducted to explore if high baseline expression correlated with poor ISG induction. While there were some patients with high baseline expression with poor induction of gene expression on day, no statistically significant correlations were observed. Discussion IFNs exert their biological activities by binding to the heterodimeric receptor. The binding of the receptor by type I IFNs activates the JAK-STAT signalling pathway, which initiates a transcription complex to induce the expression of the downstream target genes, referred to 9 International Medical Press

5 Albumin interferon-α modulation of interferon-specific gene expression Figure. ISG (OAS, IFI7, IFI, IRF7) modulation on day 7 and day relative to baseline in each of the four alb IFN treatment groups Day 7/Day Day /Day Day 7/Day Day /Day IRF7 induction IFI induction µg µg 7 µg 9 µg µg µg 7 µg 9 µg IF7 induction Day 7/Day Day /Day OAS induction Day 7/Day Day /Day µg µg 7 µg 9 µg µg µg 7 µg 9 µg Alb IFN, albumin interferon-α; ISG, interferon-specific genes. Figure. Change in hepatitis C virus RNA versus ISG induction at day Pearson s r=.9 P=.9 Pearson s r=. P=. HCV RNA reduction (log IU/ml) at Day HCV RNA reduction (og IU/ml) at Day Fold induction in OAS at day Fold induction in IFI at day At day, hepatitis C virus RNA reduction correlated with induction of OAS and IFI. Antiviral Therapy :7 9

6 V Balan et al. Figure. Pairwise correlation of ISG induction at day Pearson s r=. P=.9 Pearson s r=. P=.77 IFI induction (Day /Day ) IFI induction (Day /Day ) OAS induction (Day /Day ) IFI7 induction (Day /Day ) Pearson s r=.9 P=. Pearson s r=. P=. IRF7 induction (Day /Day ) IRF7 induction (Day /Day ) IFI induction (Day /Day ) OAS induction (Day /Day ) Pearson s r=. P=. Pearson s r=.9 P=.9 IRF7 induction (Day /Day ) IFI7 induction (Day /Day ) OAS induction (Day /Day ) IFI induction (Day /Day ) At day, induction of OAS, IFI and IRF7 showed a correlation in pairwise comparisons. 9 International Medical Press

7 Albumin interferon-α modulation of interferon-specific gene expression Figure. Correlation of pre-treatment OAS, IFI and IRF7 expression with HCV RNA reduction at day HCV RNA reduction at Day, log IU/ml HCV RNA reduction at Day, log IU/ml HCV RNA reduction at Day, log IU/ml P= Baseline gene expression of IFI P=. P=.7... Baseline gene expression of OAS xe - xe - xe - xe - xe - Baseline gene expression of IRF7 as ISGs [,,]. ISGs are the genetic effectors of the host response to virus infection, and the human genome encodes hundreds of ISGs [,7]. Previous reports have examined the role of IFN-α-induced target genes on anti-hcv activity []. Alb IFN is a novel recombinant protein produced by a genetic fusion of human serum albumin and IFN-αb. The extended half-life of alb IFN supports dosing once every or weeks, and the longer therapeutic activity might potentially improve the agent s efficacy and tolerability compared to conventional IFN therapies []. In this study, we have demonstrated robust induction of ISG and correlation of ISG expression with antiviral response at day following the administration of two injections of alb IFN. The identification of OAS and IFI as genes whose pretreatment levels and the fold induction show correlation with antiviral response following the administration of alb IFN are of interest. OAS, in particular, has been previously shown to possess antiviral activity by activating latent ribonucleases, which results in the degradation of viral RNA and inhibition of virus replication [,]. Moreover, the correlation of higher pretreatment ISG levels with lack of antiviral response are consistent with a recent study where higher pretreatment levels of the ISG (ISG) in the liver correlated with treatment failure [9]. While some ISGs such as OAS have been postulated to show direct antiviral activity, other examples include IRF-7, an ISG that promotes IFN-subtype expression and diversification of the ISG response, establishing a positive-feedback loop that amplifies IFN production and antiviral action []. The correlation of specific ISG expression in individual patients, as shown in this study, for OAS, IFI and IRF7 is suggestive of their involvement in a common IFN regulatory pathway in vivo. Furthermore, the lack of correlation of the magnitude of IFI7 with antiviral decline is of interest and further strengthens the observation that there may be a subset of genes in the general IFN signal transduction pathway that correlate strongly with early HCV RNA reduction. While we do not know why IFI correlated with viral decline and IFI7 did not, we can only speculate on the reasons. Both IFI and IFI7 have been previously shown to be genes that are inducible by type IFNs, whose precise molecular function is not well understood. IFI shows cytoplasmic localization and has previously shown to be induced in the liver of HCV-infected chimpanzees, and was thought to contribute to antiviral activity []. IFI7 on the other hand shows nuclear localization and likely plays a more non-specific role in chromatin modifications associated with the IFN transcriptional response and may not contribute to antiviral activity []. While gene expression in the liver (which is a major site for viral replication) is most relevant to antiviral response, the peripheral blood compartment does constitute a small extrahepatic reservoir for HCV and represents a surrogate population of effector cells to define IFN-α activity []. In this study, ISG expression was studied in whole blood that comprises a heterogeneous cell population containing polymorphonuclear cells, lymphocytes and monocytes. Hence the changes in gene expression observed in this study are likely to be reflective of the changes in some or all of these subpopulations. Further studies are needed to define expression patterns of these genes in these subpopulations of cells. Finally, while the time points of day 7 and are reflective of the early events during the treatment course, it would be Antiviral Therapy :7 97

8 V Balan et al. important to extend these correlations with the clinical endpoints of sustained virological response ( weeks after completion of treatment) in a larger patient population. References. Tilg H. New insights into the mechanisms of interferon: an immunoregulatory and anti-inflammatory cytokine. Gastroenterology 997; :7.. Feld JJ, Hoofnagle JH. Mechanism of action of interferon and ribavirin in treatment of hepatitis C. Nature ; : Osborn BL, Olsen HS, Nardelli B, et al. Pharmacokinetic and pharmacodynamic studies of a human serum albumininterferon-alpha fusion protein in cynomolgus monkeys. J Pharmacol Exp Ther ; :.. Balan V, Sulkowski M, Nelson D, et al. A Phase I/II study to evaluate the safety, tolerability, pharmacokinetics and pharmacodynamics of escalating doses of recombinant human albumin-interferon alpha fusion protein in patients with chronic hepatitis C who have failed previous interferon alpha based therapy. Antivir Ther ; :. Balan V, Sulkowski M, Nelson D, et al. Molecular profiles of drug response in HCV infected patients during the first weeks of therapy for chronic hepatitis C virus with pegylated interferon containing regimens or Albuferon. Hepatology ; Suppl :A,Abstract 9.. Der SD, Zhou A, Williams BRG, Silverman RH. Identification of genes differentially regulated by interferon or using oligonucleotide arrays. Proc Natl Acad Sci USA 99; 9:. 7. de Veer MJ, Holko M, Frevel M, et al. Functional classification of interferon-stimulated genes identified using microarrays. J Leukoc Biol ; 9:9 9.. Hayashi J, Stoyanova R, Seeger C. The transcriptome of HCV replicon expressing cell lines in the presence of alpha interferon. Virology ; : Chen L, Borozan I, Feld J et al. Hepatic gene expression discriminates responders and nonresponders in treatment of chronic hepatitis C viral infection. Gastroenterology ; :7.. Honda K, Yanai H, Negishi H et al. IRF-7 is the master regulator of type-i interferon-dependent immune responses. Nature ; : Kitamura A, Takahashi K, Okajima A, Kitamura N. Induction of the human gene for p, a hepatitis-c-associated microtubular aggregate protein, by interferon-alpha/beta. Eur J Biochem 99; :77.. Huang M, Qian F, Hu Y, Ang C, Li Z, Wen Z. Chromatinremodelling factor BRG selectively activates a subset of interferon-alpha-inducible genes. Nat Cell Biol ; :77 7. Bare P, Massud I, Parodi C, Belmonte L, et al. Continuous release of hepatitis C virus (HCV) by peripheral blood mononuclear cells and B-lymphoblastoid cell-line cultures derived from HCV-infected patients. J Gen Virol ; : Accepted for publication 7 June 9 International Medical Press