Tanya Zappitelli. Copyright by Tanya Zappitelli 2015

Transcription

1 Characterization of the Gja1 Jrt /+ Skeletal Phenotype and the Cellular and Molecular Effects of the G60S Connexin 43 Mutation in the Long Bone Microenvironment by Tanya Zappitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Medical Biophysics University of Toronto Copyright by Tanya Zappitelli 2015

2 Characterization of the Gja1 Jrt /+ Skeletal Phenotype and the Cellular and Molecular Effects of the G60S Connexin 43 Mutation in the Long Bone Microenvironment Tanya Zappitelli Doctor of Philosophy Department of Medical Biophysics University of Toronto 2015 Abstract Gja1 Jrt /+ mice carry a mutation in one allele of the gap junction protein, alpha 1 gene (Gja1), encoding for a dominant negative G60S Connexin 43 (Cx43) mutant protein. Similar to other Cx43 mutant mouse models described, a reduction in Cx43 gap junction formation and/or function resulted in mice with early onset osteopenia. Here we show that in contrast to other Cx43 mutants, the G60S Cx43 mutation activates the osteoblast lineage, with higher bone marrow stromal osteoprogenitor numbers and increased appendicular skeleton osteoblast activity. The data presented in this thesis are the first to describe a Cx43 mutation in which osteopenia is caused by activation of osteoclasts secondary to activation of osteoblast lineage cells, which occurs not only through increased membrane-bound receptor activator of nuclear factor kappa-b ligand (mbrankl) but production of an abnormal resorption-stimulating bone matrix. Gja1 Jrt /+ is also the only Cx43 mutant mouse model described to date with early and progressive bone marrow atrophy, with a significant increase in bone marrow adiposity and adipocyte-specific gene expression in Gja1 Jrt /+ mice compared to wild type littermates. We analyzed the mechanism by which the G60S Cx43 mutation activates the osteoblast and ii

3 adipocyte lineage and show that increased bone morphogenic protein 2 and 4 (BMP2/4) production and signaling increase osteoblast-specific marker expression and peroxisome proliferator-activated receptor gamma (Pparg2) gene expression in Gja1 Jrt /+ osteoblasts and bone marrow stromal cells. Taken together, this thesis provides new insight into the role of Cx43 and the effects of the G60S mutation on bone formation and homeostasis, and on the differentiation and activity of bone cell lineages. iii

4 Acknowledgments To my supervisor, Dr. Jane Aubin, thank you for taking me into your lab when I was still an undergraduate student and knew nothing about conducting scientific research. Thank you for teaching me the skills required to become a successful scientist, and for always pushing me to learn and grow. To my supervisory committee, Dr. Jane Mitchell, Dr. Liliana Attisano and Dr. Minna Woo, thank you for your knowledge, advice and guidance over the years. To all of the former Aubin lab members, you truly made my time here memorable. Thank you especially to Frieda Chen, Ralph Zirngibl, Marco Cardelli and Ruolin Guo for sharing your expertise and knowledge with me, and for all of the insightful conversations (both scientific and not). Frieda, I am so grateful for all of the guidance, help and encouragement you provided me, thank you. To the members of the Centre for Modeling Human Disease, particularly Celeste Owen, thank you for your support and expertise over the years. To my parents, Angelo and Angela, thank you so much for everything! I dedicate this thesis to you. Your support throughout my studies -both emotional and financial- was instrumental in allowing me to successfully complete my graduate studies. I could not have done this without your love, encouragement and unwavering support. To my brother, Anthony, thank you for your humor during my times of struggle and for listening whenever I really needed it. To all of my family and friends, thank you for your love and encouragement throughout all of these years. To LM, LH, GF, MU and to MC thank you for all the agendas/breaks/weekends away from my lab work and studying! ~~~~~~~~~~~~~~~~~~~~~~~~~~~~ In loving memory Nonno Antonio Zappitelli iv

5 Table of Contents Acknowledgments... iv Table of Contents... v List of Tables... vii List of Figures... viii Chapter 1 Introduction Bone Processes of Bone Formation Bone Structure and Composition Regulation of Bone Formation Description and Expression Patterns of Osteoblast-Specific Genes Regulation of Osteoblast Differentiation by Growth Factors and Small Molecules Regulation of Bone Resorption Description and Expression Patterns of Osteoclast-Specific Genes Regulation of Osteoclast Differentiation by Cytokines, Hormones, and Small Molecules Connexins: Gap Junctions and Hemichannels Structure and Function Connexin Cx43 Mouse Models Cx43 disruption: Effect on bone development and skeletal homeostasis Cx43 disruption: Effect on development and activity of osteoblast lineage cells Cx43 disruption: Effect on the development and activity of osteoclasts Cx43 channels and signaling in bone cells response to stimuli Growth factors, morphogens, and other molecules v

6 1.6.2 Mechanostimulation Age-related changes in Cx43 channel formation and function Thesis Objectives Chapter 2 The G60S Connexin 43 Mutation Activates the Osteoblast Lineage and Results in a Resorption-Stimulating Bone Matrix and Abrogation of old Age-related Bone Loss Abstract Introduction Materials and Methods Results Discussion Chapter 3 Upregulation of BMP2/4 signaling increases both osteoblast-specific marker expression and bone marrow adipogenesis in Gja1 Jrt /+ stromal cell cultures Abstract Introduction Materials and Methods Results Discussion Chapter 4 Discussion, Future Directions and Final Conclusions Summary and Discussion of Findings Future Directions Effect of the G60S mutation on Cx43 hemichannel function Gja1 Jrt /+ rescue experiments Gja1 Jrt /+ response to challenge or stimuli Further investigations into other Cx43-deficient models Conclusions References vi

7 List of Tables Table 1.1 Connexin 43 missense point mutation summary chart Table 2.1 Quantitative RT-PCR primer sequences used in this study Table 2.2 List of antibodies used in this study Table 2.3 Longitudinal analysis of femoral length and mechanical-material properties of Gja1 Jrt /+ and WT mice are presented Table 3.1 Quantitative RT-PCR primer sequences used in this study Table 3.2 List of antibodies used in this study Table 3.3 Results of the Mouse Signal Transduction Pathway Finder RT² Profiler PCR Array Table 4.1 Connexin 43 mutant mice summary chart vii

8 List of Figures Figure 1.1 Development of the osteoblast and osteoclast lineage Figure 1.2 Illustrations of connexin protein structure, hemichannels and gap junctions in the plasma membranes of cells Figure 1.3 Connexin 43 in the bone microenvironment Figure 1.4. Schematic of osteoblast lineage development and the different promoters used to drive Cre for differentiation stage-specific Cx43 ablation Figure 2.1 Longitudinal analysis of BMD and trabecular bone parameters Figure 2.2 Longitudinal analysis of cortical bone parameters Figure 2.3 Longitudinal analysis of cortical parameters Figure 2.4 Longitudinal analyses of trabecular osteoblast parameters and activity Figure 2.5 Analysis of osteoblast and osteocyte-specific genes in cortical bone extracts Figure 2.6 Effect of the Gja1 Jrt mutation on osteoprogenitors, osteoblasts and bone matrix composition Figure 2.7 Expression of Rankl-Opg and osteoclast-specific gene expression in Gja1 Jrt /+ versus WT mice Figure 2.8 Gja1 Jrt /+ osteoclast number and activity are increased in young mice in vivo, but not in vitro Figure 2.9 The abnormal bone matrix produced by Gja1 Jrt /+ mice promotes bone matrix resorption Figure 2.10 The cellular and molecular age-related changes that occur in the bone microenvironment viii

9 Figure 3.1 The Gja1 Jrt mutation activates the osteoblast lineage and alters bone matrix composition Figure 3.2 Adipocyte number and activity are increased in Gja1 Jrt /+ versus WT bone marrow. 70 Figure 3.3 The Gja1 Jrt mutation does not cause a systemic increase in adipogenesis or adipocyte activity Figure 3.4 The Gja1 Jrt mutation does not affect adipocyte lineage development in vitro Figure 3.5 Effect of the Gja1 Jrt mutation on formation of bone marrow- derived adipocytes in vitro Figure 3.6 Changes in Wnt/β-catenin signaling cannot account for the upregulation of Bsp expression in hyperactive Gja1 Jrt /+ osteoblasts Figure 3.7 BMP2/4 signaling is increased in Gja1 Jrt /+ in vivo and in vitro Figure 3.8 Upregulated BMP2/4 signaling is responsible for the increased osteoblast marker expression and the increased Pparg2 expression in bone marrow-derived adipocytes and adipogenic precursors in Gja1 Jrt /+ versus WT mice Figure 3.9 Levels of psmad1/5/8 were significantly reduced in both WT and Gja1 Jrt /+ stromal cells treated with 200ng/mL of Noggin versus vehicle treated cells Figure 3.10 Intracellular levels of camp and camp signaling are increased in Gja1 Jrt /+ versus WT osteogenic stromal cells ix

10 1 Chapter 1 Introduction Some of the text, tables, and figures presented in Chapter 1 are published in: The connexin between bone cells and skeletal functions Tanya Zappitelli 1 and Jane E. Aubin 1,2 1 Department of Medical Biophysics and 2 Department of Molecular Genetics, University of Toronto, 1 King's College Circle, Toronto, Ontario M5S 1A8, Canada. J Cell Biochem Oct;115(10):

11 Bone Bone is a living and dynamic tissue whose structural and material properties are critical to the skeleton s functions, which include providing structural support to the body, protecting internal organs, assisting in limb mobility, and acting as a reservoir for and participating in calcium and phosphate homeostasis. Bone not only responds to hormonal signals, but is itself an endocrine organ, with secretion of factors influencing such diverse functions as phosphate excretion by the kidney and insulin production by pancreatic beta cells, amongst other targets (1). Bone tissue consists of a mineralized organic matrix formed and maintained by cells that are continuously engaged in modeling and remodeling to adapt the tissue to the demands (mechanical and physiological) that are put on it. Forming and maintaining the integrity of the adult skeleton requires equilibrium between the amount of bone formed and the amount resorbed, i.e. coordinated activity between osteoblasts and osteoclasts. Osteoporosis or osteopetrosis can occur when this equilibrium is disrupted causing a net loss or gain of bone mass, respectively Processes of Bone Formation The formation of bone occurs by two processes: intramembranous ossification and endochondral ossification (reviewed in (2) ). Intramembranous ossification takes place within a condensation of mesenchymal tissue called a primary ossification center. Groups of cells then begin to differentiate into osteoblasts, which produce bone matrix followed by calcification, encapsulating some of the osteoblasts to become osteocytes. The ossification centers grow radially and fuse together replacing the original connective tissue. This type of bone formation is typical of membrane bones, such as the flat bones of the skull. Endochondral ossification is primarily responsible for the formation of short and long bones. In this case, mesenchymal cells migrate to the site of eventual bone formation, condense or aggregate and differentiate into chondrocytes, which produce cartilage (loose extracellular matrix comprised of collagen and mucopolysaccharides) in the shape of the ensuing bone. Midway between the ends of the elongated cartilage template or anlage, the chondrocytes hypertrophy and the matrix erodes. Blood vessels invade the cartilage, which is degraded by osteoclasts, and strands of the

12 3 remaining cartilage act as a template for osteoblasts to secrete more ECM that undergoes calcification, forming the trabecular and cortical bone Bone Structure and Composition Bone tissue consists of a mineralized organic matrix formed and maintained by cells that are continuously engaged in modeling and remodeling. Approximately 20-30% by weight of bone is organic, 10% is water and the remainder is mineral. The organic matrix typically contains approximately 90% collagen and 10% noncollagenous proteins (e.g., bone sialoprotein, osteopontin, osteocalcin), proteoglycans, and lipids. Irrespective of the process by which it forms, bone is generally classified into two types: 1. cortical/compact bone and 2. trabecular/cancellous/spongy bone, based on porosity and unit microstructure (reviewed in (3) ). Cortical bone is the semi-solid shell that covers the entire bone. It contributes about 80% of the adult skeletal mass, but the surface area is relatively small - only 33% of total bone surface. The main function of cortical bone is to provide biomechanical strength, support and protective properties. Trabecular bone is a sponge-like network (rod or plate-like trabeculae) that occupies the inner area of the epiphysis and metaphysis. It contributes only ~20% of total bone mass but its surface area is large - 75% of the total surface of the skeletal system. Trabecular bone is more metabolically active and remodelled more frequently than cortical bone. Cortical and trabecular bone appear in all bones, including the long bones, vertebrae and calvaria. Within the solid bone shell is the bone marrow, which contains a number of stromal cell types, including precursors of the bone cells described below (hematopoietic stem cells (HSCs) and mesenchymal stem cells (MSCs)), blood cells, immune cells, megakaryocytes, and adipocytes (reviewed in (4) ). Bone and bone marrow function interdependently, as a single unit. The cells within the bone marrow are closely associated with and can affect the developing and mature bones; for instance, bone precursor cells have a direct regulatory role in their own development and in bone remodeling activities, while other stromal cells may regulate these processes through the production of local and systemic factors (discussed below). Bone and bone marrow composition both exhibit age-related changes: bones (particularly in humans) undergo

13 4 age-related bone loss, where osteopenia and osteoporosis develop most commonly in the elderly and post-menopausal women, and bone marrow becomes increasingly fatty with age, with higher numbers of adipocytes present in old versus young marrow. This correlation is at least in part due to the decreased osteogenic potential of precursors in older versus younger bone marrow (5) ; that is, an increase in adipocyte formation at the expense of osteoblast formation, both of which derive from common precursors, MSCs. 1.2 Regulation of Bone Formation Cells that produce bone matrix are called osteoblasts (reviewed in (6,7) ). Osteoblasts derive from MSCs that undergo several fate choices and transitional stages to become committed progenitors, and eventually the differentiated end-stage cells of the osteoblast lineage. These commitment and differentiation stages require and are identified by changes in proliferative capacity, along with temporal acquisition and loss of expression of specific molecular and morphological traits, as depicted in Figure 1.1. When their matrix forming phase terminates, osteoblasts may either: undergo programmed cell death (apoptosis), differentiate into lining cells on the bone surface or become enclosed in the bone matrix within small lacunae as osteocytes (reviewed in (8-10) ). Osteocytes are the major cell type in adult bone. They can communicate with neighboring osteocytes and cells on the bone surface, and can access nutrients though connections that are made via thin cellular processes called dendrites, located within a canalicular network permeating throughout the bone tissue. Osteocytes can sense mechanical strain and are essential for the skeleton s adaptive response to load, emitting signals to promote or inhibit bone formation and resorption. Osteoblastogenesis and bone formation are directed and controlled by the coordination of a number of molecules and factors, including expression of transcription factors, growth factors and small molecules which activate signals to guide cellular commitment, differentiation, and activity.

14 5 Figure 1.1 Development of the osteoblast and osteoclast lineage. The temporal morphological changes that accompany the differentiation of the bone forming osteoblast lineage cells (left) and the bone resorbing osteoclast lineage cells (right) are shown in the upper half of the diagram. For simplicity, general stages of the differentiation sequences are shown. The sequences of molecular changes in gene expression that occur through differentiation are shown in the lower part of the diagram, below each representative differentiation stage. RANK-RANKL-OPG signaling molecules are depicted in the diagram (for simplicity, at only one stage), and their protein expression profiles are found below.

15 Description and Expression Patterns of Osteoblast-Specific Genes MSC differentiation down the osteoblast lineage requires the activation of specific transcription factors that control the progenitor cell commitment and expression of downstream osteoblastspecific genes, which are necessary for the differentiation and activation of the osteoblast lineage. A complete description of the transcription factor networks that regulate osteoblastogenesis and osteogenesis is beyond the scope of this Introduction, but two key transcriptional regulators are: Runx2 (runt related transcription factor 2) is the master regulator/transcription factor required to activate the process of osteoblast differentiation (11,12). Osx (osterix) is also considered a major transcriptional regulator of osteoblastogenesis and its expression is downstream of Runx2 (13). The temporal expression patterns of not only Runx2 and Sost, but also the following genes are often used to characterize the lineage development of the osteoblast: Alp (alkaline phosphatase) enzyme has an important role in the mineralization of bone matrix by osteoblasts (14). It generally functions to promote mineralization by increasing the local concentration of inorganic phosphate and decreasing the concentration of extracellular pyrophosphate. Col1a1 (collagen type 1 alpha 1) is an extracellular matrix protein. Collagen fibrils form the organized scaffold of the bone matrix and their cross-linking contributes to bone strength (reviewed in (15) ). Major non-collagenous proteins in bone: Bsp (bone sialoprotein) is a phosphoprotein that promotes and is necessary for mineralization (16). Ocn (osteocalcin) is a calcium binding bone matrix protein and an inhibitor of bone formation (17) ; it has also been shown to have an endocrine function (18). Dmp1 (dentin matrix protein 1) is generally established as an osteocyte-specific marker and regulator of extracellular matrix mineralization. Loss of DMP1 in mice results in hypomineralization of bones and defective osteocyte maturation (19). Phex (phosphate regulating endopeptidase homolog, X-linked) protein is a member of the M13 class of cell-surface zinc-dependant proteases and is involved in the bone-kidney axis,

16 7 along with fibroblast growth factor 23 (Fgf23). Disruption of PHEX in humans and mice results in hypophosphatemia, renal phosphate wasting and rickets/osteomalacia (20,21). Sost (Sclerostin) mrna is expressed in mature osteoblasts and osteocytes, but the protein is only secreted by osteocytes. At the bone surface, it functions to inhibit osteoblastic bone formation by antagonizing Wnt signaling (22) Regulation of Osteoblast Differentiation by Growth Factors and Small Molecules Osteoblast differentiation and bone formation are regulated by a number of autocrine and paracrine factors, including growth factors (cytokines and hormones) and other small molecules that are present in the bone microenvironment via secretion from nearby and neighboring cells or via release from the bone matrix during resorption. There are a large number of growth factor families or groups that are known to be important in bone formation and repair, including numerous hormones (e.g. insulin-like growth factor (IGF-1) (23), sex steroids [reviewed in (24) ], parathyroid hormone (PTH) (25), etc.), fibroblast growth factors (FGFs; reviewed in (26,27) ), platelet-derived growth factor (PDGF (28,29) ), and the transforming growth factor beta (TGFB) superfamily (reviewed in (30) ). For instance, bone morphogenic proteins (BMPs), which are a large subfamily of the TGFB superfamily, have been well documented to induce osteogenesis, particularly BMPs 2, 4, 5, 6 and 7 (31). BMPs are secreted proteins that function by binding to the BMP receptors type I and II on the surface of cells, the signal is then mediated by phosphorylation of specific receptor-regulated Smads (R- Smads), such as Smads 1, 5, and 8. The phosphorylated R-Smads interact with common-partner Smad (Co-Smad), Smad4, and the complex translocates to the nucleus where it can regulate transcription of target genes, e.g. genes related to osteoblast differentiation, such as: Osx, Alp, Ocn and Bsp (32,33). In addition to growth factors, there are a number of small signaling molecules that also regulate bone formation and turnover, for example prostaglandins (34,35) and Wnt proteins. In particular, the Wnt family of secreted glycoproteins and their downstream signaling is a major pathway that has been shown to affect bone mass and strength, where activation of the pathway

17 8 induces bone formation and inhibition of the pathway results in osteopenia. Wnt/β-catenin signaling, also known as canonical Wnt signaling (reviewed in (36) ), is initiated by secreted Wnt ligands which bind to a receptor complex composed of low-density lipoprotein receptor-related protein 5 or 6 (Lrp5/6) and the frizzled receptor. This causes a signaling cascade downstream of the receptors that inhibits cytoplasmic glycogen synthase kinase 3 beta (GSK3b), which is normally involved in the proteasomal degradation of β-catenin. Cytoplasmic levels of β-catenin then accumulate and translocate to the nucleus, where it associates with the T-cell specific transcription factor/ lymphoid enhancer binding factor (TCF/lef) family transcription factors to control transcription of target genes which regulate osteogenic differentiation. As mentioned above, osteoblasts and adipocytes both derive from MSCs, and their progression along each lineage is guided by various molecules and factors that activate the required master transcription factors for each lineage, i.e. Runx2 for osteoblasts and Pparg2 for adipocyte. In addition to this, the significant plasticity between the osteoblast and adipocyte lineages provides a basis for transdifferentiation, and experimental evidence of an osteoblastadipocyte switch has been documented (37,38). For instance, Song et al. showed that loss of β- catenin from pre-osteoblasts leads to a cell-fate switch from osteoblasts to adipocytes (39). This has important implications in bone pathological conditions, and further studies are required to identify the exact molecular mechanisms that regulate the balance of osteoblasts and adipocytes within the bone marrow. 1.3 Regulation of Bone Resorption Osteoclasts are the bone resorbing cells (reviewed in (40) ). They may be mononuclear but are more typically recognized as multinuclear cells that are located on or adjacent to bone surfaces. Osteoclasts are terminally differentiated post-proliferative cells of hematopoietic origin whose differentiation, as with osteoblasts, is delineated by a temporal sequence of molecular and morphological traits, as shown in Figure 1.1, right panel. Their size and number may increase due to differentiation and fusion of mononuclear precursor cells with each other or existing osteoclasts. The process of bone resorption by osteoclasts is critically important to maintain skeletal health (as it is required in order to repair daily wear, microfractures, and even breaks in

18 9 the bone) and to whole body functioning via the release of important minerals and proteins which are stored in the bone matrix. Balancing rates of bone resorption and bone formation are necessary to ensure that skeletal integrity is maintained Description and Expression Patterns of Osteoclast-Specific Genes HSC differentiation down the osteoclast lineage also requires the activation of specific transcription factors that control the progenitor cell commitment and expression of downstream osteoclast-specific genes, which are necessary in the differentiation, fusion, and activation of the osteoclast lineage cells. A complete description of the transcription factor networks that regulate osteoclastogenesis is beyond the scope of this Introduction, but one key transcriptional regulator is: Nfatc1 (nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1) is the major osteoclastogenic transcription factor, required to stimulate osteoclastogenesis (41). In addition to Nfatc1, the temporal expression patterns of the following genes are often used to characterize the lineage development of the osteoclast: Oscar (osteoclast associated receptor) has been shown to be a collagen receptor on the surface of preosteoclasts and osteoclasts that promotes osteoclastogenesis (42). Trap (tartrate-resistant acid phosphatase) is an enzyme secreted by osteoclasts during bone resorption (43). Trap staining in bone and in vitro cultures is often used as a marker of osteoclastogenesis, though its expression is not restricted to osteoclasts, as mononuclear cells may also stain Trap positive. Calcr (Calcitonin receptor) located on the surface of osteoclasts binds the hormone calcitonin, a mediator of calcium homeostasis (44). When binding to its receptor, calcitonin inhibits calcium release from the bone by restricting osteoclastic bone resorption. The calcitonin receptor is generally a mature osteoclast marker. (Ctsk) Cathepsin K is a cysteine protease that is expressed in bone resorbing osteoclasts. Cathespin K is capable of cleaving bone matrix proteins and plays a role in degrading the organic portion of the bone during resorption (45,46).

19 Regulation of Osteoclast Differentiation by Cytokines, Hormones, and Small Molecules As described above for osteoblasts, osteoclast differentiation and bone resorbing activity are also controlled by a number of autocrine and paracrine factors, including various cytokines, hormones and other small molecules present in the bone microenvironment. Several of the growth factors and small molecules listed above have also been documented to affect osteoclastogenesis, either directly or via their effects on osteoblasts and stromal cells, including prostaglandins (35), sex steroid hormones (reviewed in (24) ), and PTH (47), among others. However, one of the major signaling systems/cytokines that regulate (stimulate or inhibit) the formation and activity of osteoclasts is the RANK/RANKL/OPG signaling axis (reviewed in (40,48) and depicted in Figure 1.1). Receptor activator of nuclear factor kappa B (RANK) is a receptor found on the surface of osteoclasts and their precursors. Osteoblasts and bone marrow stromal cells express receptor activator of nuclear factor kappa B- ligand (RANKL), which binds to its receptor RANK, to promote osteoclastogenesis and osteoclast activity. RANKL may be present in a soluble form (srankl) or in membrane-bound form (mbrankl). These same cells also express osteoprotegerin (OPG), a decoy receptor for RANKL, which can bind RANKL molecules inhibiting them from binding to the RANK receptors. The RANKL/OPG ratio has important implications for bone mass; an increase in the ratio favors osteoclastogenesis and bone resorption, while a decrease in the ratio has an osteoprotective role. 1.4 Connexins: Gap Junctions and Hemichannels The tightly regulated processes of bone modeling and remodeling (i.e. the coupling of bone formation and bone resorption) require the coordination of osteoblasts, osteocytes and osteoclasts. The coordinated activity between these cells is mediated by cell-cell and cellextracellular environment communication (e.g. communication across gap junctions and hemichannels, and cell-extracellular matrix interactions mediated by cell surface integrins), in addition to soluble factors (e.g. RANKL-OPG) as well as other cell-cell interactions.

20 Structure and Function Connexins are a multigene family of hemichannel- and gap junction-forming proteins (reviewed in (49,50) ). The connexin proteins contain highly conserved transmembrane domains, extracellular domains required for hemichannel or connexon pairing between adjacent cells, and a carboxylterminal region that serves as a docking platform for signaling complexes, as depicted in Figure 1.2. Six connexin proteins form the hemichannel or connexon with a central pore. Intercellular gap junctions form when hemichannels from adjacent cells dock onto one another. Hemichannels and gap junctions both display relatively low substrate specificity and allow the passage of ions and small molecules (molecular weight less than 1 kda). Hemichannels mediate communication between cells and the extracellular environment, including the bone matrix. They are essential for the transduction of signals and can activate intracellular signaling by mediating transport of signaling molecules such as ATP (51,52) and PGE2 (53,54). On the other hand, gap junctions are involved in communication between adjacent cells, via transport of intracellular signaling molecules such as calcium (55,56), camp (57,58), and inositol triphosphate (55,56).

21 12 Figure 1.2 Illustrations of connexin protein structure, hemichannels and gap junctions in the plasma membranes of cells. (A) Schematic of Cx43 protein structure showing the three missense mutations described in the ODDD mouse models highlighted in red. The mutations are denoted by the correct amino acid followed by the number and the substituted amino acid. (B) Illustration of six connexin proteins which oligomerize forming a hemichannel or connexon in the plasma membrane. (C) Hemichannels and gap junctions allow the passage of ions and small molecules to the extracellular environment and between cells, respectively. Abbreviations: plasma membrane (PM).

22 13 Many cells express more than one member of the connexin family, and each member forms channels with different functional properties. A connexin channel s permeability to specific cytoplasmic molecules, voltage, and chemical gating properties are determined by the type of channel formed, e.g. hemichannel versus gap junction, and the channel s composition, e.g. homomeric (composed of a single connexin member) versus heteromeric (composed of 2 or more different connexins). These differences are the reason that connexins cannot fully substitute or compensate for one another Connexin 43 Cx43, encoded by the gap junction protein alpha 1 gene (GJA1 (human), Gja1 (mouse)), is the most widely expressed and abundant vertebrate gap junction protein. It is expressed in cells of almost all tissues in the body, including the brain (59,60), heart (61), ovary (62), tooth (63,64), eye (65) and bone (66,67). Cx43 is the major connexin protein expressed in developing and mature skeletal tissues, and is expressed in chondrocytes (68,69), osteoblasts (66,70), osteocytes (70), osteoclasts (71), and bone marrow stromal cells (72). Cx45 (66,73), Cx46 (74) and Cx37 (75,76) are also expressed in bone tissue, albeit at significantly lower levels than Cx43. In bone as in other tissues, osteoblasts, osteocytes, osteoclasts and cells in the bone marrow can communicate with one another via passage of signaling molecules and ions across gap junctions and hemichannels; see Figure 1.3. This communication is crucial in cellular control of the tightly regulated processes of bone formation and bone turnover. However, the signaling pathways involved in this multi-cellular communication and the functional consequences on bone of aberrant gap junction and hemichannel communication are only beginning to be elucidated. 1.5 Cx43 Mouse Models Understanding the role of gap junctions and hemichannels in bone metabolism has long been an area of pursuit, but has accelerated over the last decade by characterization of novel mutations in humans and genetically-engineered mice, in which markedly affected gap junction and hemichannel formation and function are associated with aberrant bone structure and activity.

23 14 Figure 1.3 Connexin 43 in the bone microenvironment. The interconnected network of cells, comprised of cells on/within the bone (osteoblasts, osteocytes, and osteoclasts) and within the bone marrow (osteoprogenitors and other stromal cells) can communicate with one another via Cx43 channels, soluble factors (RANKL-OPG) and other cell-cell interactions. This communication coordinates bone formation and resorption, ensuring that skeletal integrity is maintained. The consequences of aberrant Cx43 channel formation and function are, therefore, complex and multifactorial. Question marks (?) denote instances where direct communication across Cx43 gap junctions has yet to be reported or requires further study to confirm.

24 15 Cx43 globally- and conditionally-deleted mouse models have provided much insight into the importance of Cx43 in bone formation and function and osteoblast lineage development. The models include: Cx43 global knockout mice (Cx43 -/- ) (77), and conditional deletion of Cx43 in early osteochondro progenitors (DM1Cre;Cx43 -/fl and DM1Cre;Cx43 +/fl(g138r) ) (78,79), osteoblasts (ColCre;Cx43 -/fl ) (80-82), mature osteoblasts/ osteocytes (OcnCre;Cx43 -/fl ) (83-87) and osteocytes (DMP1Cre;Cx43 fl/fl ) (87,88) ; see Figure 1.4). In addition to the knockout models, three mouse strains with missense point mutations in one allele of the Gja1 gene have been generated (Gja1 Jrt(G60S) /+ (89), Cx43 I130T /+ (90), Cx43 G138R /+ (91) ; Figure 1.2, Table 1.1). These strains serve as phenotypic mimics and thus useful models of a rare human disorder termed oculodentodigital dysplasia (ODDD), characterized by a spectrum of clinical features including, amongst others, craniofacial abnormalities, syndactyly, neurological problems and cardiac defects (92,93). To date, over 65 mutations in GJA1 have been identified and reported to cause ODDD (92-94). The functional effects of many of these GJA1 mutations have been extensively studied and shown to act in a dominant negative manner, significantly reducing total and phosphorylated levels of Cx43 protein. Formation and function of Cx43 gap junctions are concomitantly significantly reduced, since a large portion of Cx43 remains trapped in intracellular structures, such as the Golgi (89-91,95,96). Interestingly, however, the effect of the Cx43 mutant proteins on the activity of opened hemichannels is more variable (97,98). The only point mutation models whose bone phenotypes have been reported upon are the Gja1 Jrt /+ and Cx43 G138R /+ mouse models. Below and in Table 4.1, we summarize the consequences of Gja1 mutation and ablation in these various mouse models. Comparison across models highlights the complex roles and underlying mechanisms of Cx43 in bone cell lineage development, activities, and in the formation and maintenance of the skeleton. Furthermore, the table documents how the work presented in this thesis adds valuable information to the field of Cx43 research regarding the bone-related effects of the Gja1 Jrt mutation, and puts it in the context of the published data on other Cx43 models.

25 16 Figure 1.4. Schematic of osteoblast lineage development and the different promoters used to drive Cre for differentiation stage-specific Cx43 ablation. The figure depicts in simplified form osteoblast differentiation from mesenchymal progenitor (osteochondroprogenitor) to terminally differentiated osteocyte. Displayed are the promoter-cre constructs, which depict the point in the lineage development that Cx43 is disrupted in the conditional deletion mouse models. All cells in the body that express Cx43, which is amongst the most ubiquitously expressed of Cxs, are affected in the Cx43 global knockout and Cx43 point mutation mouse models.

26 17 Gja1 Jrt /+ Cx43 I130T /+ Cx43 G138R /+ Reference Flenniken et al., 2005; McLachlan et al., 2008 Kalcheva et al., 2007 Dobrowolski et al., 2008 Mutation G60S I130T G138R Mutation Location first extracellular loop intracellular loop intracellular loop Mutation described in human ODDD No Yes Yes Effect on total CX43 levels unaffected or p-cx43 levels Gap junction formation unaffected or Gap junction function Hemichannel function Unknown Table 1.1 Connexin 43 missense point mutation summary chart. The location and functional effects of the Cx43 missense point mutations shown in Figure 1.1A are described.

27 Cx43 disruption: Effect on bone development and skeletal homeostasis Functional Cx43 gap junctions and hemichannels are crucial for the processes of bone formation, maintenance and healing. Loss or disruption of Cx43 gap junction formation and/or function results in varying degrees of osteopenia in all the mouse models studied. The osteopenic phenotype includes reduced bone mineral density (77,78,80,85,89), changes in geometrical properties (e.g. decreased cortical thickness and increased marrow space) (78,79,81,85,87), reduced bone biomechanical properties (e.g. material and structural parameters) (78,79,83,85,87,88), and reduced ability to heal after a bone fracture (84). The impact of Cx43 extends to bones formed via both endochondral ossification, e.g., the long bones of the appendicular skeleton and intramembranous ossification, e.g., the calvaria bones. Cx43 is important during initial formation and mineralization of early prenatal and neonatal bones, as its disruption can lead to shortened and/or misshapen bones and delayed mineralization, as in the Cx43 -/-, DM1Cre;Cx43 -/fl, and DM1Cre;Cx43 +/fl(g138r) mice (77,78,89). While phenotypic traits paralleling those seen in human ODDD (e.g., craniofacial and other bone geometry anomalies, enamel hypoplasia, syndactyly amongst others) have been reported in some mouse Cx43 models, we have found no reports of low bone mass in patients with GJA1 mutations. Whether this is due to interspecies differences in the importance of CX43 in bone maintenance (e.g. other factors compensating for the loss of functional Cx43 channels), or reflects that the presentation of more severe symptoms (e.g. various neurological and cardiac symptoms, ocular abnormalities, conductive hearing loss) have precluded the testing or reporting of altered bone density is not yet clear (92). While not yet reported in human ODDD or exhaustively studied in the Cx43 mutant mice described to date, it is thought that Cx43 channels play a role in controlling both the composition and quality of the bone matrix. For example, at least certain mutations of Cx43 negatively affect the maturation of collagen fibrils (88) and result in disorganization of collagen fibers in the bone matrix (78). The decreased maturation of collagen fibrils in OcnCre;Cx43 /fl mice decreases the strength of the bone material (88), while the disorganization of collagen fibers in the matrix of DM1Cre;Cx43 -/fl mice is accompanied by a reduction in mineralization (78). More work is needed to further assess the bone matrix - changes in make-up and quality - in Cx43 murine mutant models and potentially ODDD patients, and their impacts on the resultant bone phenotypes.

28 Cx43 disruption: Effect on development and activity of osteoblast lineage cells Although functional Cx43 channels are required for the normal processes of differentiation, function and bone-forming activities of osteoblasts, understanding the exact role - or multiplicity of roles - of Cx43 in the osteoblast lineage is still evolving. For example, there have been discordant findings in terms of osteoblastogenesis and osteoblast function in various Cx43 mutant models. The discrepancies are, in part, related to the stage in the lineage development that Cx43 channels are disrupted. For example, disruption in early stage cells indicates that Cx43 has a role in stromal cell commitment, maintenance of precursor populations and/or in controlling the subpopulation makeup of the stroma. At these earlier stages, disruption of Cx43 channels results in increased mesenchymal progenitor and osteoprogenitor numbers, as seen in the DM1Cre;Cx43 -/fl and ColCre;Cx43 /fl mice (78,82), suggesting that Cx43 may function to restrain progenitor numbers in the bone marrow, possibly by suppressing proliferation (99) or by promoting apoptosis; this is in contrast to its role in osteocytes, where Cx43 is necessary to maintain viability (see below) (86,87). It should also be noted that when Cx43 channels are disrupted very early in the lineage (e.g., in Cx43 -/-, DM1Cre;Cx43 -/fl and +/fl(g138r) and Cx43 +/G138R mice), general osteoblast dysfunction (reduced mineralization capacity and decreased expression of osteoblast markers) has been reported (77-79,100). Importantly, however, osteoblasts from different skeletal locations (e.g. calvaria versus trabecular versus cortical bone-derived; endocortical- versus perisotealderived; and calvaria-derived versus bone marrow stromal-derived osteoblasts in vitro) are differentially sensitive to loss of Cx43. For instance, ablation of Cx43 typically results in upregulated osteoblast bone formation on periosteal surfaces of cortical bone and enhanced responsiveness to in vivo loading (e.g. DM1Cre;Cx43 -/fl and OcnCre;Cx43 /fl mice) (78,79,87). While the effect of Cx43 ablation on endosteal bone formation has been reported to be different in different models, osteoblastic responsiveness to mechanical loading on endosteal surfaces is attenuated in Cx43 knockout mice (e.g. DM1Cre;Cx43 -/fl and ColCre;Cx43 /fl mice) (78,81,85,101). The differing responses to loading on the periosteal and endosteal envelopes of Cx43-deficient bone have been posited to arise due to decreased SOST production specifically by osteocytes close to the periosteal surface or from site-specific (periosteal versus endosteal) cell autonomous

29 20 alterations in sensitivity to mechanical load and mechanotransduction. While more remains to be done to understand the mechanisms, the results highlight the complex role that Cx43 has in osteoblastic and their accessory cells in different skeletal locations. Finally, when Cx43 channels are disrupted at later stages (e.g. in MC3T3 cells, a preosteoblastic cell line, or in OcnCre;Cx43 -/fl and DMP1Cre;Cx43 fl/fl mice), osteoblastogenesis and osteoblast activity have been reported to be normal (95). However, Cx43 appears to have a role in maintaining osteocyte viability specifically in the cortical bone compartment. Studies on the OcnCre;Cx43 -/fl and DMP1Cre;Cx43 fl/fl mice reveal that loss of Cx43 in mature osteoblast and osteocyte populations leads to increased osteocyte apoptosis (86,87). Bivi et al. suggested that the reduced osteocyte number results in changes in levels of osteocyte-derived factors (e.g. SOST, RANKL and OPG) that control bone formation and resorption, and that osteocytes undergoing apoptosis emit signals that act as chemoattractants to induce osteoclast recruitment and resorption, driving changes in the bone geometry of these Cx43 mutant mice (87). Nevertheless, it remains unclear why when Cx43 channels are also disrupted earlier, that is in osteoblast precursors (e.g. in the DM1Cre;Cx43 -/fl mice), osteocyte numbers and apoptosis are unaffected (78) Cx43 disruption: Effect on the development and activity of osteoclasts A variety of in vitro studies indicate that functional Cx43 gap junctions are essential for osteoclastogenesis (differentiation and fusion), osteoclastic bone resorption and/or osteoclastic survival (71, ). For example, disruption of Cx43, with the use of antibodies, mimetic peptides (e.g. Gap 27) or pharmacological inhibitors, reduces osteoclastogenesis (formation and fusion of TRAP-positive osteoclasts), bone resorption (number and/or size of resorption pits) and osteoclastic survival rate in culture models. Such studies have suggested that Cx43 gap junction communication has a direct effect on osteoclast development, activities and survival, perhaps by influencing signaling pathways downstream of RANKL (105), other inducers of osteoclastogenesis, or factors controlling proliferation and/or apoptosis.

30 21 On the other hand, in vivo disruption of Cx43 at various stages of the osteoblast lineage, as in DM1Cre;Cx43 -/fl, OcnCre;Cx43 /fl and DMP1Cre;Cx43 fl/fl mice, results in increased osteoclast numbers and bone resorption in bones, especially on endosteal surfaces (78,85,87). These results suggest that the effect of Cx43 disruption on osteoclast formation and function is indirect or secondary to communication from osteoblasts, osteocytes and/or stromal cells either directly through gap junction intercellular communication, through signals emitted from apoptotic osteocytes acting as chemoattractants for osteoclasts and their precursors (as discussed above), or through changes to factors such as RANKL and OPG, or a combination of these. That Cx43 gap junction communication affects the expression of RANKL and OPG, chemokines produced by osteoblasts, osteocytes and stromal cells that are crucial to the formation and activation of osteoclasts, is now well-established. Disruption of Cx43 in DM1Cre;Cx43 -/fl, OcnCre;Cx43 /fl, and DMP1Cre;Cx43 fl/fl mice causes changes in the RANKL- OPG signaling axis favoring an increase in the RANKL/OPG ratio (78,85,87), promoting osteoclastogenesis and bone resorption, and contributing to the osteopenic phenotypes of Cx43 mutant mice. Given the results to date, it remains unclear whether osteoclasts and adjacent cells communicate directly via gap junction intercellular communication and/or whether osteoclasts rely on hemichannels to communicate (receive and emit signals) with nearby cells on the bone or within the stroma. Regardless, more work is needed to determine the precise direct and/or indirect mechanism(s) by which Cx43 gap junction communication regulates bone resorption. 1.6 Cx43 channels and signaling in bone cells response to stimuli Modulating the formation and function of gap junctions and hemichannels allows cells to modulate (propagate or diminish) signaling responses in networks of nearby and connected cells. Notably, osteoblastic cells respond to a variety of mechanical and hormonal signals, to bone endogenous (autocrine/paracrine) factors, such as cytokines and growth factors, and to exogenous factors, such as pharmacological agents, with changes to Cx43 expression. This leads to differences in functional coupling (passage of signaling molecules and ions) between cells or

31 22 cells and their environment, in turn altering osteoblastic cell responsiveness to the same or other signals (106,107), and resulting in an overall adaptive response of the skeleton to a particular stimulus. For instance, gap junction intercellular communication in bone cells plays an important role in response to mechanotransduction, e.g. by propagating such signals through osteoblast networks with second messengers Ca 2+ (108) and PGE2 (109) Growth factors, morphogens, and other molecules Connexin 43 gap junction intercellular communication plays an important role in enhancing the signaling and transcriptional response of osteoblasts to growth factors, morphogens, or hormones. In addition to the important role of Cx43 channels in transport of signaling molecules, Cx43 has been shown to interact with intracellular structural and signaling molecules to modulate cellular signaling activities. For instance, Cx43 proteins have been proposed and/or shown to interact with Src kinase to activate ERKs in response to bisphosphonate-mediated cell survival signaling (110), with β-arrestin in response to PTH survival signaling (111), and with protein kinase C-delta during FGF2 signaling (112). Cx43 can alter the transcriptional regulation of particular genes promoter elements via select signaling pathways, like MAP-kinase and protein kinase C -δ, which may be required to integrate and enhance signals or transduce them across the osteoblast network (113,114). Specifically for instance, Cx43-dependent amplification of FGF2 signaling in osteoblasts occurs via cell-cell communication and activation of ERK and PKC-δ; this allows for a coordinated response to the FGF2 signal, enhancing the transcriptional activation of Runx2, in an osteoblast population (114,115). Cx43 has also been proposed to physically interact with β-catenin protein (116), although its direct involvement in two of the major osteoblastic signaling pathways, the Wnt and BMP signaling pathways, remains unknown. Interestingly, Dobrowolski et al. showed that the syndactyly phenotype of the Cx43+/G138R and Cx43-/- mice arises from decreased interdigital apoptosis due to decreased SHH and BMP2, along with subsequent increase in FGF signaling due to increased FGF4 and FGF8 (117). Kim et al. showed that disruption of Cx43 by antisenseoligonucleotides caused increased Shh and decreased Bmp2 expression levels during fungiform papillae development (118). Clearly, disruption of Cx43 gap junction coupling can lead to

32 23 alterations of morphogens or growth factors such as BMPs and FGFs, but the mechanism by which this occurs must continue to be investigated (119) Mechanostimulation Responsiveness to, for example, mechanical stress is needed to maintain the integrity of the skeleton. Ablation of Cx43 (e.g. in DM1Cre;Cx43 -/fl, OcnCre;Cx43 /fl and DMP1Cre;Cx43 fl/fl mice) generally enhances the anabolic response to mechanical loading (78,81,85,101). The increased responsiveness has been linked to changes in signaling molecules, specifically to a decrease in SOST expression (in bones of DM1Cre;Cx43 -/fl mice (120) ) or to an upregulation of β-catenin protein levels ( priming osteocytes of DMP1Cre;Cx43 fl/fl mice to respond to stimulation (121) ). Conversely, loss of Cx43 attenuates the catabolic response to unloading (e.g. in ColCre;Cx43 /fl(120) and OcnCre;Cx43 /fl(83) mice). This phenomenon has also been linked to a reduction in SOST (i.e. the decreased number of SOST-positive osteocytes in OcnCre;Cx43 /fl mice (122) ), or to the increase in baseline osteoclast numbers (in ColCre;Cx43 /fl mice (81,120) ) which may limit further osteoclast activation upon unloading. Regardless, these data suggest that disruption of Cx43 alters how bones perceive and respond to mechanical stimulation, possibly because Cx43 has a role in desensitizing the bone to mechanical signals either by controlling molecules that enhance sensitivity to such signals (e.g. SOST and β-catenin) or by directly controlling the viability/activities of cells that respond to mechanical stimulation (e.g. osteocytes, osteoblasts and osteoclasts). 1.7 Age-related changes in Cx43 channel formation and function The formation and responses of Cx43 channels to stimuli decline as a function of age (123,124). Cx43 gap junction formation is significantly lower in older versus younger bone marrow MSCs and HSCs (123,125,126). This is interesting vis-a-vis the proposed role of Cx43 in developing bone marrow, during cell division and progenitor proliferation, and in repopulation of the bone marrow during regeneration (125,126), but cause versus effect relationships remain to be rigorously determined. Functional Cx43 channels are necessary to modulate the response of osteoblasts to physiological signals, as outlined above. However, it has been shown that Cx43 gap junction

33 24 intercellular communication in response to at least one signal, that of PTH, decreases as a function of age (124), and ablation of Cx43 in mice results in an attenuated response to PTH (81). Under normal conditions, treatment with PTH upregulates Cx43 expression and gap junction intercellular communication in osteoblastic cells (106,127,128). The decrease in Cx43 gap junction formation and function with age may explain, at least in part, why the adult skeleton is less able to adapt to the physical demands placed on it. Also the decreased responsiveness of cells to hormonal and mechanical signals with age, due to decreased formation and function of Cx43 channels, likely contributes to the presence of osteopenia and osteoporosis with increasing age. The early-onset osteopenic phenotypes displayed by the Cx43 mutant mouse models further support the link between reduced Cx43 channel formation/function and osteopenia/low BMD. 1.8 Thesis Objectives Osteopenia and osteoporosis are conditions characterized by varying degrees of low bone mass, arising from a shift in the normal equilibrium maintained between the actions of osteoblasts (bone forming cells) and osteoclasts (bone resorbing cells). Coordination between these cells is maintained, in part, by cell-cell communication across gap junctions and hemichannels, in addition to other cell-cell and cell-environment interactions. Cx43 is the major gap junctionforming protein found in bone, and its disruption (deletion, conditional-deletions, and missense mutations) in mouse models has been documented to reduce bone mineral density and bone biomechanical properties. While the Cx43 mutant models maintain several unique features, resulting from the stage in the osteoblast lineage development that Cx43 is disrupted, the osteopenic phenotypes have generally been attributed to osteoblast dysfunction and/or increased osteoclast numbers/activity. The work presented here is based on a new osteopenic mouse model carrying a unique mutated Cx43 allele. Through a genome-wide ENU mutagenesis screen, a mouse line, Gja1 Jrt /+, was isolated with a missense mutation leading to a G60S amino acid substitution in Cx43 (89). In addition to having the classical symptoms of ODDD, Gja1 Jrt /+ mice are osteopenic, with reduced bone mineral density, bone mineral content and mechanical strength at 22 weeks of age, delayed

34 25 ossification of craniofacial bones of mesoderm and neural crest origin, osteopenic endochondral bones in adult mice (8-51 weeks of age), and increased bone marrow adipogenesis in young mice (18 weeks of age) that progresses with age (until 51 weeks of age). My goal was to further describe the bone phenotypes and to identify the mechanism(s) behind the bone phenotypes exhibited by the Gja1 Jrt /+ mice.

35 26 Chapter 2 The G60S Connexin 43 Mutation Activates the Osteoblast Lineage and Results in a Resorption-Stimulating Bone Matrix and Abrogation of old Age-related Bone Loss The work presented in Chapter 2 is published as: The G60S Connexin 43 Mutation Activates the Osteoblast Lineage and Results in a Resorption-Stimulating Bone Matrix and Abrogation of old Age-related Bone Loss Tanya Zappitelli *1, Frieda Chen *2, Luisa Moreno 3, Ralph A. Zirngibl 2, Marc Grynpas 3,4, Janet E. Henderson 5 and Jane E. Aubin 1,2,4 *co-first authors, 1 Department of Medical Biophysics, 2 Department of Molecular Genetics, and 3 Department of Laboratory Medicine and Pathobiology, University of Toronto, 1 King's College Circle, Toronto, Ontario M5S 1A8, Canada, 4 Centre For Modeling Human Disease, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, 600 University Avenue, Toronto, Ontario M5G 1X5, Canada, 5 Division of Orthopedics, Montreal General Hospital, 1650 Cedar Avenue, Montreal, Quebec H3G 1A4, Canada. J Bone Miner Res Nov;28(11): Author Contributions: Study design and conduct: TZ, FC, LM, RAZ, MG, JEH, and JEA. Data collection: TZ, FC, LM, and RAZ. Data analysis: TZ, FC, LM, RAZ, and JEH. Data interpretation: TZ, FC, LM, RAZ, MG, JEH, and JEA. Drafting manuscript: TZ, FC, and JEA. Revising manuscript content and approving final version of manuscript: TZ, FC, LM, RAZ, MG, JEH, and JEA. TZ, FC, LM, RAZ, MG, JEH and JEA take responsibility for the integrity of the data analysis.

36 Abstract We previously isolated a low bone mass mouse, Gja1 Jrt /+, with a mutation in the gap junction protein, alpha 1 gene (Gja1), encoding for a dominant negative G60S Connexin 43 (Cx43) mutant protein. Similarly to other Cx43 mutant mouse models described, including a global Cx43 deletion, four skeletal cell conditional-deletion mutants and a Cx43 missense mutant (G138R/+), a reduction in Cx43 gap junction formation and/or function resulted in mice with early onset osteopenia. In contrast to other Cx43 mutants, however, we found that Gja1 Jrt /+ mice have both higher bone marrow stromal osteoprogenitor numbers and increased appendicular skeleton osteoblast activity leading to cell autonomous upregulation of both matrix bone sialoprotein (BSP) and membrane-bound receptor activator of nuclear factor kappa-b ligand (mbrankl). In younger Gja1 Jrt /+ mice, these contributed to increased osteoclast number and activity resulting in early onset osteopenia. In older animals, however, this effect was abrogated by increased osteoprotegerin (OPG) levels and serum alkaline phosphatase (ALP) so that differences in mutant and wild type (WT) bone parameters and mechanical properties lessened or disappeared with age. Our study is the first to describe a Cx43 mutation in which osteopenia is caused by increased rather than decreased osteoblast function and where activation of osteoclasts occurs not only through increased mbrankl but an increase in a matrix protein that affects bone resorption, which together abrogate age-related bone loss in older animals. 2.2 Introduction Connexins comprise the gap junction- and hemichannel-forming membrane proteins in bone and other tissues. Gap junctions allow direct cell-cell coupling and communication, whereas hemichannels, the unopposed halves of gap junctions, allow for release of extracellular signaling molecules. Cx43 is the major connexin expressed in osteoblasts and osteocytes and is also expressed in osteoclasts and bone marrow stromal cells (66,129,130), and as such has been implicated in mediating cell-cell coupling and intercellular communication/signaling in the tightly regulated process of bone metabolism.

37 28 Cx43 global and conditional knockout (KO) mutant mice with decreased gap junction function are osteopenic and/or exhibit alterations in the structure/geometry of long bones (77,78,80,85,87,88). The low bone mass phenotype was attributed in earlier studies to fewer and dysfunctional osteoblasts, or increased bone resorption by osteoclasts, or both. For example, Cx43 global and collagen 1a1 (Co1a1) promoter-cre osteoblast-deleted Cx43 mice have fewer and dysfunctional osteoblasts producing less bone matrix and with reduced mineralization in vivo and in vitro (77,80). Mice with Cx43 ablation in the osteo-chondrogenic lineage via use of the Dermo1/Twist2 (DM1) promoter results in both dysfunctional osteoblasts and increased osteoclastogenesis and bone resorption (78). Mice with Cx43 deleted at later stages of the osteoblast lineage have also been generated. One osteocalcin (Ocn) promoter-cre osteoblastdeleted Cx43 mouse line with Cx43 ablation in osteoblasts and osteocytes was reported to have no detectable change in bone mineral density but an abrogated response to the anti-apoptotic effect of bisphosphonates on osteocytes and osteoblasts (86) whereas another OcnCre Cx43 mouse line was reported to exhibit increased osteoclastogenesis and bone resorption due to an increase in the RANKL/OPG ratio in osteocytes, as well as an enhanced anabolic response to load (85). In these cases, although bone density was unaffected, the structural parameters of the long bone were still affected (79,83,85). In other recent analyses, Plotkin and colleagues reported that in both their OcnCre Cx43 mouse strain and a dentin matrix protein-1 (Dmp1) promoter-cre Cx43 mouse strain in which Cx43 is deleted from osteocytes only, no change in bone mineral density is detectable (except for a slight decrease at 2 months in the Dmp1Cre Cx43 strain) but increased osteocyte apoptosis and altered osteoclast and osteoblast activity via reduced expression of OPG and sclerostin (Sost) respectively (87) promote geometric changes in long bones. In the +/G138R mouse, which carries a mutation in the cytoplasmic loop of Cx43 and expresses normal levels of Cx43 protein but has reduced gap junction function, osteopenia and a non-statically significant decrease in osteoblast number were reported (91). Taken together, the data from the KO and G138R missense mutants suggest differences in the mechanisms underlying changes in osteoblast and osteoclast activity upon disruption of Cx43 globally or at different stages of osteoblast development. Through an N-ethyl-N-nitrosourea mutagenesis screen, we generated a mouse line, Gja1 Jrt /+, containing a glycine to serine mutation (G60S) in the first extracellular loop of Cx43 (denoted herein as Gja1 Jrt for the allele and G60S for the mutation). Like other Cx43 mutants,

38 29 this line had a bone phenotype of decreased bone mass and mechanical strength, and like G138R mice, exhibited the classical features of human oculodentodigital dysplasia (ODDD) (89), a rare disease characterized by syndactyly, enamel hypoplasia, craniofacial abnormalities, abnormal eye development and small stature (131). Although Gja1 Jrt /+ mice express less than 50% of wild type (WT) levels of Cx43 and have markedly reduced gap junction formation and function in osteoblasts and other Cx43-expressing cell types (89,95), we now report the unexpected finding that Gja1 Jrt /+ mice have more active osteoblasts than their WT littermates. We also report that while young Gja1 Jrt /+ mice are osteopenic, older mutant mice do not exhibit the old age-related bone loss seen in WT, and report the novel cellular and molecular basis of the osteopenia and age-related phenotypic anomaly in Gja1 Jrt /+ mice. 2.3 Materials and Methods Animals and Ethics Statement Gja1 Jrt /+ founders in a C57BL/6J background were backcrossed four generations to C3H/HeJ mice. Males from the fourth generation (C4) were crossed to FVB females to generate F1 mice; a second crossing to FVB produced F2 mice. This study was performed using litters from a cross between F2 males to C3H/HeJ females. All experimental procedures were performed in accordance with protocols approved by the Canadian Council on Animal Care and the University of Toronto Faculty of Medicine and Pharmacy Animal Care Committee. Bone mineral density Dual energy x-ray absorptiometry (PIXImus, Lunar Corp., Madison, WI) was used to measure bone mineral content (BMC), bone area and bone mineral density (BMD) of femurs in mice (89). MicroCT of femurs and vertebrae The distal metaphysis of the left femurs were scanned with a Skyscan 1072 microct instrument (Skyscan, Belgium) at the Centre for Bone and Periodontal Research ( as described (132). Morphometric parameters were calculated with 3D Creator software.

39 30 Mechanical testing Destructive three-point bending was performed as previously described (133) and the ultimate load, failure displacement, stiffness and energy to failure were determined from the load displacement curve. These parameters were normalized to the cross-section of the femurs (measured with calipers) to calculate the ultimate stress, ultimate strain, young s modulus and toughness. Dynamic histomorphometry Mice were given two intra-peritoneal injections of 30mg/kg aqueous calcein prior to sacrifice as described (132). Polymethylmethacrylate (MMA) embedded left femurs were cut in 3 µm sections. Histochemistry The right femur in 4% paraformaldehyde (PFA) was embedded in a mixture of MMA and glycolmethacrylate (GMA) and 5 µm sections stained with 5% silver nitrate and 0.2% toluidine blue to visualize mineralized bone, osteoid and osteoblasts. Visualization of osteoclasts in sections was tartrate resistant acid phosphatase (TRAP) staining and counterstained with 0.4% methyl green (Vector Laboratories Inc.) and mounted in aqueous medium (134). Plasma Biochemistry Whole blood was collected through the saphenous vein, and the plasma was separated from whole blood by centrifugation and stored at -80 C until biochemical analysis (Vita-Tech, Ontario, Canada). Quantitative RT-PCR Total RNA was isolated from bone and cell cultures using TriReagent (Sigma-Aldrich, St. Louis, MO) and reverse transcribed using Superscript II (Invitrogen, Carlsbad, CA) and random hexamers. cdna was combined with 0.5 µm each of the forward and reverse primers (135) (Table 2.1) and iq SYBR Green Supermix and run in the MyIQ Real-Time PCR system (BioRad Laboratories, Hercules, CA). Raw data were analyzed with PCR Miner (136) and normalized using the internal control transcript for ribosomal protein L32.

40 31 Gene Direction Sequence Product size (bp) Alp* Forward CCAACTCTTTTGTGCCAGAGA Reverse GGCTACATTGGTGTTGAGCTTTT 110 Bsp* Forward CAGGGAGGCAGTGACTCTTC Reverse AGTGTGGAAAGTGTGGCGTT 158 CalR ~ Forward CTGGTGCGGCGGGATCCTATAA Reverse AGGGCACGAGTGATGGCGTG 218 Cathepsin K ~ Forward ACCCATATGTGGGCCAGGATGA Reverse GAGATGGGTCCTACCCGCGC 136 Col1a1* Forward GCTCCTCTTAGGGGCCACT Reverse CCACGTCTCACCATTGGGG 103 Dmp1 ~ Forward CATTCTCCTTGTGTTCCTTTGGG Reverse TGTGGTCACTATTTGCCTGTC 185 E11 ~ Forward TGCTACTGGAGGGCTTAATGA Reverse TGCTGAGGTGGACAGTTCCT 103 L32 # Forward CACAATGTCAAGGAGCTGGAAGT Reverse TCTACAATGGCTTTTCGGTTCT 100 NFATc1 ~ Forward CAGCTGTTCCTTCAGCCAAT Reverse GGAGGTGATCTCGATTCTCG 140 Ocn* Forward CTGACCTCACAGATCCCAAGC Reverse TGGTCTGATAGCTCGTCACAAG 187 Opg* Forward GGGCGTTACCTGGAGATCG Reverse GAGAAGAACCCATCTGGACATTT 125 Opn* Forward AGCAAGAAACTCTTCCAAGCAA Reverse GTGAGATTCGTCAGATTCATCCG 134 OSCAR ~ Forward GTCCCTCCCCTGGCCTGCAT Reverse AGGCAGATTGAGGTGCGCGG 149 Osx* Forward ATGGCGTCCTCTCTGCTTG Reverse TGAAAGGTCAGCGTATGGCTT 156 Phex* Forward GATGCAGGGACAAAAAGGAA Reverse AAATACTTGCGGGTTTGCAG 167 Rankl* Forward CAGCATCGCTCTGTTCCTGTA Reverse CTGCGTTTTCATGGAGTCTCA 107 Runx2* Forward TGTTCTCTGATCGCCTCAGTG Reverse CCTGGGATCTGTAATCTGACTCT 146 Sost ~ Forward TTCAGGAATGATGCCACAGA Reverse GTCAGGAAGCGGGTGTAGTG 179 Trap ~ Forward TGGCAGGGCAGGAACTCTGGA Reverse GTAGGCCCAGCAGCACCACC 139 Table 2.1 Quantitative RT-PCR primer sequences used in this study Oligonucleotides were obtained from *PrimerBank, ~ NCBI primer design, and designed with # Primer Express, version 2.0 (Perkin-Elmer, Foster City, Calif.)

41 32 Isolation of Bone Marrow Cells and CFU-O assay Bone marrow cells were isolated from resected tibia and femora, using a modification of a previously published method (137). Cells were plated in α-mem supplemented with 10% heatinactivated FBS and antibiotics (1 IU penicillin, 1µg/mL streptomycin, 50µg/mL gentamicin, 250ng/mL fungizone) (standard medium) at 1x 10 6 nucleated cells/35-mm dish. After three days, the medium was changed to differentiation medium (standard medium with 50 µg/ml ascorbic acid and 10 mm β-glycerophosphate). At day 19, cultures were stained for alkaline phosphatase (ALP) activity and mineralization (Von Kossa) (138), counted, then re-stained with methylene blue. Protein isolation from bone and stromal culture and Western blotting Long bones, cleaned of surrounding tissue, epiphysis and bone marrow, were cut slightly below the growth plate to separate trabecular bone. Matrix proteins were extracted following a protocol modified from Goldberg and Sodek (139). Briefly, bones were transferred to 4.0 M Guanidine HC1 for 30 minutes, washed in PBS and crushed into bone powder in liquid nitrogen. Bone powder or stromal cultures were washed in PBS then extracted with 0.5 M EDTA in 50 mm Tris/HCl ph 7.4 buffer for four sequential 24-hour extracts. Non-matrix proteins (mbrankl) were extracted in cell lysis buffer as described (140). Protein extracts (30 µg) underwent immunoblotting with antibodies of interest (Table 2.2). Densitometry was done by chemiluminescence detected on film and quantified using Image J software; BSP levels were normalized against either ACTIN or OPN, and in either case was increased significantly. Osteoclast differentiation assay Spleen-derived: Spleens were crushed through a sterile 100 µm mesh in standard medium. Cells were collected by centrifugation, resuspended in PBS, treated with ammonium chloride to lyse the red blood cells and plated in standard medium supplemented with cytokines RANKL and M- CSF at 50ng/mL at a density of 1x10 6 cells per well of 12-well culture plate. Medium was changed after three days. On day 6, cells were fixed and stained for TRAP according to the manufacturer s instructions (Sigma). Bone marrow-derived: Bone marrow stromal cells were isolated as above and resuspended in standard medium supplemented with 100ng/mL of M-CSF. After two days, medium was changed to standard medium supplemented with 50ng/mL M-CSF and 100ng/mL RANKL.

42 33 Antigen Host Company Catalogue ID ACTIN Rabbit Sigma-Aldrich A2066 BSP Rabbit Millipore AB1854 mrankl Mouse Abcam ab45039 OCN Rabbit Millipore AB10911 OCN Rabbit Santa Cruz Biotech., Inc. sc OPN Goat Abcam ab11503 Anti-goat IgG-HRP Donkey Santa Cruz Biotech., Inc. sc-2020 Anti-mouse IgG-HRP Goat Thermo Scientific LE Anti-rabbit IgG-HRP Goat Santa Cruz Biotech., Inc. sc-2004 Table 2.2 List of antibodies used in this study. Information regarding the antibody host, company of purchase and catalogue ID is included.

43 34 Bone resorption assays Artificial substrate assay: Osteoclasts isolated as above were plated onto Corning Osteo Assay Surface plates (Corning Inc., NY). Resorption area was measured using ImageJ (version 1.44p). Trabecular bone resorption assay: Trabecular bone isolated as above was crushed into fine pieces under liquid nitrogen, using a mortar and pestle. The bone chips were washed and sonicated in ice cold water for 4 times then transferred to ice cold 70% ethanol and stored at - 20 o C until use. Prior to use, the bone powder was washed 3 times with sterile water and incubated overnight in α-mem containing antibiotics solution (10X concentrations above). On the day of the experiment, the bone powder was washed with and then resuspended in osteoclastogenic medium (as above) and distributed into 96-well plates in excess. Bone marrow cells were plated on top of the bone chips, and cultured as above for osteoclast formation and resorption. Enzyme-linked immunosorbent assay (ELISA) OPG and TRANCE/RANKL in serum were assayed using a Quantikine M Murine OPG ELISA kit and a Quantikine M Murine TRANCE/RANKL ELISA kit (No.MOP00 and No.MTR00, R&D Systems, Minneapolis, MN), respectively following the manufacturer s directions. CTX-1 levels in serum was determined from fasted mice using Serum CrossLaps ELISA (RatLaps EIA No. AC-06F1, Immunodiagnostic Systems, Fountain Hills, AZ). Statistical analysis Results are presented as mean ± SD. Experiments were repeated at least three times. Statistical analysis was performed using GraphPad Software program InStat. Longitudinal analysis was analyzed by one-way analysis of variance (ANOVA). Unpaired t-test was used for direct comparisons between mutant and WT parameters; n values presented are independent biological samples.

44 Results Gja1 Jrt /+ mice have low bone mineral density (BMD) throughout life but improve with age and do not exhibit an old age-related decrease in bone mass At birth, Gja1 Jrt /+ mice were indistinguishable from their WT littermates in terms of size, but the syndactyly phenotype was evident by day 10. Consistent with our previous results from the phenotypic screen used to identify the Gja1 Jrt /+ founder (89), Gja1 Jrt /+ mice were markedly smaller than their WT littermates by 2 months of age, reflected in a lower body weight, and this persisted throughout life (data not shown). Gja1 Jrt /+ mice had significantly lower BMD at all ages studied compared to age-matched WT littermates, although differences between Gja1 Jrt /+ and WT mice became less pronounced with increasing age (Figure 2.1A); total body BMD reached maximal value by 4 months of age and plateaued thereafter in WT, but in Gja1 Jrt /+ mice, BMD continued to increase until at least 12 months of age (the oldest age quantified). Microcomputed tomography (microct) analysis revealed differences in age-related changes in bone parameters between the genotypes. The percent bone volume to tissue volume (BV/TV) at 2, 4 and 8 months was significantly lower in the trabecular bone of the distal femur of Gja1 Jrt /+ versus WT mice (Figure 2.1B), with the most striking difference at 4 months (after which BV/TV plateaued in Gja1 Jrt /+ mice) and no difference at 12 months (Figure 2.1C). At 2 months, the lower BV/TV in Gja1 Jrt /+ versus WT mice was due to decreased trabecular thickness (Tb.Th) alone, whereas at 4 and 8 months, both Tb.Th and trabecular number (Tb.N) were lower in the mutant bone (Figure 2.1C). Consistent with these observations, the structure model index (SMI) of Gja1 Jrt /+ femoral trabecular bone increased from 1.5 to 2.0 between 2 and 4 months of age reflecting a deterioration in the 3-dimensional structure of trabeculae from a more plate-like to a more rod-like structure. Whereas WT mice exhibited a typical age-related decrease in trabecular BV/TV after 4 months of age, Gja1 Jrt /+ mice did not. Gja1 Jrt /+ femurs were smaller than WT femurs at all ages, with significantly reduced total tissue, cortical bone and marrow areas (Figure 2.2A and B, Figure 2.3A). When normalized to total tissue area, femoral cortical bone area (Ct.Ar/Tt.Ar) was significantly reduced and marrow area (Ma.Ar/Tt.Ar) significantly increased in young (2-4 months) Gja1 Jrt /+ versus WT

45 36 mice, corresponding to reduced cortical bone thickness at 2 months in Gja1 Jrt /+. However, whereas WT cortical thickness remained constant throughout the age range studied (2-12 months), Gja1 Jrt /+ cortical thickness increased over time and by 8 months had surpassed that of WT, resulting in no significant difference in Ct.Ar/Tt.Ar or Ma.Ar/Tt.Ar between genotypes in older mice (Figure 2.2B). Gja1 Jrt /+ femurs were also significantly shorter than those of WT littermates at all ages (Table 2.3), however WT femurs reached maximum length by 4 months, and Gja1 Jrt /+ femurs by 8 months of age (data not shown). Mechanical testing for material and structural properties showed that Gja1 Jrt /+ bones were less tough, weaker (lower ultimate stress) and less stiff (lower Young s modulus) than WT bones at 2 and 4 months of age, but more ductile (higher failure strain) than WT at 2 months; no significant differences between genotypes were seen in the older mice. However, the structural properties (ultimate load, energy to failure and stiffness), which depend on the size and shape of the bone, were significantly decreased in Gja1 Jrt /+ versus WT femoral bones at all ages tested. The average polar moment of inertia (ability to resist torsion), which usually correlates with the width of the midshaft, was significantly decreased from 4 to 12 months in Gja1 Jrt /+ versus WT femurs (Table 2.3).

46 37 Figure 2.1 Longitudinal analysis of BMD and trabecular bone parameters. (A) Whole mouse BMD was significantly lower in Gja1 Jrt /+ versus WT mice at all ages tested. (B) Representative microct images of femurs of Gja1 Jrt /+ and WT mice. (C) Histomorphometric analysis of the distal metaphysis of femurs showed significantly lower trabecular bone volume, trabecular number and trabecular thickness in the Gja1 Jrt /+ versus WT mice up to 8 months of age, but no difference at 12 months. Solid and dashed lines indicate significant differences over time in WT and Gja1 Jrt /+ mice, respectively; n 6; *p < 0.05, **p < 0.01 and ***p <

47 38 Figure 2.2 Longitudinal analysis of cortical bone parameters. (A) Representative microct images of cross-sections of the distal femurs of Gja1 Jrt /+ and WT mice. (B) Histomorphometric analysis of the structural properties of the femurs showed significantly lower total tissue area in Gja1 Jrt /+ versus WT mice at all ages. Cortical bone of the distal femur of Gja1 Jrt /+ mice was thinner than WT at 2 months of age, but increased with age and was higher than that of WT littermates in older mice. Similarly, Ct.Ar/Tt.Ar was significantly decreased and Ma.Ar/Tt.Ar increased at 2 and 4 months of age in Gja1 Jrt /+ mice, but no difference at 8 and12 months; n 6. (C) Endosteal bone formation (BFR) and mineral apposition rate (MAR) were significantly lower at 2 months but not significantly different thereafter in Gja1 Jrt /+ versus WT mice. Mineralizing surface per bone surface (MS/BS) was not significantly different between genotypes at 2 to 4 months of age, but was significantly increased at 8 months in Gja1 Jrt /+ versus WT bones. (D) Endosteal osteoblast surface per bone surface (Ob.S/BS) and osteocyte number per bone area (Osy.N/BA) were not significantly different between Gja1 Jrt /+ and WT from 2 to 8 months of age; n 2. Solid and dashed lines indicate significant differences over time in WT and Gja1 Jrt /+ mice, respectively. *p < 0.05, **p < 0.01 and ***p <

48 39 Figure 2.3 Longitudinal analysis of cortical parameters. (A) Histomorphometric analysis of the structural properties of the femurs showed significantly decreased cortical bone area at all ages and decreased marrow area at 4-12 months in Gja1 Jrt /+ versus WT mice. Solid and dashed lines indicate significant differences over time in WT and Gja1 Jrt /+ mice, respectively; n 6. (B) There was no difference in the percentage of lacunae that were empty in the cortical bone of Gja1 Jrt /+ versus WT mice at 2 and 8 months of age; n 4. *p < 0.05, **p < 0.01 and ***p <

49 40 Test Age (months) Femoral Length ns 10% *** 5% ** 4% * Material Properties Ultimate Stress 51% ** 42% ** ns ns Failure Strain 44% ** ns ns ns Young's Modulus 65% ** 47% ** ns ns Toughness 29% ** 38% ** ns ns Femoral Neck Fracture Ultimate Load 28% ** 32% ** 32% ** 21% ** Energy to Failure 21% * ns ns 27% * Stiffness Ns 47% ** ns 17% * Failure Displacement Ns 23% * ns ns Structural Properties Ultimate Load 37% ** 42% ** 27% ** 20% ** Energy to Failure 23% * 41% ** 33% * 33% ** Stiffness 47% ** 41% ** 26% ** 17% ** Failure Displacement 21% ** ns ns ns Polar moment of inertia ns 55% *** 58% *** 46% *** Table 2.3 Longitudinal analysis of femoral length and mechanical-material properties of Gja1 Jrt /+ and WT mice are presented. Arrows indicate the direction of change of each parameter and the percentage difference in Gja1 Jrt /+ versus WT; n 6; ns= no significant differences between Gja1 Jrt /+ and WT samples, *p < 0.05, **p < 0.01 and ***p <

50 41 G60S is an activating mutation in Gja1 Jrt /+ osteoblasts and results in bone matrix with abnormally high levels of BSP Given the age-related abrogation of the osteopenia observed in the cortical and trabecular compartments of Gja1 Jrt /+ mice, we next assessed osteoblast and osteocyte numbers and activity. Gja1 Jrt /+ bones exhibited no evidence of changes to bone periosteal surfaces (data not shown) and there was no significant difference between genotypes in the number of osteoblasts per bone surface (data not shown), osteoblast surface per bone surface (Ob.S/BS), osteocyte number per bone area (Osy.N/BA) or number of empty lacunae in the cortical (Figure 2.2D, Figure 2.3B) or trabecular (Figure 2.4A) bone compartments. Mineral apposition rate (MAR) and bone formation rate (BFR) were highest in 2 month-old animals in both genotypes, but whereas no significant differences were seen between genotypes at any age tested in the trabecular compartment (Figure 2.4B), both MAR and BFR were significantly lower on the endosteal surface of cortical bones of younger (2 month-old) but not older Gja1 Jrt /+ versus WT mice (Figure 2.2C). Notably, whereas MAR and BFR significantly declined after 2 months on the WT endosteal surface, MAR significantly declined only by 8 months of age and BFR did not decline significantly in Gja1 Jrt /+. Also, mineralizing surface per bone surface (MS/BS) was not significantly different in Gja1 Jrt /+ versus WT, but by 8 months of age MS/BS was significantly higher in Gja1 Jrt /+ cortical bone, reflecting a decrease with age in WT but not Gja1 Jrt /+ bones. Expression of early-, mid- and late-osteoblast and osteocyte markers was not different in cortical bone, with the exception of lower expression of the osteocyte marker Sost in 2 month-old but not other ages of Gja1 Jrt /+ versus WT mice (Figure 2.5). However, whereas Sost expression was unaffected in trabecular bone, expression of most osteoblast-associated genes, including Runx2, Osx, Alp, Col1a1, Bsp, Ocn and Phex, was increased in Gja1 Jrt /+ versus WT trabecular bone at all ages (4 month-old bones shown; Figure 2.4D). Similarly, serum ALP, a bone formation marker, was also significantly elevated at 4, 8 and 12 months of age in Gja1 Jrt /+ compared to WT mice (Figure 2.4C).

51 42 Figure 2.4 Longitudinal analyses of trabecular osteoblast parameters and activity. Dynamic histomorphometry and histochemistry on the femoral bones of Gja1 Jrt /+ and WT littermates showed (A) osteoblast surface per bone surface (Ob.S/BS) and osteocyte number per bone area (Osy.N/BA) were not significantly different between Gja1 Jrt /+ and WT trabecular bone; n 6. (B) Mineral apposition rate (MAR), mineralizing surface to bone surface (MS/BS), and bone formation rate (BFR) were not significantly different in Gja1 Jrt /+ versus WT mice; n 4. (C) Serum concentration of ALP was significantly increased in Gja1 Jrt /+ versus agematched WT mice from 4 to 12 months of age; n 6. (D) Expression of osteoblast-associated markers in RNA isolated from the trabecular bone of 4 month-old mice was significantly increased in Gja1 Jrt /+ versus WT mice. Expression of the osteocyte-associated marker, Sost, was not different between genotypes. n 4; samples were run in triplicate. *p < 0.05, **p < 0.01 and ***p <

52 43 Figure 2.5 Analysis of osteoblast and osteocyte-specific genes in cortical bone extracts. (A) Expression of early-, mid- and late-osteoblast and osteocyte differentiation markers were unaffected in RNA isolated from cortical bone of 2, 4, 8 and 12 month old mice, with the exception of decreased Sost expression at 2 months in Gja1Jrt/+ versus WT mice; n 3 and each sample is comprised of two or more independent biological samples. Samples were run in triplicate. *p < 0.05, **p < 0.01 and ***p <

53 44 G60S was also an activating mutation for stromal cell colony-forming efficiency in vitro, as evidenced by the significant increase in stromal progenitor populations isolated from the Gja1 Jrt /+ versus WT bone marrow (CFU-fibroblast (CFU-F), CFU-ALP or CFU-osteoblast (CFU-O)) (Figure 2.6A). Neither stromal cell proliferation nor the sizes of individual colonies and bone nodules, ALP area/cfu-alp and mineralized area/cfu-o, was significantly different between genotypes (data not shown). Expression patterns of osteoblast-associated differentiation markers in cultured stromal cells harvested at day 8, 11, 14 and 19, corresponding roughly to the proliferation, differentiation, maturation-early mineralization and late mineralization stages, were not different between genotypes during the proliferation or early differentiation stages. However, at later maturational and late mineralization stages, most osteoblast-associated markers were more highly expressed in Gja1 Jrt /+ bone marrow stromal cultures (Figure 2.6B). Protein extracts isolated from both trabecular bone (Figure 2.6C) and from mineralized nodules of end point cultures (Figure 2.6D) showed that the matrix produced by Gja1 Jrt /+ osteoblasts contained strikingly elevated levels of BSP compared to WT matrix although levels of other matrix proteins, such as osteopontin (OPN) and OCN, were normal. Gja1 Jrt /+ osteoclast number and activity are increased in vivo, but not in vitro No differences were found in the expression of osteoclast differentiation and fusion markers, including nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1 (Nfatc1), calcitonin receptor (CalR), tartrate-resistant acid phosphatase (Trap), and osteoclast associated receptor (Oscar) as assessed by quantitative RT-PCR (QPCR) of RNA isolated from bones of the two genotypes (Figure 2.7C). However, several observations suggested that mutant osteoclasts were more active in vivo than their WT counterparts in younger mice.

54 45 Figure 2.6 Effect of the Gja1 Jrt mutation on osteoprogenitors, osteoblasts and bone matrix composition. (A) The number of CFU-F, CFU-ALP, and CFU-O was higher in bone marrow stromal cell cultures Gja1 Jrt /+ mice cultured under osteogenic conditions; values are normalized to WT; n = 3. (B) RNA was isolated at four time points throughout proliferation-differentiation in the osteogenic stromal cultures. Expression of osteoblast-associated markers was higher at late differentiation-maturation stages in cultures of bone marrow stromal cells from 2 monthold Gja1 Jrt /+ mice; n = 3; samples were run in triplicate; shown is a representative experiment. (C) The ratio of BSP to OPN was increased in the trabecular bone matrix proteins of Gja1 Jrt /+ versus WT mice. OPN was not significantly different between genotypes. n 3; shown are representative blots. A nonspecific band of approximately 37kDa located below the 45kDa ACTIN band is an artifact of the extraction procedure and was not used in quantification (See also Methods). (D) OCN was unchanged but BSP was significantly increased in endpoint bone marrow stromal cell cultures containing mineralized nodules, from Gja1 Jrt /+ versus WT mice; n 3, shown are representative blots. # p < 0.1, *p < 0.05, **p < 0.01 and ***p <

55 46 Figure 2.7 Expression of Rankl-Opg and osteoclast-specific gene expression in Gja1 Jrt /+ versus WT mice. (A) The Rankl/Opg expression ratio in RNA extracted from cortical bone at all ages was unaffected in Gja1 Jrt /+ versus WT; n 3 and each sample is comprised of two or more independent biological samples. (B) Rankl/Opg expression ratio was also unaffected in trabecular bone at 2 and 4 months of age; n 4. (C) Expression of osteoclast differentiation and fusion markers was unaffected in RNA from trabecular bone of 2 and 4 month-old Gja1 Jrt /+ versus WT mice; n 3. Samples were run in triplicate. *p < 0.05, **p < 0.01 and ***p <

56 47 First, osteoclast surface per bone surface (Oc.S/BS) was significantly increased at 2 months in both cortical and trabecular compartments in Gja1 Jrt /+ versus WT femurs (Figure 2.8A), increases that were no longer detectable in 4 month or older mice; indeed, in cortical bone, Oc.S/BS was significantly decreased with age in Gja1 Jrt /+ versus WT. Second, expression of Cathepsin K, an osteoclast activity marker, was increased at 2 (p=0.061) and 4 (p=0.008) months of age in Gja1 Jrt /+ versus WT bone (trabecular bone shown; Figure 2.8B). Finally, although there was no significant difference between genotypes at any of the ages examined, the serum concentration of a resorption marker, the C-telopeptide fragment of collagen type I (CTX-1), remained level in Gja1 Jrt /+ mice whereas in WT serum it declined significantly with increasing age (Figure 2.8C). To determine whether these differences were cell autonomous, osteoclast cultures derived from both spleen and bone marrow of mice at 2 (Figures 2.8D), 4, 8, and 12 (data not shown) months of age were cultured in the presence of RANKL and M-CSF and evaluated for osteoclast differentiation and activity. No significant differences were found in vitro in osteoclast number, size (number of nuclei) or resorption activity between Gja1 Jrt /+ and WT cells irrespective of mouse age. Age-related changes in the RANKL/OPG axis exacerbate or abrogate respectively a BSPinduced increase in osteoclastogenesis and osteoclast bone resorption in younger versus older Gja1 Jrt /+ mice Taken together, the data suggest that G60S is an osteoblast autonomous and osteoclast nonautonomous Cx43 activating mutation in Gja1 Jrt /+ bone, leading us to investigate the basis of the activation of Gja1 Jrt /+ osteoclasts. We showed previously that in Bsp-/- mice, bone resorption is diminished, resulting in mice with increased trabecular bone volume (16). We therefore asked whether the abnormally high levels of BSP in Gja1 Jrt /+ bone contributed to increased bone resorption in Gja1 Jrt /+ mice by plating WT osteoclasts onto bone fragments generated from WT, Gja1 Jrt /+, Bsp+/+ (WT littermates of Bsp-/- mice) and Bsp-/- mice. WT osteoclasts exhibited significantly higher resorption activity, assessed via CTX-1 concentration in cell culture medium, when plated onto Gja1 Jrt /+ mouse bone fragments than on WT. Conversely, osteoclasts

57 48 Figure 2.8 Gja1 Jrt /+ osteoclast number and activity are increased in young mice in vivo, but not in vitro. (A) Endosteal and trabecular osteoclast surface per bone surface (Oc.S/BS) were significantly increased in 2 monthold Gja1 Jrt /+ versus WT mice. Endosteal Oc.S/BS was significantly decreased in 4 and 8 month-old Gja1 Jrt /+ versus WT mice; n 3. (B) Cathepsin K expression was increased in RNA from trabecular bone of 2 and 4 month-old Gja1 Jrt /+ versus WT mice; n 2; samples were run in triplicate. (C) Bone resorption, assessed by serum concentrations of CTX-1 fragments, declined significantly after 2 months of age in WT but not Gja1 Jrt /+ mice; n 3. Solid and dashed lines indicate significant differences over time in WT and Gja1 Jrt /+ mice, respectively. (D) The number of bone marrow-derived osteoclasts (TRAP-positive) and osteoclast activity (resorbed areas (dark patches) on artificial substrate) in vitro was not significantly different in Gja1 Jrt /+ versus WT bone marrow cells cultured with RANKL and M-CSF. Shown are the results from cells isolated from 2 month old mice; n 3; # p < 0.1, *p < 0.05, **p < 0.01 and ***p <

58 49 had lower resorption activity when plated onto Bsp-/- bone fragments than when plated onto Bsp+/+ strain-matched bone fragments (Figure 2.9A). This finding was further supported by QPCR expression analyses which showed that WT osteoclasts plated onto Gja1 Jrt /+ bone fragments had a significantly increased expression of Cathepsin K over those plated onto WT bone fragments (Figure 2.9B). The finding that the osteopenic phenotype is present early and at first worsens precipitously at 4 months but then becomes less pronounced in older mutant mice relative to WT, despite the fact that BSP over-production is sustained throughout the lifespan of Gja1 Jrt /+ mice, prompted us to examine the OPG/RANKL signaling system at different ages. Although there was no difference between genotypes in the Rankl/Opg gene expression in either cortical or trabecular bone (Figure 2.7A, B respectively), in trabecular bone, mbrankl significantly increased from 2 to 4 months of age in Gja1 Jrt /+ (2.4-fold change; p=0.02) consistent with the dramatic decline in bone volume from 2 to 4 months, whereas there was no age-related change in mbrankl in WT samples (Figure 2.9C). In older mice (8 month old), relative serum concentrations of OPG were higher in the mutant compared with that in the WT mice, an observation not found in younger mice (2 month old), whereas serum concentrations of RANKL were similar between the genotypes at both ages (Figure 2.9D). The increased OPG, along with unchanged RANKL, in older Gja1 Jrt /+ versus WT mice may thus contribute to the relative protection of the older Gja1 Jrt /+ mice against a further age-related decrease in BMD.

59 50 Figure 2.9 The abnormal bone matrix produced by Gja1 Jrt /+ mice promotes bone matrix resorption. Bone marrow cells were plated on trabecular bone chips, and cultured for osteoclast formation and resorption. (A) CTX-1 concentration in supernatant of WT osteoclast cultures plated onto either WT, Gja1 Jrt /+, Bsp+/+ or Bsp-/- bone fragments. CTX-1 was higher in the supernatant of WT osteoclasts plated onto Gja1 Jrt /+ versus WT bone fragments, and lower in the supernatant of WT osteoclasts plated onto Bsp-/- versus Bsp+/+ bone fragments; n = 5. (B) QPCR analysis showed increased Cathepsin K expression in osteoclasts plated on Gja1 Jrt /+ versus WT bone fragments; n = 5; samples run in triplicate. The Gja1 Jrt mutation affects the RANKL/OPG signaling pathway. (C) In trabecular bone, mbrankl significantly increased from 2 to 4 months in Gja1 Jrt /+, whereas mbrankl was unchanged over time in WT samples. Shown is one representative blot; n = 3. (D) Serum concentrations of RANKL and OPG in WT versus Gja1 Jrt /+ in young (2 month) and old (8 month) mice. Serum OPG was significantly increased in older Gja1 Jrt /+ mice versus WT; n 4. *p < 0.05, **p < 0.01 and ***p <

60 Discussion Gja1 Jrt /+ mice, which carry a G60S missense mutation in Cx43, express less than 50% of WT levels of Cx43 and have markedly reduced gap junction formation and function in osteoblasts and other Cx43-expressing cell types (89,95). Like other Cx43 mutants with loss or reduction in Cx43 gap junction formation and or function, Gja1 Jrt /+ mice exhibit early onset osteopenia and changes in the structural and biomechanical properties of bone, and like G138R Cx43 missense mutation knockin (+/G138R) mice, exhibit the classical features of human ODDD (89). We report here a longitudinal study of Gja1 Jrt /+ mutant mice, which recapitulate some phenotypic traits of other Cx43 loss-of-gap junction function models, but also exhibit novel and age-related bone phenotypes, and we show that the mechanism underlying the osteopenia in these mice results from activation of osteoblast activity, which also protects mice from further old age-related bone loss. G60S is unique in being an osteoblast autonomous activating mutation Several Cx43 mutant mouse models have been described previously, including a global Cx43 deletion (77), conditional-deletion of Cx43 in bipotent osteo-chondroprogenitors (DM1Cre) (78), osteoblasts (Col1a1Cre) (80), mature osteoblasts-ostecytes (OcnCre) (85,87), and osteocytes (Dmp1Cre) (87,88), and a mutant Cx43 knockin (+/G138R) (91). In all these cases except the Dmp1Cre-osteocyte-specific Cx43 deletion (87,88), a reduction in Cx43 gap junction formation and/or function resulted in mice that displayed varying degrees of osteopenia, as seen also in the Gja1 Jrt /+ model. The early osteopenic phenotype has usually been attributed to a reduction in osteoblast number and/or function and/or changes in RANKL/OPG signaling that increase osteoclast formation and activity; differences in the different models have been attributed to different consequences of loss of Cx43 function in less or more mature progenitor or osteoblastosteocyte populations. We report that the G60S mutation does not abrogate but instead activates osteoblast function in appendicular bones and in stromal populations as manifested by increases in MAR-BFR-MS/BS, and increased expression of many osteoblast-associated genes and increased production of BSP, mbrankl, OPG and ALP proteins. It should also be noted that while a previous study suggested that terminal differentiation is diminished in neonatal G60S

61 52 calvarial osteoblast cells in culture (based on lower Bsp and Ocn expression versus WT cells) (95), our studies showed that Gja1 Jrt /+ calvarial cells are indistinguishable from WT cells in vitro with regards to ALP production, mineralization, and expression of osteoblast-associated markers tested including Bsp and Ocn (data not shown). The reasons for the discrepancies are unclear but may include differences in cell isolation, culturing conditions, and/or mouse strain variations resulting from independent breeding of successive generations. In addition to increased osteoblast activity, mesenchymal progenitor and osteoprogenitor numbers were also increased in stromal cells isolated from Gja1 Jrt /+ compared to WT mice, thus suggesting a role for Cx43 in stromal cell commitment, maintenance of precursor populations, and/or controlling the overall subpopulation make-up of the stroma. It was recently reported that mesenchymal and osteoblastic progenitors were increased in the bone marrow of Col1a1Cre;Cx43 flox/flox mice relative to WT littermates (82) ; the increases were attributed to downregulated expression of Sost, a factor that prevents mesenchymal stem cell (MSC) proliferation (141). Similarly, osteoblast activity was reported to be increased in Dmp1Cre-Cx43 ablated mice also as a consequence of downregulation of SOST due to increased apoptosis of osteocytes (87). However, we found no evidence for increased osteocyte apoptosis, altered osteocyte number or altered number of empty lacunae at any age in cortical or trabecular bone compartments, or for altered Sost expression in cortical and trabecular bone in Gja1 Jrt /+ versus WT, with the exception of a decrease in Gja1 Jrt /+ cortical bone at 2 months; similarly, Sost expression was increased at later differentiation stages in Gja1 Jrt /+ stromal cell cultures, consistent with the increased osteoblastogenesis observed. Additionally, in Gja1 Jrt /+ cells, proliferation rates and self-renewal capacity in vitro were unchanged (data not shown). It remains to be determined what other factors affect the MSC microenvironment, but we previously reported biphasic expression of BSP during mesenchymal cell differentiation, with early upregulated or primed expression of BSP in very primitive osteoprogenitors (142), suggesting that BSP overexpression in Gja1 Jrt /+ mice may be a factor contributing to MSC commitment. Further studies are ongoing to dissect how the G60S mutation elicits this effect specifically on stromal progenitor populations, but altered response to mechanical loading and hormonal signals may also play roles (see below). In contrast to osteoblasts, the G60S mutation had no detectable cell autonomous effect on osteoclasts. This is consistent with previous studies on Cx43-deficient mice in which changes in

62 53 the RANKL/OPG ratio (increased osteocyte-derived Rankl/Opg mrna ratio in OcnCre;Cx43 fl/fl mice (85), decreased Opg mrna levels in DM1Cre;Cx43 -/fl osteoblasts (78), and decreased OPG expression by osteocytes in DMP1Cre;Cx43 fl/fl mice (87) ) have been reported to underlie the increased osteoclastogenesis and bone resorption and contribute to the osteopenia and/or altered bone structure in these mutants. We found no evidence to suggest that the Rankl/Opg changes were specific to changes in expression by osteocytes, as evidenced by no significant difference in Rankl/Opg in mutant versus WT cortical bone. However, we did find an osteoblast-dependent upregulation of osteoclast activity in Gja1 Jrt /+ mice due to changes in the RANKL/OPG signaling axis, with increased mbrankl protein but normal levels of serum OPG in young Gja1 Jrt /+ mice, concomitant with increased osteoclast number and activity, phenotypic traits that changed with aging (see below). It is also important to consider that the Gja1 Jrt /+ osteoclasts may be affected by changes in RANKL/OPG expression by other G60S Cx43-expressing cells that are not in the osteoblast lineage, such as stromal cells, fibroblasts (143) or activated T-cells (144). Gja1 Jrt /+ is the first Cx43 mutant mouse in which unusually high levels of matrix BSP have been reported and linked to increased osteoclast activity Although gene expression of most osteoblast-associated markers was upregulated, only BSP content and not that of other osteoid proteins (e.g., OPN, OCN) was increased in the trabecular bone matrix and mineralized nodules of stromal cultures of Gja1 Jrt /+ compared to WT mice. Whether this is due to preferential degradation of matrix proteins other than BSP, more robust sequestration of BSP into the bone matrix, or other possibilities, is currently not known. Additionally, this does not preclude the possibility that the content of other untested matrix proteins may be altered, contributing to the abnormal composition and enhanced resorption rate of the Gja1 Jrt /+ bone matrix. In any case, the in vitro resorption assay we developed indicated that the abnormal composition of the Gja1 Jrt /+ bone matrix was a significant factor in Gja1 Jrt /+ osteopenia, with high BSP promoting high resorption. RANKL and human recombinant BSP were shown to act synergistically to induce osteoclastogenesis and bone resorption in vitro (145). We have also reported that Bsp-/- mice, in contrast to the Gja1 Jrt /+ mice, had higher trabecular bone density and lower bone turnover (16). Similarly, many histological features of the Gja1 Jrt /+

63 54 skeleton correlate with observations in BSP-overexpressing CMV-BSP transgenic mice, which display a decrease in trabecular bone due to an increased Oc.S/BS (146). Thus, from both our in vivo analyses of young Gja1 Jrt /+ bones and in vitro resorption assays testing the Gja1 Jrt /+ bone matrix, we conclude that the decrease in Gja1 Jrt /+ bone volume results from increased osteoclastogenesis and bone resorption at least in part in response to increased matrix BSP. No other studies have yet reported a bone matrix containing abnormal levels of bone proteins in Cx43 mutant mice (77,80,85,91), however, we predict that the disordered collagen bundles recently reported in cortical bone matrix of DM1Cre;Cx43 -/fl mice (78) and the decreased mineralization of the femoral diaphysis in DMP1Cre;Cx43 fl/fl mice (88) may reflect abnormal content of the non-collagenous proteins, in particular BSP. This may also be a factor in the recently reported OCNCre;Cx43 fl/- mice, in which reduced quality of the bone matrix and its decreased material properties were linked to improper maturation of collagen cross-links (88) (decreased fraction of non-reducible to reducible collagen cross-links) in the cortical bone matrix. We also suggest that matrix anomalies, in particular changes in BSP, may contribute to the alteration in the osteogenic BM niche recently reported in Col1a1Cre;Cx43 fl/fl mice (82). Taken together, the data indicate a need for additional analysis of the matrix in various Cx43 mutant mouse lines and the role of matrix anomalies, i.e., niche anomalies, in both altered osteoclast and altered osteoblast activities. Gja1 Jrt /+ mice are protected from old age-related diminution in BMD and exhibit age-related improvement in femoral bone structural and material parameters While many phenotypic traits are seen in the Gja1 Jrt /+ mouse model that parallel those reported in various other Cx43 mutant mouse models, some traits are unique, including certain phenotypic changes with aging and the underlying mechanisms. For example, lower BMD versus WT controls has been reported in almost all Cx43 mutant models with loss of gap junction function, and low BMD, where observed, persists up to at least 12 months of age (78,80,85,91), as it does in Gja1 Jrt /+ mice. Similarly to what has been described for DM1Cre;Cx43 /fl and DM1Cre;Gja1 +/fl(g138r) mice (78), the greatest difference in Gja1 Jrt /+ versus WT BMD was seen at younger ages. Notably, however, no significant difference in trabecular parameters (BV/TV, Tb.N and Tb.Th) was seen in 12 month-old Gja1 Jrt /+ versus WT femurs, and Gja1 Jrt /+ femoral

64 55 cortical thickness surpassed that of age-matched WT bones by 8 months of age. Corresponding age-related changes in the structural and material properties of Gja1 Jrt /+ long bones were also seen. Thus, similar to observations made in DM1Cre, Col1a1Cre, OcnCre and Dmp1Cre Cx43- conditionally deleted mice (78,79,81,83,85,87,88), Gja1 Jrt /+ femurs exhibited reduced structural and material properties versus WT at younger ages. Gja1 Jrt /+ bone material quality improved in older mice, although the structural properties remained lower versus WT, most likely because the Gja1 Jrt /+ femoral total tissue cross-sectional area remained smaller than WT throughout life. This is in contrast to what is seen in OcnCre;Cx43 fl/- and DMP1Cre;Cx43 fl/fl mice, where structural parameters were unaffected even though material properties were reduced, presumably because the benefit of the increased femoral cross-section off-set the lower bone quality in these mutants (88). To our knowledge, Gja1 Jrt /+ is the only mouse model in which loss of gap junction function leads to increased cortical thickness with age, and age-related elimination or abrogation of the reduced cortical thickness, increased marrow space and reduced material properties compared to that observed in younger Gja1 Jrt /+ mice versus WT. In most Cx43 conditionaldeletion models, changes in the cortical parameters and bone geometry reflect increased endocortical resorption and increased or unaffected periosteal bone formation (78,79,81,83,85,87,88). In contrast, in Gja1 Jrt /+ mice, cortices in younger (2 month-old) are thinner due to decreased bone formation and increased bone resorption on the endosteal surface, with no detectable change in periosteal parameters. The correction of the cortical bone and marrow area proportions and thickening of the cortical bone in older Gja1 Jrt /+ mice results from a significant decrease in endosteal bone resorption hand-in-hand with maintenance of endosteal bone formation and mineralization parameters higher than those seen in WT at the same ages. Our data suggest an age-related switch in the Rankl-Opg signaling mechanism, with increased mbrankl and increased resorption in younger Gja1 Jrt /+ mice, followed by increased serum OPG in older mice reducing bone resorption, allowing cortical and trabecular bone thickness to increase over time. As already mentioned, the changes in Gja1 Jrt /+ mice do not appear to reflect changes in osteocyte-specific changes in either Rankl-Opg signaling or Sost expression. In addition to age-related effects on osteoclasts and resorption, expression of osteoblastassociated genes is higher in Gja1 Jrt /+ versus WT mice at all ages tested and up to at least one year; amongst upregulated genes was ALP which would be expected to contribute to increased

65 56 total mineral deposition, and increases in BMD with age. An expanded osteoprogenitor population, as seen in Gja1 Jrt /+ versus WT stromal cell cultures, presumably contributes to maintenance if not expansion of the bone itself in older Gja1 Jrt /+ mice; an increased capacity to generate active osteoblasts could contribute to the lack of further decreases in BMD, Tb.N and BV/TV and increased cortical thickness seen in aging Gja1 Jrt /+ mice. The age-related changes in the Gja1 Jrt /+ bone phenotype may arise as a consequence of age-related changes in Cx43 gap junction formation and/ or function, altered responsiveness to mechanical load or hormonal and molecular signals, skeletal site-specific differences in sensitivity to disruption of Cx43, and/or other factors. Recently, for example, Cx43 deficiency has been shown to result in an increased responsiveness to mechanical load (79,85), with several studies demonstrating that cells from different skeletal locations are differentially sensitive to loss of Cx43, particularly within the endocortical and periosteal surfaces of the cortical bone (78,85,87). Specifically, in response to mechanical loading, DM1Cre;Cx43 fl/fl mice displayed an increased periosteal, but decreased endocortical (BFR) response (79), Col1a1Cre;Cx43 -/fl mice a decreased endocortical (BFR) response (81), and OcnCre;Cx43 -/fl mice both enhance periosteal and endocortical (BFR) response versus WT (79,85). After loading, DM1Cre;Cx43 fl/fl also experienced a significant increase in trabecular BV/TV, an effect not seen in WT mice (79). Interestingly, Llyod et. al. very recently showed that after unloading via hind limb suspension, OcnCre;Cx43 -/fl mice experienced an attenuated response (less of a decline in trabecular bone parameters and no suppression of periosteal and endosteal bone formation) versus WT. Other recent studies in rat stromal and osteoblastic cells have indicated that Cx43 gap junction formation (123) and the capacity for gap junction intercellular communication in response to a hormonal signal (PTH) (124) is significantly decreased as a function of age. Whether and how the G60S mutation in Cx43 alters responses to hormonal or mechanical stimuli remains to be determined, but the differences observed in the Gja1 Jrt /+ versus other loss-of-function bone phenotypes support the view that the mechanisms are multifactorial and, reflect a complex summation of positive and negative effects across the diversity of bone cell populations and maturational stages affected (77-83,85-87,91). In summary, we report that the G60S mutation results in a cell autonomous activation of the osteoblast population and further link the resulting production of abnormally high matrix levels of BSP protein to increased osteoclastogenesis and bone resorption (summary Figure

66 ). Our results also show that the G60S mutation, unlike Cx43 knockout mutations, exerts a significant age-related enhancement of trabecular and cortical bone volume and quality.

67 58 Figure 2.10 The cellular and molecular age-related changes that occur in the bone microenvironment. Both the cellular (osteoblast bone formation and osteoclast bone resorption) and molecular (RANK/RANKL/OPG signaling, ALP/BSP matrix molecules) age-related changes that occur in the bone microenvironment of WT (upper panel) and Gja1 Jrt /+ (lower panel) mice are depicted. In young WT mice, osteoblast activity is greater than or equal to osteoclast activity, allowing for bone formation/growth and healthy bone turnover/remodelling. Osteoblasts express ALP and secrete bone matrix proteins, such as BSP, that are incorporated into the extracellular matrix, and chemokines such as RANKL (both membrane bound (mbrankl) and secreted forms) and OPG. RANKL binds to RANK receptor, on the surface of osteoclasts promoting their differentiation and activity (147,148), while OPG, the decoy receptor, prevents these ( ). As osteoclasts resorb bone, matrix molecules are released into the surrounding microenvironment, including BSP which works synergistically with RANKL to promote osteoclastogenesis and bone resorption (145). As WT mice age, osteoclast resorptive activity surpasses that of osteoblast bone formation, which results in age-related bone loss. In young Gja1 Jrt /+ mice, both osteoblast and osteoclast activity is upregulated, however bone resorption exceeds bone formation to result in early-onset high turnover osteopenia. Mutant osteoblasts overexpress mbrankl and produce an abnormal matrix that is high in BSP content leading to excessive bone resorption. In old Gja1 Jrt /+ mice, an upregulation of serum OPG reduces the effects of RANKL on the osteoclast population and increased serum ALP levels indicate an increase in bone formation, both of which provide protection against further old age-related bone loss in Gja1 Jrt /+ mice.

68 59 Chapter 3 Upregulation of BMP2/4 signaling increases both osteoblastspecific marker expression and bone marrow adipogenesis in Gja1 Jrt /+ stromal cell cultures The work presented in Chapter 3 is published as: Upregulation of BMP2/4 signaling increases both osteoblast-specific marker expression and bone marrow adipogenesis in Gja1 Jrt /+ stromal cell cultures Tanya Zappitelli 1, Frieda Chen 2 and Jane E. Aubin 1,2,3 1 Department of Medical Biophysics and 2 Department of Molecular Genetics, University of Toronto, 1 King's College Circle, Toronto, Ontario M5S 1A8, Canada, 3 Centre For Modeling Human Disease, Samuel Lunenfeld Research Institute, Mount Sinai Hospital, 600 University Avenue, Toronto, Ontario M5G 1X5, Canada. Mol Biol Cell Mar 1;26(5): Author Contributions: Study design and conduct: TZ, FC and JEA. Data collection: TZ and FC. Data analysis: TZ and FC. Data interpretation: TZ, FC and JEA. Drafting the manuscript: TZ and JEA. Revising manuscript content and approving final version of manuscript: TZ, FC and JEA. TZ, FC and JEA take responsibility for the integrity of the data analysis.

69 Abstract Gja1 Jrt /+ mice carry a mutation in one allele of the gap junction protein, alpha 1 gene (Gja1), resulting in a G60S Connexin 43 (Cx43) mutant protein that is dominant negative for Cx43 protein production of less than 50% of wild type (WT) levels and significantly reduced gap junction formation and function in osteoblasts and other Cx43-expressing cells. Earlier we reported that Gja1 Jrt /+ mice exhibited early-onset osteopenia caused by activation of osteoclasts secondary to activation of osteoblast lineage cells, which expressed increased RANKL and produced an abnormal resorption-stimulating bone matrix, high in BSP content. Gja1 Jrt /+ mice also displayed early and progressive bone marrow atrophy, with a significant increase in bone marrow adiposity versus WT littermates but no increase in adipose tissues elsewhere in the body. BMP2/4 production and signaling were increased in Gja1 Jrt /+ trabecular bone and osteogenic stromal cell cultures, which contributed to the upregulated expression of osteoblast-specific markers (e.g. Bsp and Ocn) in Gja1 Jrt /+ osteoblasts and increased Pparg2 expression in bone marrow-derived adipoprogenitors in vitro. The elevated levels of BMP2/4 signaling in G60S Cx43-containing cells resulted at least in part from elevated levels of camp. We conclude that upregulation of BMP2/4 signaling in trabecular bone and/or stromal cells increases osteoblastspecific marker expression in hyperactive Gja1 Jrt /+ osteoblasts, and may also increase bone marrow adipogenesis by upregulation of Pparg2 in the Cx43-deficient Gja1 Jrt /+ mouse model. 3.2 Introduction Gap junctions and hemichannels mediate cellular communication by allowing the passage of small molecules and ions (e.g. ATP, Ca 2+, IP3, camp) directly between cells and between cells and their extracellular environment, respectively (153,154). Cx43, one member of the large connexin protein family, is the major gap junctional protein found in bone, and is expressed by osteoblasts, osteocytes (66,106) and bone marrow stromal cells (including osteoblast and adipocyte precursors) (72). Other members of the connexin protein family expressed in bone are Cx45 (73), Cx46 (74,155) and Cx37 (75,76), although their expression is much lower than that of Cx43. In bone,

70 61 Cx43 is important in mediating hormonal and molecular signals (80,85,86), fracture repair (84), mechanical loading (79,81,85), and controlling the subpopulation makeup of the stroma (82). Cx43 gap junction function is critical to the processes of osteoblast and osteocyte differentiation and activity, bone formation and maintenance, and has been studied extensively through the generation of Cx43 knockout (77), conditionally-deleted (78,80,82,85,88), and pointmutation mutant mice (89,91,156), and by overexpression of mutant Cx43 proteins in cell lines (95). The role of Cx43 in adipocytes and adipogenesis is less well studied. However, it has been reported that functional Cx43 gap junctions are present and required for mitotic expansion and C/EBPbeta expression in pre-adipocytes (157), and that levels of Cx43 protein and gap junction formation and function are downregulated during adipocyte differentiation ( ). In addition to the important role of Cx43 channels in transport of signaling molecules, Cx43 has been shown to interact with intracellular structural and signaling molecules to modulate cellular signaling activities. For instance, Cx43 proteins have been proposed and/or shown to interact with Src kinase to activate ERKs in response to bisphosphonate-mediated cell survival signaling (110), with β-arrestin in response to PTH survival signaling (111), and with protein kinase C-delta during FGF2 signaling (112). Cx43 has also been proposed to physically interact with β-catenin (116), although its involvement in Wnt and BMP signaling pathways remains unknown. Loss or disruption of Cx43 gap junctions and hemichannels in cells early in the osteogenic lineage has been reported to impair osteoblast differentiation, bone formation and mineralization activities in various mouse models (77,78,80,95). However, in Gja1 Jrt /+ mice, in which a dominant negative G60S Cx43 mutation results in a significant (over 50%) reduction of Cx43 protein production, phosphorylation and gap junction formation and function in osteoblasts (95) and other cell types (89), we recently showed that osteoblast differentiation and function are not decreased, but are instead activated (156). In particular, we found that Gja1 Jrt /+ osteoblasts overexpress many osteoblast-associated genes, including Bsp, and deposit an abnormal resorption-stimulating bone matrix high in BSP content. In addition to its novel osteoblast phenotype, Gja1 Jrt /+ is the only Cx43 mutant mouse model with a reported change in bone marrow adipogenesis, leading to progressive bone marrow atrophy beginning at 17 weeks of age (89).

71 62 We now report that the G60S Cx43 mutation increases the expression level of osteoblastspecific markers in the osteoblasts by upregulation of BMP2/4 production and signaling, and that the increased BMP production by activated osteoblasts and/or stromal cells may also upregulate Pparg2 expression leading to increased bone marrow adipogenesis. 3.3 Materials and Methods Animals and Ethics Statement Gja1 Jrt /+ mice were generated as previously described (156). The studies reported here were done on male Gja1 Jrt /+ and WT littermates between 2 and 4 months of age. All experimental procedures were performed in accordance with protocols approved by the Canadian Council on Animal Care and the University of Toronto Faculty of Medicine and Pharmacy Animal Care Committee. Body Composition Dual energy x-ray absorptiometry (PIXImus, Lunar Corp., Madison, WI, USA) was used to measure body composition (% fat, lean tissue mass) on the whole body (excluding the head). Immunocytochemistry Mouse embryonic fibroblasts cultured on glass coverslips were permeabilized in 1%Triton X- 100 in phosphate buffered saline (PBS), washed in PBS, blocked in 2% fetal bovine serum (FBS)-PBS, incubated with rabbit anti-cx43 (Invitrogen Corporation, Carlsbad, CA, USA) diluted 1:200 in PBS at room temperature for 2 hours, washed in PBS, incubated in Alexa Fluor goat anti-rabbit IgG (Molecular Probes, Inc., Eugene, OR, USA), washed in PBS and then stained with 1mg/mL Hoechst diluted 1:1000 in PBS for 5 minutes at room temperature. Coverslips were mounted and stored at 4 o C overnight. Cells were imaged on a Leitz Dialux 20 microscope with fluorescence and camera attachments (Leitz, Inc., Rockleigh, NJ, USA). Histochemistry The right femur fixed in 4% paraformaldehyde (PFA) was embedded in a mixture of methyl methacrylate (MMA) and glycolmethacrylate (GMA) and 5 µm sections were stained with

72 63 hematoxylin and eosin stain (134). Images were captured and analysed using a Bioquant Osteoimager and Bioquant Osteo 2012 (BIOQUANT Image Analysis Corporation, Nashville, TN, USA). Isolation of Bone Marrow Cells Bone marrow cells were isolated from resected tibia and femora, using a modification of a previously published method (137). Cells were plated in α-mem supplemented with 10% heatinactivated FBS and antibiotics (100µg/mL penicillin, 1µg/mL streptomycin, 50µg/mL gentamicin, 250ng/mL fungizone) (standard medium) at 1x10 6 nucleated cells/35-mm dish. Osteogenic Assay: After three days, the medium was changed to differentiation medium (standard medium supplemented with 50 µg/ml ascorbic acid and 10 mm β-glycerophosphate). Adipogenic Assay: After three days, the medium was changed to differentiation medium (standard medium with 50 µg/ml ascorbic acid and 10-5 M thiazolidinedione (BRL 49653)). Conditioned medium: Conditioned medium was collected from osteogenic stromal cell cultures at confluence after hours of conditioning. The conditioned medium was then used at 50:50 with fresh adipogenic medium. Inhibitor Studies in Stromal Cells IWP-2: Stromal cells were cultured in standard medium with 50µg/mL ascorbic acid until day 6 (matrix-forming time point). Cells were then treated for 24 hours with 0.1 or 1µM IWP-2 (Cat. I0536; Sigma-Aldrich, St. Louis, MO, USA) in dimethyl sulfoxide (DMSO) or vehicle (DMSO) alone. RNA was isolated as described below. Noggin: Osteogenic cells- Stromal cells were cultured in standard osteogenic differentiation medium with vehicle (20µg/mL acetic acid in 0.1% BSA PBS), or 25, 50, 100, 200, 500 ng/ml Noggin (Cat. ab50156; Abcam Inc., Cambridge, MA, USA). Cells were cultured until vehicletreated wells contained mineralized nodules and RNA was then isolated as below. Adipogenic cells- Stromal cells were cultured in standard adipogenic differentiation medium for 24 hours, then treated with vehicle (20µg/mL acetic acid in 0.1% BSA PBS), or 25, 50, 200 ng/ml Noggin for 48 hours. RNA was isolated as below.

73 64 IBMX (3-isobutyl-1-methylxanthine): Stromal cells were cultured in standard medium with 50 µg/ml ascorbic acid to confluence, serum starved (α-mem with 0.5% heat-inactivated FBS and antibiotics) overnight, and treated with 1mM IBMX (Cat. I5879; Sigma-Aldrich, St. Louis, MO, USA) for 40 minutes, 2 hours or 4 hours. RNA and protein were isolated as described below. camp-dependent protein kinase inhibitor (14-22), myristoylated (mpki): Osteogenic cells- Stromal cells were cultured in standard medium with 50 µg/ml ascorbic acid until confluence. Cells were then treated with vehicle (water) or 5, 10, 20 µm mpki (Cat. PHZ1202; Life Technologies, Carlsbad, CA, USA) for 24 hours and RNA was collected. Adipogenic cells- Stromal cells were cultured in standard adipogenic differentiation medium for 48 hours, and then treated with vehicle (water) or 5, 10, 20 µm mpki for 24 hours and RNA was collected. Quantitative RT-PCR Total RNA was isolated from bone, bone marrow and cell cultures using TriReagent (Sigma- Aldrich, St. Louis, MO, USA) and reverse transcribed using Superscript II (Invitrogen, Carlsbad, CA, USA) and random hexamers. cdna was combined with 0.5 µm each of the forward and reverse primers (Table 3.1) and iq SYBR Green Supermix and run in the MyIQ Real-Time PCR system (BioRad Laboratories, Inc., Hercules, CA, USA). Raw data were analyzed with PCR Miner (136) and normalized using the internal control transcript for ribosomal protein L32. SA Biosciences Mouse Signal Transduction PathwayFinder PCR Array RNA was isolated from trabecular bone samples. Sample preparation and RNA isolation were performed using TriReagent (Sigma-Aldrich, St. Louis, MO, USA) and SA Biosciences qpcr- Grade RNA isolation kit (Qiagen, Venlo, NL) following manufacturer s instructions. The Mouse Signal Transduction Pathway Finder RT² Profiler PCR Array (Qiagen, Venlo, NL) was performed following the manufacturer s instructions. Protein isolation from bone and stromal culture and Western blotting Long bones, cleaned of surrounding tissue, epiphysis and bone marrow, were cut slightly below the growth plate to separate trabecular bone and washed in PBS. Stromal culture plates were

74 65 Gene Direction Sequence Adipsin Forward TTGCAGGGGAGACTCCGGCAG Reverse CTCGGGTATAGACGCCCGGCT ap2 Forward TAACCCTAGATGGCGGGGCCC Reverse AACACATTCCACCACCAGCTTGT Axin2 Forward GCATCGCAGTGTGAAGGCCAA Reverse AGCAGGTTCCACAGGCGTCA Bsp* Forward CAGGGAGGCAGTGACTCTTC Reverse AGTGTGGAAAGTGTGGCGTT Bmp2 Forward GAGGCGAAGAAAAGCAACAG Reverse GGGGAAGCAGCAACACTAGA Bmp4 Forward TTCCTGGTAACCGAATGCTGA Reverse CCTGAATCTCGGCGACTTTTT L32 # Forward CACAATGTCAAGGAGCTGGAAGT Reverse TCTACAATGGCTTTTCGGTTCT LPL Forward GACTTGCCCTACGGCGCTCC Reverse AATCTCTTCCCGCGTCTGCTGC Nkd1 Forward GGAGGACAGCCGGCAAGAGTG Reverse ACCCGCAGTGTCTTGCTTGATG Pparg2 Forward TCGCTGATGCACTGCCTATG Reverse GAGAGGTCCACAGAGCTGATT Tcf7 Forward AGCCAGAAGCAAGGAGTTCACAGG Reverse GCAGGAAGGGGACAGGGGGTAG Table 3.1 Quantitative RT-PCR primer sequences used in this study. All primer sequences were from NCBI primer design, except those marked * which were obtained from PrimerBank, and those marked # which were designed using Primer Express software, version 2.0 (Perkin-Elmer, Foster City, CA).

75 66 washed with PBS. Proteins were extracted in cell lysis buffer as previously described (140). Protein extracts (30 µg) underwent immunoblotting with antibodies of interest (Table 3.2); ACTIN was used as a loading control. Western blots were developed using chemiluminescence, imaged with BioRad ChemiDoc TM -XRS+ and analysed using Image Lab software (BioRad Laboratories, Inc., Hercules, CA, USA). Statistical analysis Results are presented as mean ± standard deviation (SD). Experiments were repeated at least three times with independent biological samples. Statistical analysis was performed using Graphpad Prism 4.0 software. One-way analysis of variance (ANOVA) was used to determine longitudinal significance in dosage experiments. Unpaired t-test was used for direct comparisons between mutant and WT parameters; paired t-test was used for comparisons within genotypes (e.g. changes over treatment time); n values presented are independent biological samples. 3.4 Results The G60S Cx43 mutation concomitantly activates the osteoblast lineage and increases bone marrow adipogenesis in early-onset osteopenic Gja1 Jrt /+ mice. As we previously reported, Gja1 Jrt /+ mice, which carry a G60S Cx43 mutation resulting in reduced gap junction formation (Figure 3.1A) and function, exhibited early-onset osteopenia and changes in the structure and biomechanical properties of bone (156). The osteopenic phenotype results from activation of osteoclasts secondary to activation of the osteoblast lineage both in trabecular bone in vivo and in bone marrow stromal cultures. We confirmed here that activation of Gja1 Jrt /+ osteoblastic cells resulted in increased bone nodule formation, increased osteoblast marker expression - with Bsp being the most highly and significantly upregulated - and production of an abnormal bone matrix high in BSP content (Figure 3.1B, C), which we previously showed stimulates resorption (156).

76 67 Antigen Host Company Catalogue ID ACTIN Rabbit Sigma-Aldrich A2066 β-catenin (active) Mouse Millipore β-catenin (total) Rabbit Abcam ab6302 CREB Rabbit Cell Signaling Technology 4820 Connexin 43 Rabbit Invitrogen pcreb Rabbit Cell Signaling Technology 4276 SMAD 1 Rabbit Invitrogen psmad 1/5/8 Rabbit Cell Signaling Technology 9511 Anti-mouse IgG-HRP Goat Thermo Scientific LE Anti-rabbit IgG-HRP Goat Santa Cruz Biotech., Inc. sc-2004 Table 3.2 List of antibodies used in this study.

77 68 Figure 3.1 The Gja1 Jrt mutation activates the osteoblast lineage and alters bone matrix composition. (A) The formation of gap junctional plaques on the surface of Gja1 Jrt /+ mouse embryonic fibroblasts was significantly decreased versus WT cells, whereas intracellular localization of CX43 protein was significantly increased in Gja1 Jrt /+ versus WT cells. (B) Levels of Bsp mrna and BSP protein were significantly increased in the trabecular bone matrix of Gja1 Jrt /+ versus WT mice. (C) ALP and VonKossa stained end-point osteogenic stromal cultures revealed that numbers of CFU-F, CFU-ALP, and CFU-O were higher in Gja1 Jrt /+ versus WT cultures. Expression of osteoblastassociated markers, Bsp and Ocn, at end-point of culture was significantly increased in stromal cultures isolated from Gja1 Jrt /+ versus WT mice; n 3. *p<0.05 and **p<0.01.

78 69 As early as 7 weeks of age, Gja1 Jrt /+ mice exhibited increased bone marrow atrophy versus WT mice (Figure 3.2A, see also (89) ). Histomorphometry confirmed that whereas adipocyte size (adipocyte volume, Ad.V/adipocyte number, Ad.No) and percent marrow fat (adipocyte volume, Ad.V)/ marrow volume, Ma.V) were not significantly different between genotypes, adipocyte density (adipocyte number, Ad.No/tissue volume, mm 2 ) was significantly increased at 2 and 4 months of age in Gja1 Jrt /+ versus WT bone marrow (Figure 3.2B). Expression of all adipocyte markers tested, including Pparg2, the master adipogenic transcription factor, and downstream adipogenic markers ap2, LPL and Adipsin, were significantly increased in Gja1 Jrt /+ versus WT bone marrow (Figure 3.2C). The increase in adipogenesis in Gja1 Jrt /+ mice was restricted to the bone marrow, as evidenced by the fact that neither body mass composition (Figure 3.3A) nor expression of adipocyte markers in the epididymal fat pads (Figure 3.3B) were significantly different between Gja1 Jrt /+ and WT mice at any age tested. Notably, Gja1 Jrt /+ stromal cells cultured under adipogenic conditions displayed significantly increased expression of adipocyte markers at day 1 compared to WT cells, but not thereafter (Figure 3.4); consistent with this, no difference was seen in oil red-o staining at end point between genotypes (Figure 3.5). The BMP2/4 and Wnt/β-catenin signaling pathways are upregulated in Gja1 Jrt /+ trabecular bone and osteogenic stromal cell cultures but only BMP2/4 is responsible for the increase in osteoblast-specific gene expression. We next sought to identify which signaling pathway(s) downstream of Cx43 were altered by the G60S Cx43 mutation and might account for the increased expression of markers in the Gja1 Jrt /+ osteoblasts. Using a Pathway Finder QPCR array and RNA isolated from Gja1 Jrt /+ and WT trabecular bone samples, we identified and selected two candidate pathways, the BMP2/BMP4 pathway and the Wnt/β-catenin pathway (based on expression differences of 1.5-fold or greater between genotypes; Table 3.3) for further analysis. Given the reported ability of β-catenin to interact physically with CX43 (116), we first examined the Wnt/β-catenin signaling pathway.

79 70 Figure 3.2 Adipocyte number and activity are increased in Gja1 Jrt /+ versus WT bone marrow. (A) H&E stained tibia bones revealed an increased bone marrow atrophy in Gja1 Jrt /+ mice at 2 and 4 months of age versus WT littermates. (B) Histomorphometric analysis of the long bones showed a significant increase in adipocyte density at 2 and 4 months of age. Percentage marrow fat and adipocyte size were unaffected between genotypes; n 4. (C) Expression of adipocyte-associated markers was significantly increased in Gja1 Jrt /+ versus WT whole bone marrow of 4 month old mice; n 4. Solid and dashed lines indicate significance over time in WT and Gja1 Jrt /+ mice, respectively. #p<0.1, *p<0.05 and **p<0.01.

80 71 Figure 3.3 The Gja1 Jrt mutation does not cause a systemic increase in adipogenesis or adipocyte activity. (A) Representative DEXA images of WT and Gja1 Jrt /+ mice at 2 and 8 months of age. Measurements showed that Gja1 Jrt /+ mice had significantly lower body weight than WT littermates at all ages. No differences in percentage fat or percentage lean mass were noted at any age; n = 9. (B) Representative images of WT and Gja1 Jrt /+ epididymal fat pads. Expression of adipocyte-associated markers were unchanged in RNA isolated from epididymal fat pads of WT versus Gja1 Jrt /+ mice; n 3. *p<0.05, **p<0.01 and ***p<0.001.

81 72 Figure 3.4 The Gja1 Jrt mutation does not affect adipocyte lineage development in vitro. RNA was isolated at four time points throughout proliferation-differentiation in adipogenic stromal cultures derived from 4 month old mice. Expression of adipocyte- associated markers, Bmp2, Bmp4, and Tcf7 were unchanged between genotypes, except at day 1, when expression of these markers was increased in Gja1 Jrt /+ versus WT adipogenic stromal cultures; n 3. #p<0.1, *p<0.05 and **p<0.01.

82 73 Figure 3.5 Effect of the Gja1 Jrt mutation on formation of bone marrow- derived adipocytes in vitro. (A) Representative images of end-point adipogenic stromal cultures stained with Oil Red-O. The stromal cells were cultured under adipogenic conditions for approximately 6 days or until adipocytes could be identified by the presence of visible lipid droplets. (B) The amount of Oil Red-O staining was unaffected between genotypes; n = 3.

83 74 Gene Symbol Gene Name Bmp2 bone morphogenetic protein Bmp4 bone morphogenetic protein Ccl2 chemokine (C-C motif) ligand Cdkn2a cyclin-dependent kinase inhibitor 2A Cxcl1 chemokine (C-X-C motif) ligand Egr1 early growth response Fn1 fibronectin Hhip Hedgehog-interacting protein 2.79 Il1a interleukin 1 alpha 1.65 Il4ra interleukin 4 receptor, alpha Mmp10 matrix metallopeptidase Pparg peroxisome proliferator activated receptor gamma 2.53 Selp selectin, platelet Tcf7 transcription factor 7, T cell specific 3.21 Tfrc transferrin receptor 1.69 Pmepa1 prostate transmembrane protein, androgen induced Vcam1 vascular cell adhesion molecule Vegfa vascular endothelial growth factor A 1.52 Wisp1 WNT1 inducible signaling pathway protein Table 3.3 Results of the Mouse Signal Transduction Pathway Finder RT² Profiler PCR Array. Fold change versus WT The table shows the gene symbol and the gene name. Expression of the genes are shown as fold change versus WT; genes of interest were identified as those whose expression was changed 1.5-fold or greater in Gja1 Jrt /+ versus WT samples. RNA was isolated from trabecular bone of 2 month old WT and Gja1 Jrt /+ mice; n = 2 and each sample was the combination of n 2 independent biological samples.

84 75 Whereas total β-catenin protein was significantly increased in Gja1 Jrt /+ versus WT stromal cells, the level of transcriptionally active β-catenin was not (Figure 3.6A). When expression of Axin2 and naked cuticle 1 (Nkd1), two direct targets of β-catenin signaling, was assessed via QPCR, we found that Axin2 was unaffected, but expression of Nkd1 was significantly upregulated in Gja1 Jrt /+ versus WT stromal cells (Figure 3.6B). The inconsistent changes in Wnt/β-catenin target genes suggested that this pathway was not involved in the increased marker expression by Gja1 Jrt /+ osteoblasts. The latter was confirmed by treating WT and Gja1 Jrt /+ stromal cells with a Wnt signaling inhibitor, IWP-2. Treatment with 1µM IWP-2 significantly reduced Wnt/β-catenin signaling in both WT and Gja1 Jrt /+ stromal cells as evidenced by downregulation of expression of Axin2 (Figure 3.6C), however, IWP-2 treatment had no significant effect on expression of Bsp in either WT or Gja1 Jrt /+ stromal cells and Bsp expression remained higher in Gja1 Jrt /+ versus WT stromal cells, regardless of the IWP-2 concentration used (Figure 3.6D). We therefore next examined the BMP2/4 signaling pathway and confirmed that expression of Bmp2, Bmp4 and Tcf7 was significantly increased in RNA isolated from both Gja1 Jrt /+ trabecular bone (Figure 3.7A) and osteogenic stromal cell cultures (Figure 3.7B) versus WT specimens. Bmp2/4 signaling, determined by immunoblotting for phosphorylated SMAD1/5/8 (psmad1/5/8) proteins, was also significantly increased in Gja1 Jrt /+ versus WT stromal cell cultures. Levels of SMAD1 were unaffected between genotypes (Figure 3.7C). To determine whether the upregulated marker expression in Gja1 Jrt /+ osteoblasts resulted directly from upregulated BMP2/4 signaling, we treated osteogenic stromal cell cultures with Noggin, a BMP2/4 signaling inhibitor. The dose of Noggin required for either half (ID50) or maximal knockdown of both Bsp and Ocn expression was higher in Gja1 Jrt /+ versus WT cells (e.g. ID50's ng/mL of Noggin in WT cells versus ID ng/ml of Noggin in Gja1 Jrt /+ cells) (Figure 3.8A). The significant reduction in psmad1/5/8 levels confirmed that Noggin treatment knocked down BMP2/4 signaling in cells of both genotypes (Figure 3.9).

85 76 Figure 3.6 Changes in Wnt/β-catenin signaling cannot account for the upregulation of Bsp expression in hyperactive Gja1 Jrt /+ osteoblasts. (A) The level of total β -CATENIN protein was significantly increased in Gja1 Jrt /+ versus WT confluent osteogenic stromal cultures derived from 4 month old mice. Levels of active β -CATENIN (antibody recognizes the active form of β -CATENIN, dephosphorylated on Ser37 and Thr41) were unchanged. Shown is one representative blot; n 4. (B) Expression of direct β-catenin target genes, Axin2 and Nkd1, were unaffected and increased, respectively, in Gja1 Jrt /+ versus WT cells; n 8. When confluent osteogenic stromal cells were treated with IWP-2, a Wnt signaling inhibitor, (C) the expression of Axin2 decreased significantly, but (D) the expression of Bsp remained significantly increased in Gja1 Jrt /+ versus WT cells. Expression of Bsp was unchanged by IWP-2 treatment in cells of both genotypes; n 3. Solid and dashed lines indicate significant differences over dosage concentration in WT and Gja1 Jrt /+ mice, respectively. *p < 0.05, **p < 0.01 and ***p <

86 77 Figure 3.7 BMP2/4 signaling is increased in Gja1 Jrt /+ in vivo and in vitro. Expression of Bmp2, Bmp4, and Tcf7 were increased in Gja1 Jrt /+ versus WT (A) trabecular bone at 4 months of age; n 8, and in (B) osteogenic stromal cultures at confluence; n 3. (C) Levels of psmad1/5/8 were significantly increased in Gja1 Jrt /+ versus WT confluent osteogenic stromal cultures. Levels of SMAD1 were unchanged. One representative blot is shown; n 4. #p<0.1, *p<0.05 and **p<0.01.

87 78 Figure 3.8 Upregulated BMP2/4 signaling is responsible for the increased osteoblast marker expression and the increased Pparg2 expression in bone marrow-derived adipocytes and adipogenic precursors in Gja1 Jrt /+ versus WT mice. (A) The dose of Noggin required for either half (ID50) or maximal knockdown of both Bsp and Ocn expression was higher in Gja1 Jrt /+ versus WT osteogenic stromal cells. One representative experiment is shown, samples were run in triplicate; n = 3. (B) Both WT and Gja1 Jrt /+ adipogenic stromal cells grown in the presence of Gja1 Jrt /+ conditioned medium expressed higher levels of Pparg2 versus those grown with the addition of WT conditioned medium; n 3. Solid and dashed lines indicate significant differences between cells cultured in either conditioned media situation in WT and Gja1 Jrt /+ cells, respectively. (C) Expression of Pparg2 declined significantly when cells of either genotype (cultured under adipogenic conditions and with the addition of Gja1 Jrt /+ conditioned medium) were treated with Noggin; n = 5. Stars indicate significance between genotypes at that dosage concentration *p<0.05, **p<0.01 and ***p< Capital letters indicate significance between WT samples, lower case letters indicate significance between Gja1 Jrt /+ samples, letters are ascribed in alphabetical order to the dosages (e.g. significant difference versus dose 0 is denoted A in WT or a in Gja1 Jrt /+). A p-value of less than 0.05 was considered statistically significant.

88 79 Figure 3.9 Levels of psmad1/5/8 were significantly reduced in both WT and Gja1 Jrt /+ stromal cells treated with 200ng/mL of Noggin versus vehicle treated cells. One representative blot is shown; n = 3. *p<0.05, **p<0.01 and ***p<0.001.

89 80 Upregulated BMP2/4 production by Gja1 Jrt /+ osteogenic stromal cell cultures increases adipocyte gene expression in adipogenic stromal cultures. As summarized above, adipocyte density and volume were increased in the bone marrow but not elsewhere in the body (e.g., fat pads, trunk) of Gja1 Jrt /+ mice, suggesting that the increase was dependent on factors in the marrow microenvironment. The fact that increased expression of adipocyte-associated genes was seen only at early times, i.e., day 1, but not thereafter, in Gja1 Jrt /+ versus WT stromal cell cultures, also supported the possibility that cells other than adipocytes or their endogenous factors in the marrow microenvironment were responsible for the increased adipogenesis. Previously, we showed that mature endosteal osteoblasts are dislodged from bone surfaces when bone marrow is flushed from long bones and they remain viable for only short periods of time in culture (161). We therefore hypothesized that it is the hyperactive Gja1 Jrt /+ osteoblasts that are responsible, potentially through their increased production of BMP2/4, for increased marrow adipogenesis in Gja1 Jrt /+ mice. The increased Bmp2/4 expression and signaling in Gja1 Jrt /+ versus WT osteogenic stromal cell cultures at confluence (Figure 3.7B, C) supports this possibility. To test this hypothesis further, we cultured stromal cells under adipogenic conditions but further supplemented with addition of either WT or Gja1 Jrt /+ osteogenic stromal cell-conditioned medium. The expression of Pparg2 was significantly increased when cells of either genotype were grown in the presence of Gja1 Jrt /+ conditioned medium versus those supplemented with WT conditioned medium (Figure 3.8B). To determine whether this increase was due to increased BMP2/4 in the Gja1 Jrt /+ conditioned medium, we next treated adipogenic stromal cells supplemented with Gja1 Jrt /+ conditioned medium with Noggin for 48 hours. In cultures supplemented with Gja1 Jrt /+ conditioned medium, treatment with 6.25ng/mL of Noggin significantly reduced the expression of Pparg2 in both WT and Gja1 Jrt /+ adipogenic cells (Figure 3.8C). Increased levels of camp contribute to the upregulation of BMP2/4 signaling in Gja1 Jrt /+ versus WT osteogenic stromal cell cultures. To establish the link between decreased G60S Cx43 channel function and the increased activity of Gja1 Jrt /+ osteoblasts including increased BMP2/4 production, we next compared the intracellular concentrations of several molecules and ions known to be transported through Cx43

90 81 channels in WT and Gja1 Jrt /+ stromal cells. Whereas intracellular levels of ATP and Ca 2+ were not different between genotypes, camp levels were significantly increased in Gja1 Jrt /+ versus WT stromal cells cultured under osteogenic conditions (Figure 3.10A). To determine whether camp signaling was upregulated, we quantified phosphorylation of camp-responsive elementbinding protein (CREB), a camp-responsive transcription factor; given the relatively rapid decay of camp and low basal levels of pcreb/creb, we performed the assay in the presence of 3-isobutyl-1-methylxanthine (IBMX), a nonselective phosphodiesterase inhibitor, which inhibits camp breakdown, thereby amplifying any differences in levels of camp and its targets between genotypes. Levels of pcreb/creb increased significantly in Gja1 Jrt /+ cells after 2 hours of IBMX treatment, whereas no change in camp levels were detectable in WT cells; notably, pcreb/creb levels were also significantly increased in Gja1 Jrt /+ versus WT stromal cells at 2 hours of IBMX treatment (Figure 3.10B). To determine whether increased camp signaling in Gja1 Jrt /+ cells was the mechanism behind the increased BMP2/4 production, we next treated WT and Gja1 Jrt /+ stromal cells with an inhibitor of camp signaling and assessed Bmp2 expression. Myristoylated camp-dependent protein kinase inhibitor (mpki) knocks down camp signaling by interfering with the activation of protein kinase A (PKA) (162,163). Treatment with mpki had no significant effect on Bmp2 expression in WT stromal cells, but knocked down Bmp2 expression in Gja1 Jrt /+ cells to WT levels (Fig. 3.10C).

91 82 Figure 3.10 Intracellular levels of camp and camp signaling are increased in Gja1 Jrt /+ versus WT osteogenic stromal cells. (A) Intracellular levels of camp were significantly increased in confluent Gja1 Jrt /+ versus WT osteogenic stromal cells. Intracellular levels of ATP and Ca 2+ were unchanged; n 6. Levels of the signaling molecules and ions were normalized to WT levels. (B) Basal levels of pcreb/creb were unaffected in osteogenic stromal cells isolated from 4 month old mice. However, treatment of cells with 1mM IBMX for at least 2 hours resulted in increased levels of pcreb/creb in Gja1 Jrt /+ versus WT cells. Two representative blots are shown; n=3. (C) Bmp2 expression decreased when Gja1 Jrt /+ osteogenic stromal cells were treated with 20µM mpki, a camp signaling inhibitor, for 15 minutes. Treatment of WT cells with mpki had no effect on Bmp2 expression. One representative experiment is shown; n 4. Solid and dashed lines indicate significant differences over time in WT and Gja1 Jrt /+ mice, respectively. *p<0.05 and **p<0.01.