JVI Accepts, published online ahead of print on 23 March 2011 J. Virol. doi: /jvi

Transcription

1 JVI Accepts, published online ahead of print on 23 March 2011 J. Virol. doi: /jvi Copyright 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 2 Antiviral Stilbene 1,2-Diamines Prevent Initiation Of Hepatitis C Viral RNA Replication At The Outset of Infection Pablo Gastaminza 1, Suresh M. Pitram 2, Marlene Dreux 1, Larissa B. Krasnova 2, Christina Whitten-Bauer 1, Jiajia Dong 2, Josan Chung 1, Valery V. Fokin 2, K. Barry Sharpless 2 and Francis V. Chisari 1. 1 Department of Immunology and Microbial Science; 2 Department of Chemistry The Scripps Research Institute North Torrey Pines Road La Jolla, CA Address correspondence to: Pablo Gastaminza. Department of Cellular and Molecular Biology. Lab 116. Centro Nacional de Biotecnologia (CNB-CSIC). Campus Universidad Autónoma de Madrid, Cantoblanco. C/ Darwin, MADRID (SPAIN) Phone Number: Fax: pgastaminza@cnb.csic.es Abstract length: 190 words. Manuscript length: 5920 words. Running Title: Inhibitors of HCV RNA replication initiation

2 Abstract The recent development of a cell culture model of HCV infection based on the JFH-1 molecular clone has enabled discovery of new antiviral agents. Using a cell-based colorimetric screening assay to interrogate a 1,200 compound chemical library for anti- HCV activity, we identified a family of 1,2-diamines derived from trans-stilbene oxide that prevent HCV infection at nontoxic, low micromolar concentrations in cell culture. Structure-activity relationship analysis of ~300 derivatives synthesized using click chemistry yielded compounds with greatly enhanced low nanomolar potency and a >1000:1 therapeutic ratio. Using surrogate models of HCV infection we showed that the compounds selectively block the initiation of replication of incoming HCV RNA but have no impact on viral entry, primary translation, or ongoing HCV RNA replication, nor do they suppress persistent HCV infection. Selection of an escape variant revealed that NS5A is directly or indirectly targeted by this compound. In summary, we have identified a family of HCV inhibitors that target a critical step in the establishment of HCV infection in which NS5A translated de novo from an incoming genomic HCV RNA template is required to initiate the replication of this important human pathogen

3 Introduction Hepatitis C virus (HCV) is a hepatotropic, enveloped virus with single stranded RNA genome of positive polarity that causes acute and chronic hepatitis and hepatocellular carcinoma (36). More than 170 million people are chronically infected and are at risk of developing cirrhosis and hepatocellular carcinoma (25). There is currently no vaccine against HCV and the only approved antiviral therapy, a combination of recombinant type I interferon alpha and ribavirin, is expensive, toxic and only partially effective (50). HCV is a member of the Flaviviridae family. Its 9.6-kb RNA genome encodes a long open reading frame that is co- and post-translationally cleaved by cellular and viral proteases (reviewed in (52)) into structural proteins (core, E1, E2) that constitute the major viral components of the viral particles, and non-structural proteins (p7, NS2, NS3, NS4A, NS4B, NS5A and NS5B) that are required at multiple levels of the virus life cycle including viral RNA replication (2) and infectious particle assembly (46). The single open reading frame is located between two untranslated regions, the 5 UTR and 3 UTR, that contain RNA sequences essential for RNA translation and replication, respectively (15, 16, 24). HCV infection is initiated when viral particles bind and enter the target cells in a process that involves multiple cellular receptors and clathrin-dependent endocytosis (7). Release of the viral genome into the cytoplasm is thought to occur after low ph induced membrane fusion, a process mediated by the viral envelope glycoproteins (61). Incoming viral genomes are translated into the viral polyprotein in a process that requires components of the autophagy machinery (12). Cleavage of the polyprotein into the - 3 -

4 individual viral proteins enables the establishment of replication complexes in ERderived membranous compartments where viral RNA replication occurs via minus strand synthesis (45). Progeny genomes are either translated to produce additional viral proteins or packaged to assemble progeny infectious virions. Virus particle assembly is thought to occur in an ER-related compartment in close proximity to cytosolic lipid droplets, where core and NS5A proteins co-localize (44)41). HCV RNA-containing core particles acquire their envelope by budding through the ER membrane at sites where E1E2 glycoprotein complexes are inserted (55). The HCV assembly process is dependent not only on structural and non-structural proteins (p7, NS2, NS3 and NS5A) (1, 27, 29, 30, 39, 43, 47, 56, 59, 63) but also on cellular factors involved in lipoprotein biosynthesis (10, 18, 26, 28, 48). HCV assembly results in the production of high-density intracellular infectious precursors that undergo maturation during their passage through the secretory pathway where they acquire their characteristic low-density extracellular configuration (21). Extracellular virions are spherical, pleomorphic particles that are heterogeneous in size (31, 35, 42, 54, 60) some of which are surrounded by a membrane bilayer, likely the viral envelope, that can be observed by cryoelectron microscopy (19). The development of hepatoma-derived cell lines bearing autonomously replicating HCV RNA (replicons) (8, 38) permitted the development of potent antiviral molecules directed against the viral NS3 protease, the NS5B RNA-dependent RNA polymerase (49), and recently NS5A (17), a zinc metalloprotein that is required for viral replication and particle assembly (41, 59). The opportunity to develop compounds that target additional steps in the HCV life cycle awaited the development of cell culture infection models that recapitulated all aspects of the viral infection. We recently - 4 -

5 established a cell-based unbiased screening procedure that permits interrogation of chemical libraries for antiviral activity against all steps in the HCV life cycle, including cellular and viral factors required for efficient viral spread (22). Using this technology, we have discovered a class of antiviral compounds that selectively blocks the initiation of HCV RNA replication in vitro without affecting ongoing HCV RNA replication, a unique and hitherto obscure step in HCV infection that can now be approached experimentally for basic and translational purposes. Methods Library description. The initial chemical library was composed of ~1,200 compounds with diverse skeletal architectures (i.e., acyclic, cyclic, fused/bridged polycyclic, heterocyclic, aromatic). Their assembly relied on click chemistry, focusing primarily on carbonheteroatom linkages (32). This synthetic strategy allowed for rapid generation of large quantities (grams) of material in high yields requiring relatively simple purification methods. Inherently incorporated into these structures were functional groups that immediately enabled further diversification for SAR analysis and hit compound optimization. Synthesis of compounds 1 and 2. The syntheses of compounds 1 and 2 are illustrated in Suppl. Figure 1. Synthetic procedures for 1 have been described (20). A detailed preparation of compound 2 along with the SAR studies leading to 2 will be described in a future report (53). Dry powders - 5 -

6 of 1 and 2 were dissolved in DMSO to a final 10 mm concentration. The solution of compound 2 required heating at 65 o C for 5 minutes before use as this compound tends to precipitate in DMSO at relatively high concentrations (10 mm), although it is watersoluble up to 50 µm. Library screening. The chemical library described above was screened using a colorimetric HCV infection readout as described in Gastaminza et al. (22). Briefly, compounds were dissolved in DMSO at a final concentration of 10 mm, diluted to a final concentration of 20µM in 100 µl of culture medium (D-MEM 10% FCS) and mixed (1:1) with 100µl of a D183 virus (66) dilution (2x10 3 ffu/ml) in medium. One hundred microliters (100 µl) of this mixture was used to inoculate 10 4 Huh clone 2 cells (51) per well (multiplicity of infection m.o.i ) in a 96-well format (Falcon flat bottom 96-well cell culture microplate- BD Biosciences-La Jolla, CA) in duplicate as previously described (20). The cells were incubated at 37 C for 72 hours after which the cells were fixed with 4% paraformaldehyde (PFA) for 20 minutes at room temperature (RT). PFA-fixed cells were subsequently processed as described previously (22). Every test plate included control wells with uninfected cells that were used to subtract background values. Relative infection efficiency values were calculated from the colorimetric values using a standard curve generated by serial 2-fold virus dilutions starting at 200 ffu/well. Data were considered only if the standard curves displayed correlation coefficients (r 2 ) above Compound toxicity was determined by evaluating the cell biomass remaining at 72 hours post-inoculation by crystal violet staining and colorimetry at 570 nm as - 6 -

7 described previously (6). Compounds resulting in a reduction of the biomass below ~70% of that of the controls were considered toxic and discarded for further analysis. Compounds reducing infection efficiency by more than 10-fold in the absence of toxicity were considered hits and were further characterized. Determination of potency (EC 50 ) and toxicity (LD 50 ). Compound stock solutions (100 µm) were prepared by diluting a 10 mm solution in DMSO (1.5 µl) in complete medium (148 µl). Subsequent serial 3-fold dilutions of the compound were prepared in culture medium (D-MEM 10% FCS). Compound dilutions (50 µl) were mixed with 50 µl of a virus dilution in complete medium containing 200 ffu Mixtures containing virus and compound dilutions ranging from 50 µm to 0.4 nm were added to Huh c2 cells in 96-well plates and assayed as described above. EC 50 and EC 90 values were obtained by graphic interpolation of the compound concentration resulting in 50% and 90% HCV infection inhibition in the linear portion of the curve. LD 50 values were determined by evaluating the cell biomass remaining at 72 hours post-inoculation as described above. LD 50 values were interpolated graphically from the dose-response curves. Similar values were obtained using MTT-formazan cellular viability assays performed in parallel (23). 154 Viruses and Cells Huh-7, Huh and Huh c2 cells were cultured in D-MEM 10% fetal calf serum (FCS) as previously described (51, 65). JFH-1 and D183 adapted virus stocks were - 7 -

8 produced as described. Establishment of persistent JFH-1 infections was previously described (18) Determination of infectivity titers and HCV RNA levels. Infectivity titers and HCV RNA levels were measured by titration and reversetranscription quantitative PCR (RT-qPCR) as previously described (21, 65). HCV pseudotype particle infectivity inhibition assay. HCV E1/E2-pseudotyped (or VSV-G pseudotyped as a control) lentiviral particles bearing the luciferase reporter gene were generated as described (4). Comparable amounts of infectious HCVpp and VSVpp were used in every experiment. For the inhibition assays, particles were mixed 1:1 with medium containing (DMSO) or with compound dilutions to achieve a final 5 µm concentration. The mixture was used to inoculate Huh-7 cells at 37 o C for another 72-hour period after which infection efficiency was evaluated by measuring reporter gene expression using a commercial kit (Luciferase Assay System, Promega- Madison, WI). Relative infection values were obtained using DMSO-treated cells as control (100%). Background levels were established by measuring luciferase expression in cells transduced with HCVpp lacking envelope glycoproteins, as previously described (4) Multiple cycle infections - 8 -

9 Huh clone 2 cells (5 X 10 5 cells; 6-well plate) were inoculated (moi 0.01) with D183 virus (66) in the presence of the indicated compound doses and incubated for 6 days at 37 o C. Cells were split (1:3) at days 2 and 4 post-inoculation, time at which the cells were replenished with fresh medium containing the compounds. Samples of the cells and cell supernatants were tested for infectivity and HCV RNA at days 2, 4 and 6. Single cycle infections Huh-7 cells were seeded in 24-well plates (5 X10 4 cells/well) and inoculated with D183 virus 24 hours later (moi 10) in the presence of the indicated compound doses and further incubated for 40 hours in complete medium at 37 o C. Samples of the cells and supernatants were collected at 40 hours post-infection for HCV RNA and infectivity analyses. -Time of addition experiments: Dilutions of compound 2 (10 µm) and D183 virus (10 6 ffu/ml) were prepared in medium containing 10% FCS. Huh-7 cells (2.5 X 10 4 cells/well; 48-well plate) were either inoculated at time 0 with a 1:1 mixture of the compound (250 µl) and virus dilutions (250 µl) or pre-treated with the compound (1:1 mixture with medium) or the virus (250 µl of virus). At the indicated times, pre-treated cells were inoculated with the virus dilution (250 µl) and cells inoculated at time 0 were treated with 250 µl of the compound dilution. Cells were further incubated at 37 o C for 40 hours and harvested to measure HCV RNA accumulation. The compounds remained present in the medium throughout the experiment except for the data shown in Suppl. Figure 2 where the pretreated cells were washed twice with PBS before virus inoculation

10 Infection efficiency was determined by measuring intracellular HCV RNA accumulation 40 hours post-infection Inoculation at low temperature: Single cycle infections were performed as described above by incubating virus dilutions (moi 10) with target cells in the presence or absence of the compounds (5µM) for 1 hr on ice. Cells were then washed twice with cold PBS. Warm medium containing either the compounds (5 µm) or DMSO as control was added to the cells that were further incubated at 37 o C. Infection efficiency was determined by measuring intracellular HCV RNA accumulation 40 hours post-infection. Subgenomic replicon transfection Subgenomic genotype 2a (JFH-1) (12) or genotype 1b (Con1-Bart79ILuc) (11) replicons bearing a luciferase reporter gene was electroporated into Huh-7 and Huh cells respectively as described previously (12). For primary translation experiments a replication-deficient mutant subgenomic JFH1 replicon bearing a point mutation in the NS5B catalytic site (GND mutant) was transfected (12). Cells were then plated into replicate wells (5x10 4 cells/well) in the presence of the inhibitors (5 µm) or DMSO as negative control. Unless otherwise stated, compounds were added immediately after transfection and replenished at 24 hours. Samples were collected at the indicated time points and tested for luciferase activity using a commercially available kit (Renilla Luciferase Assay System, Promega- Madison, WI) Treatment of persistently infected cells

11 222 Persistent infections were established as described previously (18). Persistently 223 infected cells were seeded (10 5 cells/well; 12-well plate) the day before treatment Compounds were diluted in medium (5 µm) and added to the cell cultures. Cells were incubated for 24 hours at 37 o C after which the media were replenished with fresh compound. After 40 hours of incubation at 37 o C, samples of the cells and the supernatants were analyzed for infectivity and HCV RNA. Selection of compound 2-resistant variants and viral genome sequencing. A stock of D183 virus was used to inoculate clone 2 cells (1.5X 10 6 cells; T75 flask) at high multiplicity (moi of 10) in the presence or absence of compound 2 (0.5 µm). Seventy-two hours post-infection, supernatants were collected, filtered through a 45 µm filter. Supernatants were diluted (1:10) in fresh medium and used to inoculate naïve clone 2 cells. Five blind passages later in the presence of compound 2 (0.5 µm), supernatants were diluted 1:100 and used to inoculate naïve cells at low moi in the presence of 2.5 µm of compound 2 and subjected to five additional blind passages in the presence of compound 2 (2.5 µm). Diluted supernatants were used to inoculate naïve cells in the presence of 5 µm of compound 2 for 10 additional blind passages in the presence of 5 µm. Samples of the supernatants were tested for their susceptibility to compound 2 by determining the infectivity titer in the presence or absence of 5 µm of the compound. HCV RNA was isolated from the supernatants of passages 12, 14 and 18. Viral genome populations were bulk-sequenced as previously described (66). All sequences were compared to the parental JFH-1 genotype and mutations were only considered if they were present in all three samples

12 Generation of mutant replicons Point mutants were generated by PCR-mediated mutagenesis using the mutagenic primers (5-3 ): Fragment NsiI-RsrII CGCCACATGCATGCAAGCTGACCT; Fragment NsiI-RsrII reverse (mutagenic E2371A) GCACGGACCGCCGGATgCGGCGG; F2004L forward CTGACCTCTAAATTGcTCCCCAAGCTGC; F2004L reverse GCAGCTTGG GGAgCAATTTAGAGGTCAG; RsrII-EcoRV Fragment forward GAATCCGGCGGT CCGACGTCCCC; RsrII-EcoRV Fragment reverse GAAGAGATATCGGCCGC AAACGGCCG; K2493R forward TCACAGAGGGCTAAAAgGGTAACTTTTGA CAGG; K2493R reverse CCTGTCAAAAGTTACCcTTTTAGCCCTCTGTGA; A2780T forward GAGCGGAACCTGAGAaCCTTCACGGAGGCC; A2780T reverse GGCCTCC GTGAAGGtTCTCAGGTTCCGCTC. All PCR products were cloned into pgem-t vector (Promega-Madison, WI) and individual clones were sequenced to verify the presence of the mutation of interest and the absence of additional mutations. Mutant fragments were cloned into the parental vector using NsiI-RsrII sites for F2004L and E2371A and RsrII-EcoRV for K2493R and A2780T. F2004L mutant was constructed by transferring the NsiI and BsshII fragment from the double mutant NsiI-RsrII fragment bearing the F2004L-E2371A mutations into the parental plasmid. Double mutant K2493R-A2780T was generated by site-directed mutagenesis of the replicon bearing the mutation A2780T Results

13 Compounds 1 and 2 represent a novel family of small molecule inhibitors of HCV infection. We interrogated a small library of structurally diverse compounds using an unbiased colorimetric cell-based screening assay for inhibitors of HCV infection that allows quantitation of JFH-1 spread quantitatively in a 96-well format (20). Non-toxic compounds that strongly inhibited viral spread (>10-fold) were selected for further characterization. Analysis of the chemical structure of the antiviral compounds identified in the first round of screening lead to the identification of a novel family of small molecules that significantly reduced viral spread at low concentrations (EC 50 <5µM) in cell culture in the absence of measurable cytotoxicity (CC 50 >25µM). The chemical structure of a representative member of the family is shown in Figure 1A (compound 1). Synthesis of over 300 compound 1 derivatives permitted extensive structure-activity relationship (SAR) analysis, resulting in the development of compound 2 (Figure 1A, compound 2), that displayed remarkably higher potency (EC 50 <50 nm) and comparable cytoxicity (CC 50 >35µM). A detailed description of the chemical library used for the screening, the structure-activity relationship (SAR) analysis conducted to obtain compound 2, as well as the structural elements required for optimal antiviral activity will be described elsewhere (53). In this report, we will describe experiments that defined the step of the viral life cycle that is targeted by these inhibitors and that provide insight into their mode of action against HCV in cell culture. First, to independently confirm the ability of these compounds to interfere with HCV spread in cell culture, Huh-7 cells were inoculated at low multiplicity (moi 0.01) with the cell-culture adapted variant of JFH-1, D183 virus (66), in the presence of

14 compounds 1 or 2 (5 µm). Extracellular infectivity titers of supernatants collected at days 2, 4 and 6 post-infection indicated partial inhibition of HCV spread with compound 1, that caused a modest reduction in the titers found at every time point (Figure 1B). As expected, compound 2 reduced viral titers to levels below detection (Figure 1B), indicating that it efficiently prevented the initiation and spread of HCV infection. The antiviral activity of these compounds is underscored by the reduced intracellular HCV RNA content of compound 1-treated cultures, and the complete abolition of HCV RNA replication in cells that had been pre-treated with compound 2 (Figure 1B). These results confirm the antiviral activity of these small molecules and the enhanced potency of the derivative compound 2. Compounds 1 and 2 inhibit early steps of HCV infection. Next, we performed single cycle infection experiments to determine the step in the viral life cycle that was targeted by the compounds. Huh-7 cells were inoculated at high multiplicity (moi 10) in the presence of compounds 1 and 2 (5 µm). Intracellular HCV RNA levels were reduced 3-fold and >30-fold in compound 1 and 2-treated cells, respectively (Figure 2A). This reduction resulted in the proportional decrease of intracellular and extracellular infectivity titers (Figure 2A), indicating that compounds 1 and 2 interfere with an early step of the infection leading to the production of intracellular HCV RNA. To examine the events preceding HCV RNA production in a single cycle infection, we performed infections at 4 o C to determine if the compounds were interfering with infection at the adsorption or post-adsorption level. Huh-7 cells were inoculated at

15 o C at high multiplicity (moi 10) in the presence or absence of the antiviral compounds to permit particle adsorption without internalization, which is strongly inhibited at this temperature (33). After 1 hr incubation, the cells were extensively washed to remove free virus and compound and infection was allowed to proceed by adding warm medium containing either the inhibitors or the vehicle control and by further incubation at 37 o C. Analysis of intracellular HCV RNA at 40 hours post-infection revealed that the compounds did not display any antiviral activity when added during particle adsorption (Figure 2B) and that addition of the compounds post-adsorption recapitulated the antiviral activity observed when the compounds were present throughout the entire experiment (Figure 2B). These results suggest that the compounds target a postadsorption step in the infection, and that they do not target the viral particles themselves. In order to determine the optimal time-of-addition of these compounds, compound 2 was added to Huh-7 cells at different times relative to the time of inoculation (moi 10). Cells were either pre-treated (-6,-4,-2,-1 hours) with compound or the compound was added at the time of inoculation (0 hours) or after inoculation (1, 2, 4, 6 hours) and it remained present throughout the entire experiment. Forty hours postinfection, intracellular HCV RNA levels were measured by RT-qPCR. Figure 3C shows the relative HCV RNA levels in cells treated at different times with compound 2. The curve indicates that the compound displays maximum efficacy when it is added before (Figure 2C-no wash) or at the time of virus inoculation but is virtually inactive if it is added even shortly (< 2 hour) thereafter. In addition, the antiviral activity of the compound is severely attenuated if it is washed away before virus inoculation (Figure 2C-wash), indicating that it must be present at the time of inoculation for optimal

16 antiviral activity. This narrow time-of-addition window indicates that compound 2 targets a very early step in the viral life cycle. Since the compounds fail to control infection if they are added shortly after inoculation, they should not have antiviral activity in persistently HCV-infected cells. To test this hypothesis, persistently infected cells were treated with compounds 1 or 2 (5 µm) for 48 hours. Parallel cultures were treated with a well-characterized polymerase inhibitor (2 -m-c-adenosine; 2mAde) as positive control (9). As shown in Figure 2D, compounds 1 and 2 had little or no effect on intracellular HCV RNA content, or intracellular or extracellular infectivity titers. In contrast, 2mAde inhibited all these parameters (Figure 2D). These results demonstrate that compounds 1 and 2 have limited or no antiviral activity against established HCV infection. They also suggest that the compounds don t inhibit HCV RNA replication per se and that the ability of the compounds to suppress the accumulation of intracellular HCV RNA after inoculation at high multiplicity (Figure 2A) likely reflects their ability to inhibit a step preceding steady-state HCV RNA replication. Similar single cycle infection experiments were conducted in Huh-7 cells in parallel with HCV and other RNA viruses such as lymphocytic choriomeningitis virus (LCMV) or Borna disease virus. Compounds (BDV). Figure 3 shows that antiviral doses of compound 1 and 2 have little or no impact on LCMV or BDV infection efficiency, indicating that they display specific anti-hcv activity. Compounds 1 and 2 do not inhibit HCV pseudotype infection

17 Since compounds 1 and 2 interfered with early events of HCV infection without affecting persistent HCV infection, we asked if they blocked viral entry using HCVpseudotyped retroviral particles that recapitulate envelope glycoprotein-mediated receptor binding, particle internalization and low ph-mediated membrane fusion (3). Figure 4 shows that neither compound (5 µm) interfered significantly with either HCVpp or VSVpp infection in contrast with the entry inhibitor fluphenazine (5µM) that selectively reduced HCVpp infection by at least one order of magnitude without interfering with VSVpp infection, as previously described (22). These results suggest that the compounds interfere with a step downstream of glycoprotein-mediated fusion. Compounds 1 and 2 prevent the initiation of HCV RNA replication. In these experiments, we examined the impact of compounds 1 and 2 on the ability of subgenomic HCV RNAs to initiate RNA replication after transfection into naïve target cells. This recapitulates the early steps of HCV infection after the viral genome is released into the cytoplasm. Huh-7 cells were transfected with a subgenomic JFH-1 replicon bearing a luciferase reporter gene in the absence or presence of compounds 1 and 2 (5 µm) or the polymerase inhibitor 2mAde (5 µm), and luciferase activity was measured in total cell lysates at the indicated times post infection. As shown in Figure 5A, Luciferase activity was comparable under all conditions at 5 and 12 hours post-transfection, indicating that compounds 1 and 2 do not interfere with primary HCV IRES-dependent translation of the incoming HCV RNA. This is underscored by the comparable luciferase activity observed in cells transfected with a replication-deficient mutant replicon and treated with compounds 1, 2 or 2mAde (Figure 5B)

18 Luciferase activity increased in the transfected, DMSO-treated cells 24 and 48 hours after transfection but not in the 2mAde-treated cells (Figure 5A) nor in the cells transfected with the replication-deficient replicon (Figure 5B), indicating that it reflected active HCV RNA replication. During the initial replication phase, from 12 to 24 hours post-transfection, luciferase activity was slightly reduced (~3-fold) by compound 1 and more strongly (~20-fold) reduced in compound 2-treated cells (Figure 5A). These results indicate that compounds 1 and 2 inhibit the initiation of HCV RNA replication, at a step downstream of primary translation and that they do so proportionally to the antiviral activity they display in single cycle infections. Interestingly, even though fresh compound was added to the cultures 24 hours post-transfection, replicon replication between 24 and 48 hours was only minimally inhibited in compound 1-treated cells and only moderately inhibited in compound 2-treated cells. This was in clear contrast with the profound antiviral activity of the polymerase inhibitor 2mAde (Figure 5A). These results suggest that once HCV RNA replication is initiated, compound 1 and compound 2 are ineffective, implying that they address a unique step in the virus life cycle that is limited to the initiation phase of viral RNA replication. To test this hypothesis, we treated the transfected cells either with DMSO, or the polymerase inhibitor 2-mAde, or compounds 1 or 2 either at the time of transfection (0 hours), or 24 hours later, or at both time points, and we measured luciferase activity 5, 24 and 48 hours later (see inset in Figure 4B). As expected, administration of neither 2- made nor compounds 1 or 2 inhibited luciferase activity when it was analyzed 5 hours after transfection (prior to the onset of replication) but they all inhibited luciferase activity 24 hours after transfection (during which initiation of viral RNA replication

19 occurs) (Figure 5C). Inhibition was also observed at 48 hours in cells that had been treated from the beginning of the experiment with compound 1 or 2, albeit slightly less than that observed at 24 hours (Figure 5C). However, when treatment was delayed until 24 hours after transfection, neither compound 1 or 2 displayed any antiviral activity while the polymerase inhibitor was strongly suppressive (Figure 5C), confirming that compounds 1 and 2 do not inhibit HCV RNA ongoing replication. These results illustrate that compounds 1 and 2 inhibit the initiation of HCV RNA replication thereby confirming the impact of these compounds in single cycle experiments and suggesting that they inhibit viral infection by interfering with the initiation of viral replication after translation of the incoming viral RNAs. Similar transfection experiments were performed with a genotype 1b, Con1-based subgenomic replicon in Huh cells. As expected based on its poor replicative capacity relative to JFH-1 (34), Con1-luc transfection induced luciferase activity that rapidly decreased after electroporation, while it increased exponentially in JFH1-luc transfected cells (Figure 6B). Nevertheless, Con1-luc replication was demonstrated by its sensitivity to the polymerase inhibitor 2mAde (Figure 6A) similar to what has been reported using a replication-deficient mutant (34). However, because of the limited replication capacity of the Con1 replicon (Figure 6A), the luciferase signal obtained at 24 hours derived predominantly from translation of incoming genomes rather than from RNA replication as shown by the similarity of the signals in the 2mAde-treated and untreated cells. Thus, using 2mAde-treated cells as reference, we evaluated the antiviral activity of these compounds against establishment of Con1 RNA replication at 24 hours, the earliest time point at which replication could be demonstrated (Figure 6A). Figure 6C

20 shows that compound 1 (5 µm) produced a small although significant (p<0.05) reduction in luciferase accumulation at 24 hours post-transfection and that compound 2 inhibited HCV replication with a magnitude comparable to that of the control inhibitor 2mAde (5 µm). These results suggest that this genotype 1b replicon is partially susceptible to the antiviral activity of these compounds, that compound 2 displays enhanced antiviral activity as compared to compound 1, and that antiviral activity of this family of compounds is not limited to JFH-1. Selection of compound 2-resistant virus variants. In order to gain insight into the mode of action of these compounds, we attempted to select JFH-1 variants that were resistant to the antiviral action of compound 2. We serially passaged D183-JFH1 virus in the presence of sequentially increasing concentrations of compound 2. This led to the emergence of a virus population (C2R) that required a >10-fold higher concentration of compound 2 to reduce its infectivity by 50% than a control virus which was passaged in parallel in the absence of compound 2 (Figure 7A). This reduced susceptibility was specific for compound 2 as the C2R virus displayed similar sensitivity to 2mAde when compared with the control virus (Figure 7B). As shown in Figure 7C, antiviral doses of compound 2 could not prevent intracellular HCV RNA accumulation in Huh-7 cells inoculated with the C2R variant at high multiplicity, in contrast to the strong antiviral activity displayed against the control virus. These results confirmed that a resistant variant had been selected. In order to analyze the genetic determinants conferring resistance, and therefore investigate which areas of the viral genome undergo selective pressure by compound 2, we sequenced the

21 viral genomes present in the supernatants of three non-consecutive passages of the virus under selection as well as control viruses passaged in the absence of compound. Common mutations were found in both control and C2R virus (Figure 7D). The table in Figure 7E summarizes the mutations found in all three passages of the resistant virus (C2R) that were not found in the control supernatants and therefore might confer resistance to compound 2. Non-synonymous mutations were found in the coding sequence corresponding to E1 (V223D), E2 (N410D), p7 (H781Y), NS2 (Q931R), NS5A (F2004L, E2371A) and NS5B (K2493R, A2780T). Despite these genetic differences, control and C2R viruses display comparable growth curves (Figure 8A). Since our results indicate that the antiviral activity against the virus could be recapitulated in the context of the subgenomic replicon (Figure 5), which lacks the sequences encoding the structural proteins, p7 and NS2, we focused our attention on the mutations in NS5A and NS5B. Individual, double, and quadruple mutations in NS5A and NS5B were engineered into a subgenomic wildtype JFH-1 replicon bearing a luciferase reporter gene. In vitro transcribed RNAs (5 µg) were electroporated into Huh-7 cells in the presence of DMSO or antiviral doses (2.5 and 5 µm) of compound 2. Cell lysates were prepared at 5 and 24 hours post-transfection and assayed for luciferase activity. All mutant replicons displayed comparable (< 2-fold differences) replication capacity as measured by the luciferase signal obtained 24 hours post-transfection in the absence of inhibitors (Figure 8B). Figure 8C shows the expected dose-dependent reduction of luciferase signal for the wild-type replicon. The antiviral activity of compound 2 was clearly reduced against the replicon bearing either all four mutations, double NS5A mutations and the single mutant F2004L, which were

22 insensitive to 2.5 µm of compound 2 and only partially inhibited at 5 µm (Figure 7). In contrast, NS5A mutant E2371A and both NS5B mutants displayed similar sensitivity when compared with the wild-type. These results indicate that the F2004L mutation (position F28 in NS5A), which is not conserved among different HCV genotypes (Figure 9), is sufficient to confer partial resistance to the antiviral activity of compound 2 in the context of JFH-1 and suggest that NS5A might be directly or indirectly involved in the process targeted by these compounds. DISCUSSION Study of the HCV life cycle in surrogate models of infection, e.g. HCVpp and replicon cell lines, has permitted analysis of the cellular and molecular events that govern viral entry and steady-state HCV RNA replication. Aspects of the viral life cycle not recapitulated in these systems, such as those occurring downstream of endosomal internalization of the infectious particles, leading to primary translation of the viral genome and establishment of the replication complexes are beginning to be characterized (5, 12), thanks to the development of cell culture infection systems that recapitulate every step of the HCV life cycle (37, 62, 65). Having adapted this cell culture system into an unbiased cell-based screening methodology (22), interrogation of chemical libraries for antiviral molecules against HCV enables discovery of antiviral compounds that interrupt aspects of the infection that were previously uncharacterized. Thus, this methodology has the potential to provide not only novel lead compounds for therapy against this important pathogen, but to identify

23 novel chemical probes to study aspects of HCV infection that have been functionally and biochemically uncharacterized. Using this methodology, we have identified and characterized a novel family of small molecules that efficiently inhibit viral spread at nanomolar concentrations. These compounds efficiently inhibited HCV infection without altering viral entry, as shown by the lack of antiviral activity against HCVpp (Figure 4), or interfering with persistent HCV RNA replication and virus particle production in persistently infected cells (Figure 2D). Time of addition experiments indicate that the inhibition occurs at early steps of the infection, since addition of the compounds as early as 2 hours after virus inoculation resulted in the virtual loss of antiviral activity (Figure 2C). The results shown in Figure 2C argue against a rapid loss of antiviral activity due to compound instability since the compounds retained full antiviral activity even when they were added to the cultures 6 hours before virus inoculation. Since HCVpp entry was unaffected by these compounds, we postulated that they target steps downstream viral entry. This hypothesis was confirmed by the antiviral activity of the compounds against the initiation of HCV RNA replication by subgenomic HCV replicons that were electroporated into naïve Huh-7 cells (Figure 5A). This effect was dependent on the time-of-addition of the compounds and was not observed once HCV RNA replication had been initiated (Figure 4B), recapitulating the lack of antiviral activity observed in persistently infected cells. Overall, these observations indicate that compounds 1 and 2 specifically target a very early step in HCV RNA replication without altering steady-state HCV RNA production. These results

24 suggest that the compounds target a transient event that is rate-limiting for the initiation of HCV RNA replication, rather than HCV RNA replication per se. It has been recently shown that the cellular autophagy machinery is required for translation of incoming HCV genomes but not for translation of progeny genomes (12). Collectively, those observations and the results presented herein suggest that the cellular and viral factors required to initiate viral replication are different from those required to maintain it once replication complexes have formed. Another possible interpretation of our results derives from the fact that expression of HCV proteins, notably NS4B, causes a profound reorganization of cellular membranous compartments to promote the formation of replication complexes in modified ER-membranes (5, 13). It is therefore formally possible that the compounds described above target HCV RNA replication per se, but that virus-induced cellular changes (e.g. alteration of intracellular membranes) reduce the access of the compounds to their molecular target(s) sufficiently once replication complexes have been established to reduce their efficacy, resulting in an apparent lack of antiviral activity. Selection of virus variants with reduced susceptibility to compound 2 (C2R) demonstrates the specific antiviral activity of this compound. We have shown that a point mutation identified in the resistant virus variants (F2004L) in NS5A is sufficient to confer the resistance phenotype to subgenomic replicons (Figure 8), suggesting that the mechanism by which these compounds inhibit HCV infection and establishment of the subgenomic replicon replication are the same. Our results also indicate that mutation F2004L did not result in a significant fitness cost, as the C2R virus grows to comparable titers both in magnitude (10 6 ffu/ml) and kinetics as compared to the control virus (Figure

25 A). Moreover, introduction of the F2004L point mutation into the subgenomic replicon did not impair baseline replication (Figure 8B), indicating that this mutation does not weaken viral replication even in a wild type genetic background. The NS5A residue F28 (F2004 in the polyprotein) is not conserved among all genotypes and strains, e.g. Con1 and J4L6 from genotype 1b display a leucine residue in that position (Figure 9). However, a Con1-based replicon was susceptible to compound 2 (Figure 6B) even at concentrations (2.5 µm) that were inactive against the JFH-1 F28L mutant, suggesting that a leucine residue in position 28 does not confer resistance to compound 2 in the context of genotype 1b. In any case, in the context of JFH-1 (2a), position F28 is located in a conserved class I proline-rich (PR) motif immediately adjacent to the membrane-anchoring amphipathic alpha helix located at the N-terminus of NS5A (58). Although no specific function has been attributed to this conserved PR motif, PR motifs in NS5A have been proposed as structural elements that determine interaction of NS5A with cellular factors containing Src-homology 3 (SH3) domains (58). This could be demonstrated for the C-terminal proline-rich motif, which mediates interaction with kinases like PI3K (57), Lck, Hck, and Fyn (40), as well as adaptor proteins such as Grb2 (58) and amphiphysin II/BinI (64), but not for the N-terminal motif in which the mutation conferring resistance to compound 2 (F28L) is included. It is therefore possible that compounds of the chemical family described here interfere with interactions of NS5A via its N-terminal PR motif and that mutation F28L restores such interactions that could be essential for the establishment of HCV RNA replication. Position F28 is located in close proximity to the N-terminal membrane-anchoring domain in NS5A and might contribute to the interaction of this protein with cellular membranes. It is possible that,

26 during the initial phases of the infection, compounds 1 and 2 interfere with docking of NS5A into membranes devoid of viral replication complexes and that this does not occur once replication complexes have been formed. While these speculative scenarios would explain our observations, extensive biochemical studies will be required to define the molecular events underlying both antiviral activity and resistance. Studies aiming at determining the composition of the molecular complexes that compounds 1 and 2 may bind in the cell will contribute to understanding the mechanisms underlying the establishment of HCV RNA replication complexes, a process in which NS5A could play a specific role. NS5A has been recently revealed as a novel target for potent antiviral compounds that inhibit viral RNA replication (e.g. BMS ) (17). Genetic evidence indicates that the compound 2 targets NS5A directly or indirectly (Figure 6), but seems to do so by a different, unprecedented mechanism that targets initiation but not steady-state HCV RNA replication. Remarkably, despite this apparent differential mode of action, position F28 in JFH-1 is aligned with position 28 in genotypes 1a and 1b (Figure 9) where mutations M28T and L28T respectively have been reported to confer partial resistance to BMS (14, 17). These genetic data indicate that both compounds impose a similar selective pressure on the N-terminus of NS5A, suggesting that they could be targeting a similar function in NS5A but appear to do so by a different molecular mechanism. Multiple functions have been attributed to NS5A involving different steps in the viral life cycle. However, no specific enzymatic activity has been ascribed to NS5A and the molecular mechanisms by which it functions remain elusive. Thus, the inhibitors described herein constitute potentially powerful chemical tools that could facilitate our

27 understanding of the functions that NS5A plays in the viral life cycle and may lead to the development of novel compounds with improved therapeutic potential Acknowledgements We are grateful to Dr. Takaji Wakita (National Institute of Infectious Diseases, Tokyo, Japan) for providing the infectious JFH-1 molecular clone and replicon constructs; Dr. Charles Rice (Rockefeller University) for providing the Huh-7.5 cells from which the Huh clone 2 cells were derived; Drs. Mansun Law and Dennis Burton (The Scripps Research Institute, La Jolla, CA) for providing the recombinant human IgG anti-e2; Dr. Francois-Loic Cosset (Ecole Normale Superieure, INSERM U758, Lyon, France) for providing the vectors necessary for HCVpp production; Dr. Jeffrey Glenn from Stanford University (Palo Alto, CA) for providing the Con1-luc replicon and Dr. Weidong Zhong from Gilead Sciences (Foster City, CA) for providing the 2 -m-c-adenosine. We thank our colleagues Drs. Urtzi Garaigorta and Stefan Wieland, for their expert advice and useful discussions. We are grateful to Mr. Brian Boyd for excellent technical assistance. This work was supported by NIH grants R01- CA and R01-AI This is manuscript number from the Scripps Research Institute. Figure Legends Figure 1: Compounds 1 and 2 inhibit HCV infection. A-Chemical structure of two representative members of the newly identified class of HCV inhibitors with relatively low (compound 1) and high (compound 2) potency and comparable cytotoxicity. EC

28 and EC 90 values were obtained using a cell-based colorimetric assay and CC 50 values were calculated by estimation of the remaining cell biomass (Average and mean error; n>3). B- Confirmation of the antiviral activity of compounds 1 and 2 (5 µm) in multiple cycle infections (moi 0.01) in Huh-7 cells. Extracellular infectivity titers (left panel) and intracellular HCV RNA levels were measured at the indicated time points post-infection by titration and RT-qPCR respectively. Data are shown as average and mean error of a representative experiment performed in triplicate. Figure 2: Compounds 1 and 2 interfere with an early step of HCV infection. A- Intracellular and extracellular infectivity parallels intracellular HCV RNA levels in Huh- 7 cells infected at high multiplicity (moi 10) in the presence of 5µM of compounds 1 or 2. The polymerase inhibitor 2 -C-m-adenosine (5µM) was used as positive control. B- Inhibition is not observed if the compounds are present during particle adsorption, but display full activity when added post-adsorption. C- Relative infection efficiency in the presence of compound 2 (5µM) added at different times relative to virus inoculation, either without washing (black squares-no wash) or washing (white circles-no wash) the cells prior to virus inoculation. D-Treatment of persistently-infected cells with the compounds 1 or 2 (5µM) did not reduce intracellular HCV RNA or infectivity levels. Data are shown as average and mean error of representative experiments performed in triplicate. Figure 3: Compounds 1 and 2 antiviral activity is specific for HCV

29 Single cycle infections were performed in Huh-7 cells in the presence or absence of 5µM compound 1 or 2 with HCV (JFH-1 D183 virus; moi 10), BDV (strain He80, moi 1) or LCMV (strain Armstrong; moi 10). Total RNA was extracted for quantitation of the viral genomes and GAPDH mrna for normalization by RT-qPCR. RNAs were extracted at the peak of infection (HCV and BDV, 40 hours; LCMV 20 hours). Figure 4: Compounds 1 and 2 do not inhibit HCVpp infection. Retroviral particles bearing the JFH-1 or VSV envelope glycoproteins were incubated with target Huh-7 cells in the presence of antiviral doses of compound 1 or 2 (5 µm) or fluphenazine (5 µm) used as positive control. Data are shown as average and mean error of at least three independent experiments performed in duplicate. Figure 5: Compounds 1 and 2 inhibit initiation of HCV RNA replication but not primary translation. Huh-7 cells were electroporated with a subgenomic JFH-1 replicon bearing a luciferase reporter gene in the presence of antiviral doses of compound 1 or 2 (5 µm) or 2 -C-madenosine (5 µm) used as positive control. A-Cell lysates were assayed at the indicated time points for luciferase activity. Compounds were added at 0 and 24 hrs posttransfection. B-Cells were treated identically as in A, using a replication-deficient (GND) mutant replicon. C- Cells were treated and harvested at the indicated times. Data are shown as average and mean error of two experiments performed in duplicate

30 Figure 6: Inhibition of initial Con1 subgenomic replicon replication by compounds 1 and 2. Huh cells were electroporated with a subgenomic Con1 replicon bearing a luciferase reporter gene in the presence of antiviral doses of compound 1 (5 µm) or 2 (2.5 and 5 µm) or 2 -C-m-adenosine (5 µm) used as positive control. Luciferase levels were measured at the indicated time points. A-Comparison of initial replication ability of Con1 and JFH-1 replicons and their susceptibility to 2mAde. B-Luciferase levels at 24 hours post-electroporation in the presence of antiviral doses of compounds 1 and 2. Data are shown as average and average error of triplicate samples. Statistical significance of the differences with the DMSO control (paired t-test, p<0.05) are indicated with an asterisk. Figure 7: Selection of compound 2-resistant (C2R) virus variants. A- Virus passaged in the presence of compound 2 displays partial resistance to compound 2 but not to 2 -C-m-adenosine (B). Data are shown as average of two independent measurements performed in duplicate. C- Antiviral doses of compound 2 do not prevent C2R infection in single cycle experiments. Data are shown as average and mean error of a representative experiment. D- Mutations found in three non-consecutive passages only in the resistant virus and not in the control. E- Mutations found in three non-consecutive passages in both the resistant and the control virus. Silent mutations are shown in gray. Figure 8: A single aminoacid mutation in NS5A confers reduced susceptibility to compound 2 without significant fitness cost

31 A-Comparative growth curve between control and C2R viruses after inoculation of Huh- 7 cells at moi of Data are shown as average and mean error of a representative experiment performed in triplicate. B-Subgenomic replicons bearing the NS5A and NS5B mutations shown in Figure 6C were transfected into Huh-7 cells. Relative replication capacity is estimated as the luciferase activity detected at 24 hours divided by that detected at 5 hours post-electroporation as compared to that of the wild-type. C- These replicons were also transfected into Huh-7 in the presence of compound 2 (2,5 and 5 µm). Cell lysates were assayed for luciferase activity 24 hours post-transfection. Data in B and C are shown as average and mean error of two independent electroporations performed in duplicate. Figure 9: Alignment of the N-terminal NS5A sequences (Residues 1-80) of representative HCV genotypes. Alignment was performed using the ClustalW algorithm and the Megalign software (DNAstar-Madison,WI). Gray bar indicates the position where mutation F28L conferring resistance to compound 2 was identified

32 REFERENCES 1. Appel, N., M. Zayas, S. Miller, J. Krijnse-Locker, T. Schaller, P. Friebe, S. Kallis, U. Engel, and R. Bartenschlager Essential role of domain III of nonstructural protein 5A for hepatitis C virus infectious particle assembly. PLoS Pathog 4:e Bartenschlager, R., and V. Lohmann Replication of hepatitis C virus. J Gen Virol 81 Pt 7: Bartosch, B., J. Bukh, J. C. Meunier, C. Granier, R. E. Engle, W. C. Blackwelder, S. U. Emerson, F. L. Cosset, and R. H. Purcell In vitro assay for neutralizing antibody to hepatitis C virus: evidence for broadly conserved neutralization epitopes. Proceedings of the National Academy of Sciences of the United States of America 100: Bartosch, B., J. Dubuisson, and F. L. Cosset Infectious hepatitis C virus pseudo-particles containing functional E1-E2 envelope protein complexes. J Exp Med 197: Berger, K. L., J. D. Cooper, N. S. Heaton, R. Yoon, T. E. Oakland, T. X. Jordan, G. Mateu, A. Grakoui, and G. Randall Roles for endocytic trafficking and phosphatidylinositol 4-kinase III alpha in hepatitis C virus replication. Proc Natl Acad Sci U S A 106: Bernhardt, G., H. Reile, H. Birnbock, T. Spruss, and H. Schonenberger Standardized kinetic microassay to quantify differential chemosensitivity on the basis of proliferative activity. J Cancer Res Clin Oncol 118: Blanchard, E., S. Belouzard, L. Goueslain, T. Wakita, J. Dubuisson, C. Wychowski, and Y. Rouille Hepatitis C virus entry depends on clathrin-mediated endocytosis. J Virol 80: Blight, K. J., A. A. Kolykhalov, and C. M. Rice Efficient initiation of HCV RNA replication in cell culture. Science 290: Carroll, S. S., J. E. Tomassini, M. Bosserman, K. Getty, M. W. Stahlhut, A. B. Eldrup, B. Bhat, D. Hall, A. L. Simcoe, R. LaFemina, C. A. Rutkowski, B. Wolanski, Z. Yang, G. Migliaccio, R. De Francesco, L. C. Kuo, M. MacCoss, and D. B. Olsen Inhibition of hepatitis C virus RNA replication by 2'- modified nucleoside analogs. J Biol Chem 278: Chang, K. S., J. Jiang, Z. Cai, and G. Luo Human apolipoprotein e is required for infectivity and production of hepatitis C virus in cell culture. J Virol 81: Cho, N. J., H. Dvory-Sobol, C. Lee, S. J. Cho, P. Bryson, M. Masek, M. Elazar, C. W. Frank, and J. S. Glenn Identification of a class of HCV inhibitors directed against the nonstructural protein NS4B. Sci Transl Med 2:15ra Dreux, M., P. Gastaminza, S. F. Wieland, and F. V. Chisari The autophagy machinery is required to initiate hepatitis C virus replication. Proc Natl Acad Sci U S A 106: Egger, D., B. Wolk, R. Gosert, L. Bianchi, H. E. Blum, D. Moradpour, and K. Bienz Expression of hepatitis C virus proteins induces distinct

33 membrane alterations including a candidate viral replication complex. J Virol 76: Fridell, R. A., D. Qiu, C. Wang, L. Valera, and M. Gao Resistance analysis of the hepatitis C virus NS5A inhibitor BMS in an in vitro replicon system. Antimicrob Agents Chemother 54: Friebe, P., J. Boudet, J. P. Simorre, and R. Bartenschlager Kissingloop interaction in the 3' end of the hepatitis C virus genome essential for RNA replication. J Virol 79: Friebe, P., V. Lohmann, N. Krieger, and R. Bartenschlager Sequences in the 5' nontranslated region of hepatitis C virus required for RNA replication. J Virol 75: Gao, M., R. E. Nettles, M. Belema, L. B. Snyder, V. N. Nguyen, R. A. Fridell, M. H. Serrano-Wu, D. R. Langley, J. H. Sun, D. R. O'Boyle, 2nd, J. A. Lemm, C. Wang, J. O. Knipe, C. Chien, R. J. Colonno, D. M. Grasela, N. A. Meanwell, and L. G. Hamann Chemical genetics strategy identifies an HCV NS5A inhibitor with a potent clinical effect. Nature 465: Gastaminza, P., G. Cheng, S. Wieland, J. Zhong, W. Liao, and F. V. Chisari Cellular determinants of hepatitis C virus assembly, maturation, degradation, and secretion. J Virol 82: Gastaminza, P., K. Dryden, B. Boyd, M. Wood, M. Law, M. Yeager, and F. V. Chisari Ultrastructural and Biophysical Characterization of Hepatitis C Virus Particles Produced in Cell Culture. J Virol. 20. Gastaminza, P., C. F.V., S. M. Pitram, L. B. Krasnova, V. V. Fokin, K. B. Sharpless, and J. J. Dong Inhibitors of hepatitis C virus infection. 21. Gastaminza, P., S. B. Kapadia, and F. V. Chisari Differential biophysical properties of infectious intracellular and secreted hepatitis C virus particles. J Virol 80: Gastaminza, P., C. Whitten-Bauer, and F. V. Chisari Unbiased probing of the entire hepatitis C virus life cycle identifies clinical compounds that target multiple aspects of the infection. Proc Natl Acad Sci U S A 107: Hoh, A., K. Maier, and R. M. Dreher Multilayered keratinocyte culture used for in vitro toxicology. Mol Toxicol 1: Honda, M., M. R. Beard, L. H. Ping, and S. M. Lemon A phylogenetically conserved stem-loop structure at the 5' border of the internal ribosome entry site of hepatitis C virus is required for capindependent viral translation. J Virol 73: Hoofnagle, J. H Course and outcome of hepatitis C. Hepatology 36:S Huang, H., F. Sun, D. M. Owen, W. Li, Y. Chen, M. Gale, Jr., and J. Ye Hepatitis C virus production by human hepatocytes dependent on assembly and secretion of very low-density lipoproteins. Proc Natl Acad Sci U S A 104: Hughes, M., S. Griffin, and M. Harris Domain III of NS5A contributes to both RNA replication and assembly of hepatitis C virus particles. J Gen Virol 90:

34 Jiang, J., and G. Luo Apolipoprotein E but not B is required for the formation of infectious hepatitis C virus particles. J Virol 83: Jones, C. T., C. L. Murray, D. K. Eastman, J. Tassello, and C. M. Rice Hepatitis C virus p7 and NS2 proteins are essential for production of infectious virus. J Virol 81: Jones, D. M., A. H. Patel, P. Targett-Adams, and J. McLauchlan The hepatitis C virus NS4B protein can trans-complement viral RNA replication and modulates production of infectious virus. J Virol 83: Kaito, M., S. Watanabe, K. Tsukiyama-Kohara, K. Yamaguchi, Y. Kobayashi, M. Konishi, M. Yokoi, S. Ishida, S. Suzuki, and M. Kohara Hepatitis C virus particle detected by immunoelectron microscopic study. J Gen Virol 75 ( Pt 7): Kolb, H. C., M. G. Finn, and K. B. Sharpless Click Chemistry: Diverse Chemical Function from a Few Good Reactions. Angew Chem Int Ed Engl 40: Koutsoudakis, G., A. Kaul, E. Steinmann, S. Kallis, V. Lohmann, T. Pietschmann, and R. Bartenschlager Characterization of the early steps of hepatitis C virus infection by using luciferase reporter viruses. J Virol 80: Krieger, N., V. Lohmann, and R. Bartenschlager Enhancement of hepatitis C virus RNA replication by cell culture-adaptive mutations. J Virol 75: Li, X., L. J. Jeffers, L. Shao, K. R. Reddy, M. de Medina, J. Scheffel, B. Moore, and E. R. Schiff Identification of hepatitis C virus by immunoelectron microscopy. J Viral Hepat 2: Liang, T. J., B. Rehermann, L. B. Seeff, and J. H. Hoofnagle Pathogenesis, natural history, treatment, and prevention of hepatitis C. Annals of Internal Medicine 132: Lindenbach, B. D., M. J. Evans, A. J. Syder, B. Wolk, T. L. Tellinghuisen, C. C. Liu, T. Maruyama, R. O. Hynes, D. R. Burton, J. A. McKeating, and C. M. Rice Complete replication of hepatitis C virus in cell culture. Science 309: Lohmann, V., F. Korner, J. Koch, U. Herian, L. Theilmann, and R. Bartenschlager Replication of subgenomic hepatitis C virus RNAs in a hepatoma cell line. Science 285: Ma, Y., J. Yates, Y. Liang, S. M. Lemon, and M. Yi NS3 helicase domains involved in infectious intracellular hepatitis C virus particle assembly. J Virol 82: Macdonald, A., K. Crowder, A. Street, C. McCormick, and M. Harris The hepatitis C virus NS5A protein binds to members of the Src family of tyrosine kinases and regulates kinase activity. J Gen Virol 85: Macdonald, A., and M. Harris Hepatitis C virus NS5A: tales of a promiscuous protein. J Gen Virol 85: Maillard, P., K. Krawczynski, J. Nitkiewicz, C. Bronnert, M. Sidorkiewicz, P. Gounon, J. Dubuisson, G. Faure, R. Crainic, and A. Budkowska

35 Nonenveloped nucleocapsids of hepatitis C virus in the serum of infected patients. J Virol 75: Masaki, T., R. Suzuki, K. Murakami, H. Aizaki, K. Ishii, A. Murayama, T. Date, Y. Matsuura, T. Miyamura, T. Wakita, and T. Suzuki Interaction of hepatitis C virus nonstructural protein 5A with core protein is critical for the production of infectious virus particles. J Virol 82: Miyanari, Y., K. Atsuzawa, N. Usuda, K. Watashi, T. Hishiki, M. Zayas, R. Bartenschlager, T. Wakita, M. Hijikata, and K. Shimotohno The lipid droplet is an important organelle for hepatitis C virus production. Nat Cell Biol 9: Moradpour, D., F. Penin, and C. M. Rice Replication of hepatitis C virus. Nat Rev Microbiol 5: Murray, C. L., C. T. Jones, and C. M. Rice Architects of assembly: roles of Flaviviridae non-structural proteins in virion morphogenesis. Nat Rev Microbiol 6: Murray, C. L., C. T. Jones, J. Tassello, and C. M. Rice Alanine scanning of the hepatitis C virus core protein reveals numerous residues essential for production of infectious virus. J Virol 81: Nahmias, Y., J. Goldwasser, M. Casali, D. van Poll, T. Wakita, R. T. Chung, and M. L. Yarmush Apolipoprotein B-dependent hepatitis C virus secretion is inhibited by the grapefruit flavonoid naringenin. Hepatology 47: Neyts, J Selective inhibitors of hepatitis C virus replication. Antiviral Res 71: Patel, K., and J. G. McHutchison Initial treatment for chronic hepatitis C: current therapies and their optimal dosing and duration. Cleve Clin J Med 71 Suppl 3:S Pedersen, I. M., G. Cheng, S. Wieland, S. Volinia, C. M. Croce, F. V. Chisari, and M. David Interferon modulation of cellular micrornas as an antiviral mechanism. Nature 449: Penin, F., J. Dubuisson, F. A. Rey, D. Moradpour, and J. M. Pawlotsky Structural biology of hepatitis C virus. Hepatology 39: Pitram, S. M., L. B. Krasnova, P. Gastaminza, J. J. Dong, F. V. Chisari, V. V. Fokin, and K. B. Sharpless. Synthesis and Biological Evaluation of Stilbene Derived Antiviral Agents against Hepatitis C Virus. Manuscript in preparation. 54. Prince, A. M., T. Huima-Byron, T. S. Parker, and D. M. Levine Visualization of hepatitis C virions and putative defective interfering particles isolated from low-density lipoproteins. J Viral Hepat 3: Roingeard, P., C. Hourioux, E. Blanchard, D. Brand, and M. Ait- Goughoulte Hepatitis C virus ultrastructure and morphogenesis. Biol Cell 96: Steinmann, E., F. Penin, S. Kallis, A. H. Patel, R. Bartenschlager, and T. Pietschmann Hepatitis C Virus p7 Protein Is Crucial for Assembly and Release of Infectious Virions. PLoS Pathog 3:e

36 Street, A., A. Macdonald, K. Crowder, and M. Harris The Hepatitis C virus NS5A protein activates a phosphoinositide 3-kinase-dependent survival signaling cascade. J Biol Chem 279: Tan, S. L., H. Nakao, Y. He, S. Vijaysri, P. Neddermann, B. L. Jacobs, B. J. Mayer, and M. G. Katze NS5A, a nonstructural protein of hepatitis C virus, binds growth factor receptor-bound protein 2 adaptor protein in a Src homology 3 domain/ligand-dependent manner and perturbs mitogenic signaling. Proc Natl Acad Sci U S A 96: Tellinghuisen, T. L., K. L. Foss, and J. Treadaway Regulation of hepatitis C virion production via phosphorylation of the NS5A protein. PLoS Pathog 4:e Trestard, A., Y. Bacq, L. Buzelay, F. Dubois, F. Barin, A. Goudeau, and P. Roingeard Ultrastructural and physicochemical characterization of the hepatitis C virus recovered from the serum of an agammaglobulinemic patient. Arch Virol 143: Tscherne, D. M., C. T. Jones, M. J. Evans, B. D. Lindenbach, J. A. McKeating, and C. M. Rice Time- and temperature-dependent activation of hepatitis C virus for low-ph-triggered entry. J Virol 80: Wakita, T., T. Pietschmann, T. Kato, T. Date, M. Miyamoto, Z. Zhao, K. Murthy, A. Habermann, H. G. Krausslich, M. Mizokami, R. Bartenschlager, and T. J. Liang Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat Med 11: Yi, M., Y. Ma, J. Yates, and S. M. Lemon Trans-complementation of an NS2 defect in a late step in hepatitis C virus (HCV) particle assembly and maturation. PLoS Pathog 5:e Zech, B., A. Kurtenbach, N. Krieger, D. Strand, S. Blencke, M. Morbitzer, K. Salassidis, M. Cotten, J. Wissing, S. Obert, R. Bartenschlager, T. Herget, and H. Daub Identification and characterization of amphiphysin II as a novel cellular interaction partner of the hepatitis C virus NS5A protein. J Gen Virol 84: Zhong, J., P. Gastaminza, G. Cheng, S. Kapadia, T. Kato, D. R. Burton, S. F. Wieland, S. L. Uprichard, T. Wakita, and F. V. Chisari Robust hepatitis C virus infection in vitro. Proc Natl Acad Sci U S A 102: Zhong, J., P. Gastaminza, J. Chung, Z. Stamataki, M. Isogawa, G. Cheng, J. A. McKeating, and F. V. Chisari Persistent hepatitis C virus infection in vitro: coevolution of virus and host. J Virol 80:

37

38

39

40

41

42

43

44

45