Point total. Page # Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule.
|
|
- Hugo Sanders
- 6 years ago
- Views:
Transcription
1 This exam is worth 90 points. Pages 2- have questions. Page 1 is for your reference only. Honor Code Agreement - Signature: Date: (You agree to not accept or provide assistance to anyone else during this exam.) Thank you! *********************************************************************************************************** FOR YOUR REFERENCE ONLY. NOTHING WILL BE GRADED ON THIS PAGE. Page # 2 Point total 4 Exam Total (out of 90) The number next to each intermediate represents the total # of C-C and C-H bonds in that molecule
2 1. (10 pts) For each choice below, write an "X" in the blank for the stronger interaction or bond in each pair. 2 points each a. X a C-G base pair vs. an A-U base pair b. X disulfide bond in protein structure vs. ionic bond in protein structure c. X bond formed by a ribozyme's catalysis vs. a bond in protein 2 structure d. interaction between sigma and RNA polymerase vs. phosphodiester bonds X e. interaction between phospholipid tails vs. ester linkage between glycerol and fatty acid X 2. (10 pts) The diagram to the right shows the Na + /K + ATPase. Cells normally have high K + and low Na + concentrations in their cytoplasm, whereas outside the cell Na + is high and K + is low. (2 pts each) a. When the Na + /K + ATPase is working normally, it moves K + which way? (Circle ONE best answer) - cytoplasm outside - outside cytoplasm b. Which ion binds more tightly to conformation A? K+ c. Which conformation is more likely to bind ATP? B d. Which of the R-groups to the right is most likely found where you see the "R" in conformation A? (Circle the BEST answer) outside cell -R P cytoplasm Conformation A Conformation B e. Which of the following is responsible for the change from conformation A to B? A. Addition of the phosphate group to an amino acid on the Na + /K + ATPase B. Energy released as heat when ATP is broken apart C. Binding of Na + ions to ATP D. Breaking of the bond between the Na + /K + ATPase and the phosphate group. ( pts) Imagine you have a lipid bilayer made primarily of phospholipids with unsaturated tails. (2 points each) a. Which of the following molecules will be permeable through this bilayer? (Circle ALL correct answers) - ATP - H 2 O - H + - CO 2 - RNA polymerase b. Would permeability increase or decrease if you changed to saturated tails? decrease c. Would permeability increase or decrease if you lowered the temperature? decrease 2
3 Biol 200, Autumn 2014 N 4. ( pts) Imagine a cell in which there is a mutation in the gene for the amino-acyl trna synthetase that binds to the trnas with the 'UCU' and 'UCC' anticodons. The mutant amino-acyl trna synthetase enzyme still binds to the same trnas, but it binds to the amino acid asparagine (Asn) instead of the normal amino acid. There are no other mutations in the cell. Which of the following will be true? Put an "X" in the blank for all correct answers. (The codon table is printed below.) (+ points each correct, -2 for "Arg" will never be included, - for any other incorrect answer) Most proteins will be a bit shorter than in normal cells The amino acid "Arg" will sometimes be added where "Asn" normally would be in proteins The amino acid "Asn" will sometimes be added where "Ser" normally would be in proteins X There will be more trnas carrying "Asn" in the mutant cell compared to normal cells There will be more trnas with the 'UCU' anticodon in the mutant cell The amino acid "Arg" will never be included in any proteins in the mutant cell There will be more trnas carrying "Ser" in the mutant cell compared to normal cells X The amino acid "Asn" will sometimes be added where "Arg" normally would be in proteins. ( pts) Below is the sequence of a complete mrna transcribed from a gene in bacteria. ' CUCGGAAGGUUACCUAAUGCUCGGGAUGUCCUAGGAACCCAUAAUAAU ' a. Write the protein sequence that is translated from this mrna on the line below, and label the amino (N) and carboxyl (C) termini of the protein. ( pts) Version A: N-Met-Leu-Gly-Met-Ser-C Version B: N-Met-Pro-Glu-Met-Val-C -2 pts incorrect or missing N/C labels, -2 if started wrong AUG, -4 if translated entire mrna, -1 for writing "stop" in the amino acid sequence, -1 for each missing or incorrectly translated aa. b. (1pt) How many trnas in total will bind the ribosome during the complete translation of this protein? c. ( pts) Put the following items in order (1-4) of when they bind to the mrna during translation. One item does not directly bind mrna, for that item write an "X" in its blank. +1 each correct ordered item, -2 if "X" incorrect the large ribosomal subunit 4 release factor 2 a trna carrying f-met X an amino-acyl trna synthetase 1 small ribosomal subunit Codon Table
4 . (14 pts) The diagram to the right shows two prokaryotic genes that are next to each other on the bacterial chromosome. "Gene A" codes for an mrna that is translated ' into the protein "RNA polymerase". ' "Gene B" codes for a trna that carries the amino acid valine (Val). "P" stands for the promoter sequence and "T" stands for the terminator sequence. P Gene A Gene B T T P C D a. (2 pts) The two grey boxes in the promoter of gene B represent the - and -10 regions. Which is more likely the -10 region? (Circle ONE) C D b. (2 pts) Can these two genes be transcribed at the same time? Yes Answer questions c-f with "gene A", "gene B", "both" or "neither": c. (2 pts) Which gene uses the top strand as a template for transcription? Gene B d. ( pts) Which gene's promoter will bind sigma? both e. ( pts) Which gene has a sequence of T's and C's in the template strand close to +1? Gene A f. (2 pts) For which gene will RNA polymerase end transcription at a stop codon? neither 7. (4 pts) The DNA below is a portion of a bacterial gene. One of the two ends of the DNA shown represents the +1 base pair. RNA polymerase will be moving from right to left, as shown. What will the first nucleotides of the RNA transcribed be? (Circle the ONE best answer) a. ' AGGUAG ' d. ' AUCUAU ' b. ' UCCAUC ' e. ' UAGAUA ' RNA polymerase moving... ' TAGGTAGCATAGAT ' ' ATCCATCGTATCTA '... c. ' AUGGAU ' f. There is not enough information to answer this question 4
5 8. (8 pts) Consider a molecule of glucose (C H O ) and a molecule of the fatty acid shown to the right (C H O 2 ). For this question, one molecule of each type is completely oxidized using cellular respiration. Note: fatty acids are modified and enter the Krebs Cycle. (2 pts for each blank) a. Which has more potential energy stored in its bonds? the fatty acid b. How many electron carriers will be reduced for glucose? the fatty acid? 1 c. Which molecule will result in more CO 2 as a product? (Circle ONE) - glucose - the fatty acid - they produce the same amount 9. (20 pts) The reaction to the right occurs during the Krebs cycle. Not all of the reactants or products are shown. a. For each statement below, write an "X" in the T or F column. (1 pt each) T F T F _X A carbon is oxidized. X_ CO 2 is a product. X_ Water is a product. X_ In cells, this is an endergonic reaction. X_ ATP drives this reaction forward. X An electron carrier is reduced. b. ( pts) Enzyme "X" catalyzes the reaction shown above. Can enzyme X catalyze different steps of the Krebs cycle? Why or why not? No. Each step of the Krebs cycle requires its own enzyme because enzymes are specific for their substrates. (explanation must be reasonable for full credit) c. ( pts) Enzyme X is shown to the right. It consists of two identical polypeptides. The ph of the matrix is 7.8. Which of the following levels of structure will change if I place enzyme X in a solution at ph 1? (Choose ALL correct answers) d. ( pts) Which of the following types of bonds will change if I place enzyme X in a solution at ph 1? (Choose ALL correct answers) - hydrogen bonds - disulfide bonds - ionic bonds e. (2 pts) How many genes encode this enzyme? one f. ( pts) In eukaryotes, this Krebs cycle enzyme is encoded by DNA in the nucleus and the mrna is translated in the cytoplasm. What should be present in the sequence of the eukaryotic protein that the prokaryotic version will not have? A mitochondrial localization sequence
Biochemistry 2000 Sample Question Transcription, Translation and Lipids. (1) Give brief definitions or unique descriptions of the following terms:
(1) Give brief definitions or unique descriptions of the following terms: (a) exon (b) holoenzyme (c) anticodon (d) trans fatty acid (e) poly A tail (f) open complex (g) Fluid Mosaic Model (h) embedded
More informationObjective: You will be able to explain how the subcomponents of
Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:
More informationBiological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A
Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:
More informationLife Sciences 1A Midterm Exam 2. November 13, 2006
Name: TF: Section Time Life Sciences 1A Midterm Exam 2 November 13, 2006 Please write legibly in the space provided below each question. You may not use calculators on this exam. We prefer that you use
More informationChemistry 107 Exam 4 Study Guide
Chemistry 107 Exam 4 Study Guide Chapter 10 10.1 Recognize that enzyme catalyze reactions by lowering activation energies. Know the definition of a catalyst. Differentiate between absolute, relative and
More informationDNA codes for RNA, which guides protein synthesis.
Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription
More informationProtein Synthesis and Mutation Review
Protein Synthesis and Mutation Review 1. Using the diagram of RNA below, identify at least three things different from a DNA molecule. Additionally, circle a nucleotide. 1) RNA is single stranded; DNA
More informationStudy Guide Key for CHEM 109 Fall 2015
Study Guide Key for CEM 109 Fall 2015 Remember you will need to show your work for full credit. n the real exam always work the problems you know best first. If you get hung up on a problem, you should
More informationTRANSLATION: 3 Stages to translation, can you guess what they are?
TRANSLATION: Translation: is the process by which a ribosome interprets a genetic message on mrna to place amino acids in a specific sequence in order to synthesize polypeptide. 3 Stages to translation,
More informationShort polymer. Dehydration removes a water molecule, forming a new bond. Longer polymer (a) Dehydration reaction in the synthesis of a polymer
HO 1 2 3 H HO H Short polymer Dehydration removes a water molecule, forming a new bond Unlinked monomer H 2 O HO 1 2 3 4 H Longer polymer (a) Dehydration reaction in the synthesis of a polymer HO 1 2 3
More informationProtein Synthesis
Protein Synthesis 10.6-10.16 Objectives - To explain the central dogma - To understand the steps of transcription and translation in order to explain how our genes create proteins necessary for survival.
More informationBiology. Lectures winter term st year of Pharmacy study
Biology Lectures winter term 2008 1 st year of Pharmacy study 3 rd Lecture Chemical composition of living matter chemical basis of life. Atoms, molecules, organic compounds carbohydrates, lipids, proteins,
More informationName: Date: Block: Biology 12
Name: Date: Block: Biology 12 Provincial Exam Review: Cell Processes and Applications January 2003 Use the following diagram to answer questions 1 and 2. 1. Which labelled organelle produces most of the
More informationNBCE Mock Board Questions Biochemistry
1. Fluid mosaic describes. A. Tertiary structure of proteins B. Ribosomal subunits C. DNA structure D. Plasma membrane structure NBCE Mock Board Questions Biochemistry 2. Where in the cell does beta oxidation
More information1. (a. Homeostasis / b. Feedback) is a state of constancy of conditions inside the human body
PLEASE BE AWARE CONTENT COVERED ON EXAMS VARIES FROM ONE SEMESTER TO ANOTHER. THIS EXAM MAY NOT CONTAIN MATERIAL THAT WILL BE ON YOUR EXAM THIS SEMESTER, AND/OR MAY CONTAIN MATERIAL THAT WILL NOT BE COVERED
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationStudent name ID # 2. (4 pts) What is the terminal electron acceptor in respiration? In photosynthesis?
1. Membrane transport. A. (4 pts) What ion couples primary and secondary active transport in animal cells? What ion serves the same function in plant cells? 2. (4 pts) What is the terminal electron acceptor
More informationFour Classes of Biological Macromolecules. Biological Macromolecules. Lipids
Biological Macromolecules Much larger than other par4cles found in cells Made up of smaller subunits Found in all cells Great diversity of func4ons Four Classes of Biological Macromolecules Lipids Polysaccharides
More informationAS Level Paper 1 and 2. A2 Level Paper 1 and 3 - Topics 1-4
Section 3.1: Biological Molecules 3.1.1 Monomers and Polymers 3.1.2 Carbohydrates 3.1.3 Lipids 3.1.4.1 Proteins 3.1.4.2 Enzymes 3.1.5.1 Nucleic acid structure 3.1.5.2 DNA Replication 3.1.6 ATP 3.1.7 Water
More informationSections 12.3, 13.1, 13.2
Sections 12.3, 13.1, 13.2 Now that the DNA has been copied, it needs to send its genetic message to the ribosomes so proteins can be made Transcription: synthesis (making of) an RNA molecule from a DNA
More informationExplain that each trna molecule is recognised by a trna-activating enzyme that binds a specific amino acid to the trna, using ATP for energy
7.4 - Translation 7.4.1 - Explain that each trna molecule is recognised by a trna-activating enzyme that binds a specific amino acid to the trna, using ATP for energy Each amino acid has a specific trna-activating
More informationGenetics Unit Bell Work September 27 & 28, 2016
Name: Date: Genetics Unit Bell Work September 27 & 28, 2016 nswer the following questions about the process shown above. 1. What are the reactants in this process? 2. What are the products in this process?
More informationComputational Biology I LSM5191
Computational Biology I LSM5191 Aylwin Ng, D.Phil Lecture Notes: Transcriptome: Molecular Biology of Gene Expression II TRANSLATION RIBOSOMES: protein synthesizing machines Translation takes place on defined
More informationOrganic molecules are molecules that contain carbon and hydrogen.
Organic Chemistry, Biochemistry Introduction Organic molecules are molecules that contain carbon and hydrogen. All living things contain these organic molecules: carbohydrates, lipids, proteins, and nucleic
More information2.2 Properties of Water
2.2 Properties of Water I. Water s unique properties allow life to exist on Earth. A. Life depends on hydrogen bonds in water. B. Water is a polar molecule. 1. Polar molecules have slightly charged regions
More informationAP BIOLOGY: READING ASSIGNMENT FOR CHAPTER 5
1) Complete the following table: Class Monomer Functions Carbohydrates 1. 3. Lipids 1. 3. Proteins 1. 3. 4. 5. 6. Nucleic Acids 1. 2) Circle the atoms of these two glucose molecules that will be removed
More informationCELLS. Cells. Basic unit of life (except virus)
Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%
More informationHand in the Test Sheets (with the checked multiple choice answers) and your Sheets with written answers.
Page 1 of 13 IMPORTANT INFORMATION Hand in the Test Sheets (with the checked multiple choice answers) and your Sheets with written answers. THE exam has an 'A' and 'B' section SECTION A (based on Dykyy's
More informationPROTEIN SYNTHESIS. It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.
PROTEIN SYNTHESIS It is known today that GENES direct the production of the proteins that determine the phonotypical characteristics of organisms.» GENES = a sequence of nucleotides in DNA that performs
More information/ The following functional group is a. Aldehyde c. Carboxyl b. Ketone d. Amino
Section A: Multiple Choice Select the answer that best answers the following questions. Please write your selected choice on the line provided, in addition to circling the answer. /25 1. The following
More informationPhysicsAndMathsTutor.com. Question Number. Answer Additional Guidance Mark. 1(a) 1. mutation changes the sequence of bases / eq ;
1(a) 1. mutation changes the sequence of bases / eq ; 2. reference to stop code / idea of {insertion / deletion / eq} changes all triplets / frame shift / eq ; 3. {transcription / translation} does not
More informationGood Afternoon! 11/30/18
Good Afternoon! 11/30/18 1. The term polar refers to a molecule that. A. Is cold B. Has two of the same charges C. Has two opposing charges D. Contains a hydrogen bond 2. Electrons on a water molecule
More informationTopic 3: The chemistry of life (15 hours)
Topic : The chemistry of life (5 hours). Chemical elements and water.. State that the most frequently occurring chemical elements in living things are carbon, hydrogen, oxygen and nitrogen...2 State that
More informationCells N5 Homework book
1 Cells N5 Homework book 2 Homework 1 3 4 5 Homework2 Cell Ultrastructure and Membrane 1. Name and give the function of the numbered organelles in the cell below: A E B D C 2. Name 3 structures you might
More informationSID#: Also give full SID# (w/ 9) on your computer grid sheet (fill in grids under Student Number) BIO 315 Exam I
SID#: Also give full SID# (w/ 9) on your computer grid sheet (fill in grids under Student Number) BIO 315 Exam I Choose an answer of A,B, C, or D for each of the following Multiple Choice Questions 1-35.
More informationFrom Atoms to Cells: Fundamental Building Blocks. Models of atoms. A chemical connection
From Atoms to Cells: A chemical connection Fundamental Building Blocks Matter - all materials that occupy space & have mass Matter is composed of atoms Atom simplest form of matter not divisible into simpler
More informationRNA (Ribonucleic acid)
RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal
More informationAMERICAN NATIONAL SCHOOL General Certificate of Education Advanced Level
MERIN NTIONL SHOOL General ertificate of Education dvanced Level IOLOGY 9700/01 Paper 1 Multiple hoice lass 1 dditional Materials: Multiple hoice nswer Sheet Soft clean eraser Soft pencil (type or H is
More informationTest Review Worksheet 1 Name: Per:
Test Review Worksheet 1 Name: Per: 1. Put the following in order according to blood flow through the body, starting with the lungs: Lungs, right atrium, left atrium, right ventricle, left ventricle, aorta,
More informationThe Structure and Function of Large Biological Molecules
NAME DATE Chapter 5 - The Structure and Function of Large Biological Molecules Guided Reading Concept 5.1: Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall
More informationActivity: Biologically Important Molecules
Activity: Biologically Important Molecules AP Biology Introduction We have already seen in our study of biochemistry that the molecules that comprise living things are carbon-based, and that they are thought
More informationGenetic information flows from mrna to protein through the process of translation
Genetic information flows from mrn to protein through the process of translation TYPES OF RN (RIBONUCLEIC CID) RN s job - protein synthesis (assembly of amino acids into proteins) Three main types: 1.
More informationBIOLOGICAL MOLECULES REVIEW-UNIT 1 1. The factor being tested in an experiment is the A. data. B. variable. C. conclusion. D. observation. 2.
BIOLOGICAL MOLECULES REVIEW-UNIT 1 1. The factor being tested in an experiment is the A. data. B. variable. C. conclusion. D. observation. 2. A possible explanation for an event that occurs in nature is
More informationTRANSLATION. Translation is a process where proteins are made by the ribosomes on the mrna strand.
TRANSLATION Dr. Mahesha H B, Yuvaraja s College, University of Mysore, Mysuru. Translation is a process where proteins are made by the ribosomes on the mrna strand. Or The process in the ribosomes of a
More informationMULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question.
Practice Quiz 1 AP Bio Sept 2016 Name MULTIPLE CHOICE. Choose the one alternative that best completes the statement or answers the question. 1) The element present in all organic molecules is A) hydrogen.
More informationObjectives: Prof.Dr. H.D.El-Yassin
Protein Synthesis and drugs that inhibit protein synthesis Objectives: 1. To understand the steps involved in the translation process that leads to protein synthesis 2. To understand and know about all
More informationChapter 5: The Structure and Function of Large Biological Molecules
Name Period Concept 5.1 Macromolecules are polymers, built from monomers 1. The large molecules of all living things fall into just four main classes. Name them. 2. Circle the three classes that are called
More informationKEY NAME (printed very legibly) UT-EID
BIOLOGY 311C - Brand Spring 2007 KEY NAME (printed very legibly) UT-EID EXAMINATION II Before beginning, check to be sure that this exam contains 7 pages (including front and back) numbered consecutively,
More informationCentral Dogma. Central Dogma. Translation (mrna -> protein)
Central Dogma Central Dogma Translation (mrna -> protein) mrna code for amino acids 1. Codons as Triplet code 2. Redundancy 3. Open reading frames 4. Start and stop codons 5. Mistakes in translation 6.
More informationBCH 4054 December 13, 1999
BH 4054 December 13, 1999 FINL EXM This exam consists of six pages. Make sure you have one of each. For questions indicating a choice, answer only one of the choices. (If you answer both, you need to indicate
More informationPaper Reference. Paper Reference(s) 6101/01 Edexcel GCE Biology Biology (Human) Advanced Subsidiary Unit Test 1
Centre No. Candidate No. Paper Reference(s) 6101/01 Edexcel GCE Biology Biology (Human) Advanced Subsidiary Unit Test 1 Monday 4 June 2007 Morning Time: 1 hour Materials required for examination Ruler
More informationAmino acids. Side chain. -Carbon atom. Carboxyl group. Amino group
PROTEINS Amino acids Side chain -Carbon atom Amino group Carboxyl group Amino acids Primary structure Amino acid monomers Peptide bond Peptide bond Amino group Carboxyl group Peptide bond N-terminal (
More information1) DNA unzips - hydrogen bonds between base pairs are broken by special enzymes.
Biology 12 Cell Cycle To divide, a cell must complete several important tasks: it must grow, during which it performs protein synthesis (G1 phase) replicate its genetic material /DNA (S phase), and physically
More informationMacromolecules. 3. There are several levels of protein structure, the most complex of which is A) primary B) secondary C) tertiary D) quaternary
Macromolecules 1. If you remove all of the functional groups from an organic molecule so that it has only carbon and hydrogen atoms, the molecule become a molecule. A) carbohydrate B) carbonyl C) carboxyl
More informationWHY IS THIS IMPORTANT?
CHAPTER 2 FUNDAMENTAL CHEMISTRY FOR MICROBIOLOGY WHY IS THIS IMPORTANT? An understanding of chemistry is essential to understand cellular structure and function, which are paramount for your understanding
More information9/16/15. Properties of Water. Benefits of Water. More properties of water
Properties of Water Solid/Liquid Density Water is densest at 4⁰C Ice floats Allows life under the ice Hydrogen bond Ice Hydrogen bonds are stable Liquid water Hydrogen bonds break and re-form Benefits
More information1. Describe the difference between covalent and ionic bonds. What are the electrons doing?
Exam 1 Review Bio 212: 1. Describe the difference between covalent and ionic bonds. What are the electrons doing? 2. Label each picture either a Carbohydrate, Protein, Nucleic Acid, or Fats(Lipid). a.
More informationRNA and Protein Synthesis Guided Notes
RNA and Protein Synthesis Guided Notes is responsible for controlling the production of in the cell, which is essential to life! o DNARNAProteins contain several thousand, each with directions to make
More informationChapter 5-7, 10. Read P , , and
Chapter 5-7, 10 Read P. 75-82, 91-100, 107-117 and 173-185 Introduction to Metabolism and Enzymes Catabolic reactions (also called catabolism ) break down larger, more complex molecules into smaller molecules
More informationChapter 5: Structure and Function of Macromolecules AP Biology 2011
Chapter 5: Structure and Function of Macromolecules AP Biology 2011 1 Macromolecules Fig. 5.1 Carbohydrates Lipids Proteins Nucleic Acids Polymer - large molecule consisting of many similar building blocks
More informationMacromolecules Chapter 2.3
Macromolecules Chapter 2.3 E.Q. What are the 4 main macromolecues found in living things and what are their functions? Carbon-Based Molecules Why is carbon called the building block of life? Carbon atoms
More informationChapter 5: The Structure and Function of Large Biological Molecules
Chapter 5: The Structure and Function of Large Biological Molecules 1. Name the four main classes of organic molecules found in all living things. Which of the four are classified as macromolecules. Define
More information3. Hydrogen bonds form between which atoms? Between an electropositive hydrogen and an electronegative N, O or F.
Chemistry of Life Answers 1. Differentiate between an ionic and covalent bond. Provide an example for each. Ionic: occurs between metals and non-metals, e.g., NaCl Covalent: occurs between two non-metals;
More informationThis exam consists of two parts. Part I is multiple choice. Each of these 25 questions is worth 2 points.
MBB 407/511 Molecular Biology and Biochemistry First Examination - October 1, 2002 Name Social Security Number This exam consists of two parts. Part I is multiple choice. Each of these 25 questions is
More information(A) Cell membrane (B) Ribosome (C) DNA (D) Nucleus (E) Plasmids. A. Incorrect! Both prokaryotic and eukaryotic cells have cell membranes.
High School Biology - Problem Drill 03: The Cell No. 1 of 10 1. Which of the following is NOT found in prokaryotic cells? #01 (A) Cell membrane (B) Ribosome (C) DNA (D) Nucleus (E) Plasmids Both prokaryotic
More informationBurton's Microbiology for the Health Sciences
Burton's Microbiology for the Health Sciences Section III. Chemical and Genetic Aspects of Microorganisms Burton's Microbiology for the Health Sciences Chapter 6. Biochemistry: The Chemistry of Life 1
More informationBiochemistry 423 Final Examination NAME:
Biochemistry 423 Final Examination NAME: 1 Circle the single BEST answer (3 points each) 1. At equilibrium the free energy of a reaction G A. depends only on the temperature B. is positive C. is 0 D. is
More informationFor questions 1-4, match the carbohydrate with its size/functional group name:
Chemistry 11 Fall 2013 Examination #5 PRACTICE 1 For the first portion of this exam, select the best answer choice for the questions below and mark the answers on your scantron. Then answer the free response
More informationChapter 32: Translation
Chapter 32: Translation Voet & Voet: Pages 1343-1385 (Parts of sections 1-3) Slide 1 Genetic code Translates the genetic information into functional proteins mrna is read in 5 to 3 direction Codons are
More informationBiology 12 - Biochemistry Practice Exam
Biology 12 - Biochemistry Practice Exam Name: Water: 1. The bond between water molecules is a (n) a. ionic bond b. covalent bond c. polar covalent bond d. hydrogen bond 2. The water properties: good solvent,
More informationBIOCHEMISTRY. How Are Macromolecules Formed? Dehydration Synthesis or condensation reaction Polymers formed by combining monomers and removing water.
BIOCHEMISTRY Organic compounds Compounds that contain carbon are called organic. Inorganic compounds do not contain carbon. Carbon has 4 electrons in outer shell. Carbon can form covalent bonds with as
More informationBIOMOLECULES. (AKA MACROMOLECULES) Name: Block:
BIOMOLECULES (AKA MACROMOLECULES) Name: Block: BIOMOLECULES POGIL All living things share the same chemical building blocks and depend on chemical processes for survival. Life without carbon (C) would
More informationHuman Anatomy & Physiology
PowerPoint Lecture Slides prepared by Barbara Heard, Atlantic Cape Community College Ninth Edition Human Anatomy & Physiology C H A P T E R 3 Annie Leibovitz/Contact Press Images 2013 Pearson Education,
More informationBIOH111. o Cell Biology Module o Tissue Module o Integumentary system o Skeletal system o Muscle system o Nervous system o Endocrine system
BIOH111 o Cell Biology Module o Tissue Module o Integumentary system o Skeletal system o Muscle system o Nervous system o Endocrine system Endeavour College of Natural Health endeavour.edu.au 1 Textbook
More informationTranslation Activity Guide
Translation Activity Guide Student Handout β-globin Translation Translation occurs in the cytoplasm of the cell and is defined as the synthesis of a protein (polypeptide) using information encoded in an
More informationCarbon. Isomers. The Chemical Building Blocks of Life
The Chemical Building Blocks of Life Carbon Chapter 3 Framework of biological molecules consists primarily of carbon bonded to Carbon O, N, S, P or H Can form up to 4 covalent bonds Hydrocarbons molecule
More informationThe Blueprint of Life: DNA to Protein. What is genetics? DNA Structure 4/27/2011. Chapter 7
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the study of genes, how they carry information, how they are replicated, how they are expressed NA Structure
More informationThe Blueprint of Life: DNA to Protein
The Blueprint of Life: NA to Protein Chapter 7 What is genetics? The science of heredity; includes the y; study of genes, how they carry information, how they are replicated, how they are expressed 1 NA
More information2.2 Cell Construction
2.2 Cell Construction Elemental composition of typical bacterial cell C 50%, O 20%, N 14%, H 8%, P 3%, S 1%, and others (K +, Na +, Ca 2+, Mg 2+, Cl -, vitamin) Molecular building blocks Lipids Carbohydrates
More informationMacromolcules, Enzymes, & Cells Intro
Name: Date: 1. The distortion (change in shape) of enzyme molecules which occurs at high temperatures is known as 5. A characteristic shared by all enzymes, hormones, and antibodies is that their function
More informationCells and Tissues 3PART C. PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College
PowerPoint Lecture Slide Presentation by Patty Bostwick-Taylor, Florence-Darlington Technical College Cells and Tissues 3PART C Protein Synthesis Gene DNA segment that carries a blueprint for building
More informationTHE CHEMISTRY OF LIFE
Name Date Class 24 THE CHEMISTRY OF LIFE SECTION 24.1 A STRATEGY FOR LIFE (pages 763 765) This section describes the structure of a typical eukaryotic cell. It also explains the relationship between photosynthesis
More information(65 pts.) 27. (10 pts.) 28. (15 pts.) 29. (10 pts.) TOTAL (100 points) Moorpark College Chemistry 11 Spring Instructor: Professor Gopal
Moorpark College Chemistry 11 Spring 2012 Instructor: Professor Gopal Examination # 5: Section Five May 1, 2012 Name: (print) GOOD LUCK! Directions: Make sure your examination contains TWELVE total pages
More informationChapter 2. What is life? Reproduction. All living things are made of cells
What is life? Chapter 2 The Nature of Life All living things are made of cells Composed of one or more cells ossess inherited information (DNA) Reproduce Develop respond to the environment Assimilate and
More informationBiology Chapter 2 Review
Biology Chapter 2 Review Vocabulary: Define the following words on a separate piece of paper. Element Compound Ion Ionic Bond Covalent Bond Molecule Hydrogen Bon Cohesion Adhesion Solution Solute Solvent
More information1 A *Copyright Michigan State University. Unauthorized copying or distribution is punishable by law.*
Midterm Exam Note: Before beginning, please scan the entire exam so that you can budget your time. If necessary you may request a "challenge sheet" to present alternate interpretations of questions, but
More informationLipids: diverse group of hydrophobic molecules
Lipids: diverse group of hydrophobic molecules Lipids only macromolecules that do not form polymers li3le or no affinity for water hydrophobic consist mostly of hydrocarbons nonpolar covalent bonds fats
More informationRNA Processing in Eukaryotes *
OpenStax-CNX module: m44532 1 RNA Processing in Eukaryotes * OpenStax This work is produced by OpenStax-CNX and licensed under the Creative Commons Attribution License 3.0 By the end of this section, you
More information2.3: Carbon-Based Molecules Notes
2.3: Carbon-Based Molecules Notes Carbon-based molecules are the of life. Bonding Properties of Carbon Carbon forms bonds with up to other atoms, including other carbon atoms. QUESTION: What types of elements
More informationBIOLOGY 12 SAMPLE QUESTIONS
BIOLOGY 12 SAMPLE QUESTIONS The following are examples of the cognitive levels: K (), U ( and Application) and H (). It should be noted that cognitive level does not necessarily reflect level of difficulty.
More informationBIOLOGY 311C - Brand Spring 2010
BIOLOGY 311C - Brand Spring 2010 NAME (printed very legibly) KEY UT-EID EXAMINATION III Before beginning, check to be sure that this exam contains 8 pages (including front and back) numbered consecutively,
More informationCLASS SET. Modeling Life s Important Compounds. AP Biology
Modeling Life s Important Compounds AP Biology CLASS SET OBJECTIVES: Upon completion of this activity, you will be able to: Explain the connection between the sequence and the subcomponents of a biological
More informationHigh School Science MCA Item Sampler Teacher Guide
High School Science MCA Item Sampler Teacher Guide Overview of Item Samplers Item samplers are one type of student resource provided to help students and educators prepare for test administration. While
More informationChapter 5 THE STRUCTURE AND FUNCTION OF LARGE BIOLOGICAL MOLECULES
Chapter 5 THE STRUCTURE AND FUNCTION OF LARGE BIOLOGICAL MOLECULES You Must Know The role of dehydration synthesis in the formation of organic compounds and hydrolysis in the digestion of organic compounds.
More informationThe Structure and Function of Biomolecules
The Structure and Function of Biomolecules The student is expected to: 9A compare the structures and functions of different types of biomolecules, including carbohydrates, lipids, proteins, and nucleic
More informationConcept 8.3: ATP powers cellular work by coupling exergonic reactions to endergonic reactions
Concept 8.3: ATP powers cellular work by coupling exergonic reactions to endergonic reactions A cell does three main kinds of work: Chemical Transport Mechanical To do work, cells manage energy resources
More informationMULTIPLE CHOICE QUESTIONS
MULTIPLE CHOICE QUESTIONS 1. Which of the following statements concerning anabolic reactions is FALSE? A. They are generally endergonic. B. They usually require ATP. C. They are part of metabolism. D.
More informationAssignment #1: Biological Molecules & the Chemistry of Life
Assignment #1: Biological Molecules & the Chemistry of Life A. Important Inorganic Molecules Water 1. Explain why water is considered a polar molecule. The partial negative charge of the oxygen and the
More informationChapter 3. Table of Contents. Section 1 Carbon Compounds. Section 2 Molecules of Life. Biochemistry
Biochemistry Table of Contents Section 1 Carbon Compounds Section 2 Molecules of Life Section 1 Carbon Compounds Objectives Distinguish between organic and inorganic compounds. Explain the importance of
More information