Fructose Upregulates FGF23 Expression In MC3T3 Pre-osteoblasts

Size: px
Start display at page:

Download "Fructose Upregulates FGF23 Expression In MC3T3 Pre-osteoblasts"

Transcription

1 Fructose Upregulates FGF23 Expression In MC3T3 Pre-osteoblasts Edek A. Williams, B.S.E., Veronique Douard, Ph.D., Joseph M. Lomuti, B.S., Ronaldo Ferraris, Ph.D., J. C. Fritton, Ph.D.. Rutgers University, Newark, NJ, USA. Disclosures: E.A. Williams: None. V. Douard: None. J.M. Lomuti: None. R. Ferraris: None. J.C. Fritton: None. Introduction: Increased consumption of high fructose has been linked to marked reductions in bone quality in humans and animals [1]. Fructose is directly transported into the blood circulation via transporters in the gut, primarly GLUT5 and metabolized specifically by ketohexokinase (KHK, commonly called fructokinase) [1]. The number of GLUT5 transporters and expression of enzymes for glucose are lower than those used for glucose, an essential sugar consumed for energy. Our data, and that of others, demonstrate that GLUT5 and KHK are expressed in the bone of growing mice [2,3]. Thus, fructose transporters are present in bone, fructose is likely metabolized in bone and fructose consumption disrupts bone formation by osteoblasts [2]. We wish to further understand the cellular mechanisms behind these alterations in bone biology and quality to understand why excessive fructose intake leads to poor bone growth. In this study we tested the hypothesis that bone cells exposed in vitro to fructose up-regulate sugar metabolism and have an anomalous differentiation to the osteoblast phenotype. Our outcome measure was the gene products that determine fructose metabolism in the cell (KHK), and indicate maturation of osteoblasts (osteocalcin and FGF23). Concentrations of fructose were tested from 0 through the physiologic range to supra-physiological. Methods: MC3T3-E1 osteoblasts were cultured for up to 14 days in osteoblast growth media [alpha modified essential media (αmem, containing 5.6 mm/l glucose) with 10% heat inactivated fetal bovine serum, 1% Penicillin/Streptomycin, 0.1% amphotericin b], with 0, 0.25, 0.5 and 1.0 mmol/l fructose to mimic no fructose, moderate fructose, physiological fructose and supra-physiological fructose concentrations in serum. MC3T3 cells were plated at passage 10, expanded and stored at passage 16 prior to seeding onto 12 well plates. After reaching 80% confluence (~4 x 10 5 cells) cells were induced to differentiate to osteoblasts with β-glycerolphosphate and ascorbic acid (media diff ) growth media (day 0). At days 7 and 14, RNA was isolated. mrna extracts were processed for real-time polymerase chain reaction (qpcr) with primers for osteocalcin (OCN), fibroblast growth factor 23 (FGF23) and KHK. Isolated primary cells from long-bone marrow of wild-type C57BL/6 mice aged 3-8 weeks old were treated as described above. After one-week culture, adherent pre-osteoblasts were isolated and induced with media diff. qpcr was performed with bone specific primers for activator of nuclear factor kappa ligand (RANKL), osteoprotegrin (OPG), matrix extracellular phosphoglycoprotein (MEPE), collagen 1, subunit alpha1 (Col1a1), runt related transcription factor 2 (Runx2) and phosphate regulating endonuclease homolog, X-linked (Phex). Sugar transport and metabolism specific primers used in addition to KHK were glucose transporters (GLUT2/5/8/9/12), and triokinase. Elongation factor 1 alpha (EF1α), and 18s ribosomal RNA (18S) were used as housekeeping genes to normalize expression. Results: MC3T3 exposed to fructose for 7 and 14 days at varying concentrations revealed increased expression of FGF23 and OCN (Figures 1-2). Longer exposure resulted in greater increases in gene expression. Surprisingly KHK expression decreased, both with fructose concentration and time (Figure 3). Primary cells demonstrated down-regulated bone-formation markers with fructose exposure (Figure 4). The RANKL/OPG ratio was increased with fructose. Similar to results in MC3T3 data, fructose downregulated the early rate-limiting steps of fructose metabolism, including the expression of glucose transporters 2,5,8,9,12 and KHK, while triokinase, which prepares fructose metabolites to enter the citric cycle, was up-regulated (Figure 5). Discussion: After ingesting 1g/kg BW of fructose, portal vein fructose concentrations approach 0.5 mmol/l but never exceed the concentration of glucose in serum, roughly 10 mmol/l. Thus, the concentrations chosen for this in vitro work represent subphysiological to an upper extreme for serum fructose concentration. In both our MC3T3 and primary cell cultures we observed that the gene products responsible for regulation of mineralized matrix and osteoblast differentiation are diminished in the presence of fructose. Previous work in growing mice challenged with low calcium diet demonstrated increased FGF23 serum levels. Increased FGF23 expression in MC3T3 cells supports what is seen in the serum. In addition to FGF23 expression, KHK expression, an enzyme which converts fructose to fructose-1-phosphate, decreases over time and with fructose concentration. This may indicate that as osteoblasts mature they have reduced capacity for KHK-mediated metabolism. We also observed increased OCN expression. OCN is another bone-specific protein that has a proposed endocrine role in osteoblast energy metabolism. Further characterization of the phenotype and the matrix produced by osteoblasts exposed to fructose is required. Limitations exist in this study. Additional time points should and will be tested in the future. Complete maturation of osteoblasts through collagen matrix production to the expression of proteins that assist in mineralization requires approximately 28 days. Confirmation of osteoblast phenotype may be accomplished with functional assays for alkaline phosphatase (ALP) activity, mineralization (Alizarin Red stain) and collagen (Sirius Red/Fast Green stain). Additionally, GLUT5, RANKL, OPG, MEPE, and Phex expression should be quantified in the MC3t3 cells in parallel with the phenotype confirmatory studies. Severely deficient expression of Phex, a messenger with downstream implications for the degradation of FGF23, could suggest a possible

2 mechanism for increased FGF23 expression in MC3T3 cells. This might support our previous in vivo data [2]. In addition to reduced expression of bone formation markers, the RANKL/OPG ratio was skewed toward that promoting osteoclastogenesis. Further work will be required in a co-culture system to determine the implications of fructose on bone resorption. However, exposure of MC3T3 and primary osteoblasts to fructose has now suggested that FGF23 may be involved in the decreased bone formation seen in our previous in vivo mouse model of mice fed fructose. Significance: High fructose corn syrup has become a staple sweetener in the diets of children. Bone growth is affected by dietary elements. However, few studies have investigated fructose effects on bone growth [1]. Acknowledgments: Funding through NSF: and NIH: AR Technical assistance provided by Mr. Joseph Geissler (NJMS). References: 1. Douard et al. J Physiol 591:401-14, Williams et al. ASBMR, Tsanzi et al. Nutr Rev 66:301-9, 2008.

3

4

5

6 ORS 2014 Annual Meeting Poster No: 0560

7

Nature Medicine: doi: /nm.4324

Nature Medicine: doi: /nm.4324 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression

More information

Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model

Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model Wnt7a Inhibits Cartilage Matrix Degradation in a Mouse In Vivo Osteoarthritis Model Averi Leahy, Andrea Foote, Tomoya Uchimura, Li Zeng, PhD. Tufts University, Boston, MA, USA. Disclosures: A. Leahy: None.

More information

Calcification of Porcine Aortic Valvular Interstitial Cells

Calcification of Porcine Aortic Valvular Interstitial Cells Calcification of Porcine Aortic Valvular Interstitial Cells Liwen Gu 1,2* Supervisor: Craig A. Simmons 1 Department of Engineering Science, 2 Institute of Biomaterials and Biomedical Engineering, University

More information

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A

Meeting Report. From December 8 to 11, 2012 at Atlanta, GA, U.S.A Meeting Report Affiliation Department of Transfusion Medicine and Cell Therapy Name Hisayuki Yao Name of the meeting Period and venue Type of your presentation Title of your presentation The 54 th Annual

More information

Space radiation and osteoclastogenesis:the effects of radiation and microgravity on bone resorption:

Space radiation and osteoclastogenesis:the effects of radiation and microgravity on bone resorption: Space radiation and osteoclastogenesis:the effects of radiation and microgravity on bone resorption: Alamelu Sundaresan1, Sukesh Aghara2, Terrell Gibson1and Indi Siripirasan2 1: Texas Southern University-3100

More information

Contribution of Interstitial Valve Cells to Aortic Valve Calcification

Contribution of Interstitial Valve Cells to Aortic Valve Calcification UNIVERSITÀ DEGLI STUDI DI PADOVA SEDE AMMINISTRATIVA: UNIVERSITÀ DEGLI STUDI DI PADOVA DIPARTIMENTO DI SCIENZE MEDICO-DIAGNOSTICHE E TERAPIE SPECIALI SCUOLA DI DOTTORATO DI RICERCA IN SCIENZE MEDICHE,

More information

supplementary information

supplementary information DOI:.38/ncb1963 a wild 5.3kb 11.2kb targeting vector stop PCR primer KKpn NNhe targeted allele 5.7kb 6.8kb probe b d (g) 35 3 25 2 genomic Southern blot Kpn I digest Nhe I digest / / / / / / 11.2 kb 5.7

More information

Mutation in Osteoactivin Enhances RANKL-Mediated Signaling, Promoting Osteoclast Differentiation, Survival and Inhibiting Bone Resorption

Mutation in Osteoactivin Enhances RANKL-Mediated Signaling, Promoting Osteoclast Differentiation, Survival and Inhibiting Bone Resorption Mutation in Osteoactivin Enhances RANKL-Mediated Signaling, Promoting Osteoclast Differentiation, Survival and Inhibiting Bone Resorption Samir Abdelmagid, MD, PhD, Fouad Moussa, BS, Sondag Gregory, MS,

More information

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were

Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were Supplemental Data Supplemental Materials and Methods Plasma measurements Mouse Glu-OC (undercarboxylated osteocalcin) and Gla-OC (carboxylated osteocalcin) levels were determined using ELISA kits according

More information

Roux-en-Y gastric bypass surgery but not vertical sleeve gastrectomy decreases bone mass in male rats

Roux-en-Y gastric bypass surgery but not vertical sleeve gastrectomy decreases bone mass in male rats SUPPLEMENTAL DATA Roux-en-Y gastric bypass surgery but not vertical sleeve gastrectomy decreases bone mass in male rats 1 Kerstin Stemmer, 2 Maximilian Bielohuby, 3 Bernadette E. Grayson, 3 Denovan P.

More information

Generation of post-germinal centre myeloma plasma B cell.

Generation of post-germinal centre myeloma plasma B cell. Generation of post-germinal centre myeloma. DNA DAMAGE CXCR4 Homing to Lytic lesion activation CD38 CD138 CD56 Phenotypic markers Naive Secondary lymphoid organ Multiple myeloma is a malignancy of s caused

More information

SUPPLEMENTAL MATERIAL. Supplementary Methods

SUPPLEMENTAL MATERIAL. Supplementary Methods SUPPLEMENTAL MATERIAL Supplementary Methods Culture of cardiomyocytes, fibroblasts and cardiac microvascular endothelial cells The isolation and culturing of neonatal rat ventricular cardiomyocytes was

More information

Supplementary data Supplementary Figure 1 Supplementary Figure 2

Supplementary data Supplementary Figure 1 Supplementary Figure 2 Supplementary data Supplementary Figure 1 SPHK1 sirna increases RANKL-induced osteoclastogenesis in RAW264.7 cell culture. (A) RAW264.7 cells were transfected with oligocassettes containing SPHK1 sirna

More information

Who manipulates who in dysregulated mineralised tissue resorption? Dr Gurå Therese Bergkvist MRCVS

Who manipulates who in dysregulated mineralised tissue resorption? Dr Gurå Therese Bergkvist MRCVS Who manipulates who in dysregulated mineralised tissue resorption? Dr Gurå Therese Bergkvist MRCVS Senior Lecturer in Veterinary Anatomy & Clinical Research Associate of The Roslin Institute Clinical diseases

More information

Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway

Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Exosomes/tricalcium phosphate combination scaffolds can enhance bone regeneration by activating the PI3K/Akt signalling pathway Jieyuan Zhang, Xiaolin Liu, Haiyan Li, Chunyuan Chen, Bin Hu, Xin Niu, Qing

More information

Deposition of Bone by the Osteoblasts. Bone is continually being deposited by osteoblasts, and it is continually being resorbed where osteoclasts are

Deposition of Bone by the Osteoblasts. Bone is continually being deposited by osteoblasts, and it is continually being resorbed where osteoclasts are Bone remodeling Deposition of Bone by the Osteoblasts. Bone is continually being deposited by osteoblasts, and it is continually being resorbed where osteoclasts are active. This mechanism is always is

More information

Ca, Mg metabolism, bone diseases. Tamás Kőszegi Pécs University, Department of Laboratory Medicine Pécs, Hungary

Ca, Mg metabolism, bone diseases. Tamás Kőszegi Pécs University, Department of Laboratory Medicine Pécs, Hungary Ca, Mg metabolism, bone diseases Tamás Kőszegi Pécs University, Department of Laboratory Medicine Pécs, Hungary Calcium homeostasis Ca 1000g in adults 99% in bones (extracellular with Mg, P) Plasma/intracellular

More information

Effects of Anti RANK ligand Denosumab on Beta Thalassemia induced osteoporosis

Effects of Anti RANK ligand Denosumab on Beta Thalassemia induced osteoporosis Effects of Anti RANK ligand Denosumab on Beta Thalassemia induced osteoporosis Mohamed Yassin 1 Ashraf T. Soliman2, Mohamed O. Abdelrahman3, Vincenzo De Sanctis 4 Departments of, 1 Hematology 2Pediatric

More information

silent epidemic,. (WHO),

silent epidemic,. (WHO), Tel: 02-740-8686; E-mail: hhbkim@snu.ac.kr silent epidemic,. (WHO),. 5 3, 1. 50 70. 50%, 25%, 20% (12~35%). 2.8% 0.7% 4. ( ). bone remodeling (osteoblast), (osteoclast),.. 3~4.. 70% (osteocyte) (bone lining

More information

Osteoclast Culture Kit

Osteoclast Culture Kit K-ASSAY KAMIYA BIOMEDICAL COMPANY Osteoclast Culture Kit For the culture of Osteoclasts from precursor cells. Cat. No.: CC-107 Rat Osteoclast Precursor Cells, V-1 CC-109 Mouse Osteoclast Precursor Cells,

More information

The Osteocyte: An Endocrine Cell... and More. Sarah L. Dallas, Matthew Prideaux, and Lynda F. Bonewald

The Osteocyte: An Endocrine Cell... and More. Sarah L. Dallas, Matthew Prideaux, and Lynda F. Bonewald REVIEW The Osteocyte: An Endocrine Cell... and More Sarah L. Dallas, Matthew Prideaux, and Lynda F. Bonewald Department of Oral and Craniofacial Sciences, School of Dentistry, University of Missouri-Kansas

More information

Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz )

Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Published on Second Faculty of Medicine, Charles University (http://www.lf2.cuni.cz ) Biochemistry Submitted by Marie Havlová on 8. February 2012-0:00 Syllabus of Biochemistry Mechanisms of enzyme catalysis.

More information

K K MK-4 MK-4 1,25-D3

K K MK-4 MK-4 1,25-D3 22 5 13 D 25-Hydroxyvitamin D Gla K K D K D K K K -4MK-4 MK-4 MK-4 steriod and xenobiotic receptorsxr MK-4 SXR MK-4 K MK-4 D 1,25-D3 D 1 CYP27B1CYP27B1-KO D CYP27B1-KO D D CYP27B1-KO Ca 1,25-D3 D Vitamin

More information

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota

Supplemental Information. Intermittent Fasting Promotes. White Adipose Browning and Decreases Obesity. by Shaping the Gut Microbiota Cell Metabolism, Volume 26 Supplemental Information Intermittent Fasting Promotes White Adipose Browning and Decreases Obesity by Shaping the Gut Microbiota Guolin Li, Cen Xie, Siyu Lu, Robert G. Nichols,

More information

Tanya Zappitelli. Copyright by Tanya Zappitelli 2015

Tanya Zappitelli. Copyright by Tanya Zappitelli 2015 Characterization of the Gja1 Jrt /+ Skeletal Phenotype and the Cellular and Molecular Effects of the G60S Connexin 43 Mutation in the Long Bone Microenvironment by Tanya Zappitelli A thesis submitted in

More information

The hart and bone in concert

The hart and bone in concert The hart and bone in concert Piotr Rozentryt III Department of Cardiology, Silesian Centre for Heart Disease, Silesian Medical University, Zabrze, Poland Disclosure Research grant, speaker`s fee, travel

More information

Osteoclast Activity Assay Substrate

Osteoclast Activity Assay Substrate Osteoclast Activity Assay Substrate For Research Use Only OSCOTECT INC. #3201 Trade Tower Samsung-dong 159, Kangnam-ku Seoul 135-729, Korea Tel: +82-2-6000-7666 / Fax: +82-2-6000-7667 customer@oscotec.com

More information

CKD-Mineral Bone Disorder (MBD) Pathogenesis of Metabolic Bone Disease. Grants: NIH, Abbott, Amgen, OPKO, Shire

CKD-Mineral Bone Disorder (MBD) Pathogenesis of Metabolic Bone Disease. Grants: NIH, Abbott, Amgen, OPKO, Shire Pathogenesis of Metabolic Bone Disease Stuart M. Sprague, D.O. Chief, Division of Nephrology and Hypertension Professor of Medicine NorthShore University HealthSystem University of Chicago Pritzker School

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 A B mir-141, human cell lines mir-2c, human cell lines mir-141, hepatocytes mir-2c, hepatocytes Relative RNA.1.8.6.4.2 Relative RNA.3.2.1 Relative RNA 1.5 1..5 Relative RNA 2. 1.5

More information

CONTRACTING ORGANIZATION: Beth Israel Deaconess Medical Center Boston, MA 02115

CONTRACTING ORGANIZATION: Beth Israel Deaconess Medical Center Boston, MA 02115 AD Award Number: W81XWH-06-1-0219 TITLE: Skeletal Complications in Neurofibromatosis Type 1: The Role of Neurofibromin Haploinsufficiency in Defective Skeletal Remodeling and Bone Healing in NF1 PRINCIPAL

More information

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO

Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Supplementary Figure S1. Effect of Glucose on Energy Balance in WT and KHK A/C KO Mice. WT mice and KHK-A/C KO mice were provided drinking water containing 10% glucose or tap water with normal chow ad

More information

THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY

THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENT OF BIOCHEMISTRY AND MOLECULAR BIOLOGY IMPACT OF OSTEOBLAST-DERIVED BONE REMODELING CYTOKINES ON METASTATIC BREAST CANCER CELL DORMANCY

More information

The Role of the Laboratory in Metabolic Bone Disease

The Role of the Laboratory in Metabolic Bone Disease The Role of the Laboratory in Metabolic Bone Disease Howard Morris PhD, FAACB, FFSc(RCPA) President, IFCC Professor of Medical Sciences, University of South Australia, Clinical Scientist, SA Pathology

More information

Cellular Physiology and Biochemistry

Cellular Physiology and Biochemistry Original Paper 2015 The Author(s). 2015 Published The Author(s) by S. Karger AG, Basel Published online: November 27, 2015 www.karger.com/cpb Published by S. Karger AG, Basel 2194 1421-9778/15/0376-2194$39.50/0

More information

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks)

Males- Western Diet WT KO Age (wks) Females- Western Diet WT KO Age (wks) Relative Arv1 mrna Adrenal 33.48 +/- 6.2 Skeletal Muscle 22.4 +/- 4.93 Liver 6.41 +/- 1.48 Heart 5.1 +/- 2.3 Brain 4.98 +/- 2.11 Ovary 4.68 +/- 2.21 Kidney 3.98 +/-.39 Lung 2.15 +/-.6 Inguinal Subcutaneous

More information

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression

Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving

More information

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate,

Supplemental Tables and Figures. The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, Supplemental Tables and Figures The metalloproteinase-proteoglycans ADAMTS7 and ADAMTS12 provide an innate, tendon-specific protective mechanism against heterotopic ossification Timothy Mead et al Supplemental

More information

Supplemental tables: Abbreviations:

Supplemental tables: Abbreviations: Supplemental tables: Abbreviations: Osteoprotegerin (OPG), Receptor Activator of Nuclear factor Kappa beta Ligand (RANKL), fibroblast growth factor-23 (FGF-23), C-terminal cross-linked telopeptide of type-i

More information

Pair-fed % inkt cells 0.5. EtOH 0.0

Pair-fed % inkt cells 0.5. EtOH 0.0 MATERIALS AND METHODS Histopathological analysis Liver tissue was collected 9 h post-gavage, and the tissue samples were fixed in 1% formalin and paraffin-embedded following a standard procedure. The embedded

More information

TYPE I DIABETIC OSTEOPOROSIS AND OSTEOBLAST APOPTOSIS. Lindsay Martin Coe

TYPE I DIABETIC OSTEOPOROSIS AND OSTEOBLAST APOPTOSIS. Lindsay Martin Coe TYPE I DIABETIC OSTEOPOROSIS AND OSTEOBLAST APOPTOSIS By Lindsay Martin Coe A DISSERTATION Submitted to Michigan State University in partial fulfillment of the requirements for the degree of DOCTOR OF

More information

BEC FEED SOLUTIONS NEW ZEALAND Ltd

BEC FEED SOLUTIONS NEW ZEALAND Ltd BEC FEED SOLUTIONS NEW ZEALAND Ltd Proudly sponsor Dr Alessandro Mereu Yara Feed Phosphates July 2017 NZARN Meeting www.becfeed.co.nz Phosphorus metabolism in cattle: principles and interactions with Ca

More information

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA

Genetics. Instructor: Dr. Jihad Abdallah Transcription of DNA Genetics Instructor: Dr. Jihad Abdallah Transcription of DNA 1 3.4 A 2 Expression of Genetic information DNA Double stranded In the nucleus Transcription mrna Single stranded Translation In the cytoplasm

More information

Biochemistry #01 Bone Formation Dr. Nabil Bashir Farah Banyhany

Biochemistry #01 Bone Formation Dr. Nabil Bashir Farah Banyhany Biochemistry #01 Bone Formation Dr. Nabil Bashir Farah Banyhany Greetings This lecture is quite detailed, but I promise you will make it through, it just requires your 100% FOCUS! Let s begin. Today s

More information

Lecture 3: Skeletogenesis and diseases

Lecture 3: Skeletogenesis and diseases Jilin University School of Stomatology Skeletogenesis Lecture 3: Skeletogenesis and diseases Aug. 21, 2015 Yuji Mishina, Ph.D. mishina@umich.edu Bone Development Mouse embryo, E14.5 Mouse embryo, E18.0

More information

Osteoclast Culture Kit

Osteoclast Culture Kit K-ASSAY Osteoclast Culture Kit For the culture of Osteoclasts from precursor cells. Cat. No.: CC-107 Rat Osteoclast Precursor Cells, V-1 For Research Use Only. 1 Rev. 091708 K-ASSAY PRODUCT INFORMATION

More information

Attempts to Create Rickets in Mice Using a Calcium Deficient Diet

Attempts to Create Rickets in Mice Using a Calcium Deficient Diet Attempts to Create Rickets in Mice Using a Calcium Deficient Diet Holly Hauser Abstract: Previous research with chickens produced rickets by reducing the calcium content of the diet. When rickets occurred,

More information

Supplementary Figure 1.

Supplementary Figure 1. Supplementary Figure 1. Increased expression of cell cycle pathway genes in insulin + Glut2 low cells of STZ-induced diabetic islets. A) random blood glucose measuers of STZ and vehicle treated MIP-GFP

More information

Daidzein promotes osteoblast proliferation and differentiation in OCT1 cells through stimulating the activation of BMP-2/Smads pathway

Daidzein promotes osteoblast proliferation and differentiation in OCT1 cells through stimulating the activation of BMP-2/Smads pathway Daidzein promotes osteoblast proliferation and differentiation in OCT1 cells through stimulating the activation of BMP-2/Smads pathway B. Hu 1,2, B. Yu 2,3, D. Tang 2, S. Li 1 and Y. Wu 1 1 Nanchang Second

More information

Elecsys bone marker panel. Optimal patient management starts in the laboratory

Elecsys bone marker panel. Optimal patient management starts in the laboratory bone marker panel Optimal patient management starts in the laboratory Complete solution for osteoporosis The most complete bone metabolism panel on a single platform bone marker assays are important diagnostic

More information

THE EFFECTS OF UNDEGRADED GLYCOSAMINOGLYCANS FROM MUCOPOLYSACCHARIDOSES ON OSTEOBLAST DIFFERENTIATION AND MINERALISATION IN VITRO

THE EFFECTS OF UNDEGRADED GLYCOSAMINOGLYCANS FROM MUCOPOLYSACCHARIDOSES ON OSTEOBLAST DIFFERENTIATION AND MINERALISATION IN VITRO THE EFFECTS OF UNDEGRADED GLYCOSAMINOGLYCANS FROM MUCOPOLYSACCHARIDOSES ON OSTEOBLAST DIFFERENTIATION AND MINERALISATION IN VITRO Nathan Rout-Pitt B.Sc. (Hons) Department of Paediatrics The University

More information

Article begins on next page

Article begins on next page Chronic High Fructose Intake Reduces Serum 1,25(OH) 2 D 3 Levels in Calcium-Sufficient Rodents Rutgers University has made this article freely available. Please share how this access benefits you. Your

More information

TITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer

TITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer AD Award Number: W81XWH-07-1-0400 TITLE: Crosstalk Between Cancer Cells and Bones Via the Hedgehog Pathway Determines Bone Metastasis of Breast Cancer PRINCIPAL INVESTIGATOR: Dr. Lalita Shevde-Samantrese

More information

Fructose in diabetes: Friend or Foe. Kim Chong Hwa MD,PhD Sejong general hospital, Division of Endocrinology & Metabolism

Fructose in diabetes: Friend or Foe. Kim Chong Hwa MD,PhD Sejong general hospital, Division of Endocrinology & Metabolism Fructose in diabetes: Friend or Foe Kim Chong Hwa MD,PhD Sejong general hospital, Division of Endocrinology & Metabolism Contents What is Fructose? Why is Fructose of Concern? Effects of Fructose on glycemic

More information

ab Adipogenesis Assay Kit (Cell-Based)

ab Adipogenesis Assay Kit (Cell-Based) ab133102 Adipogenesis Assay Kit (Cell-Based) Instructions for Use For the study of induction and inhibition of adipogenesis in adherent cells. This product is for research use only and is not intended

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Distinct Roles Of CCN1 And CCN2 In Limb Development

Distinct Roles Of CCN1 And CCN2 In Limb Development Distinct Roles Of CCN1 And CCN2 In Limb Development Jie Jiang, PhD 1, Jessica Ong, BS 1, Faith Hall-Glenn, PhD 2, Teni Anbarchian, BS 1, Karen M. Lyons, PhD 1. 1 University of California, Los Angeles,

More information

Siglec-15 Is A Potential Therapeutic Target For Postmenopausal Osteoporosis

Siglec-15 Is A Potential Therapeutic Target For Postmenopausal Osteoporosis Siglec-15 Is A Potential Therapeutic Target For Postmenopausal Osteoporosis Yusuke Kameda, Masahiko Takahata, Tomohiro Shimizu, Hiroki Hamano, Norimasa Iwasaki. Department of Orthopedic Surgery, Hokkaido

More information

RNA (Ribonucleic acid)

RNA (Ribonucleic acid) RNA (Ribonucleic acid) Structure: Similar to that of DNA except: 1- it is single stranded polunucleotide chain. 2- Sugar is ribose 3- Uracil is instead of thymine There are 3 types of RNA: 1- Ribosomal

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Haematopoietic stem cell release is regulated by circadian oscillations Simón Méndez-Ferrer *, Daniel Lucas *, Michela Battista * and Paul S. Frenette * Mount Sinai School of Medicine, *Departments of

More information

Elution of Tumoricidal Doses of Bortezomib from a Resorbable Cement Carrier

Elution of Tumoricidal Doses of Bortezomib from a Resorbable Cement Carrier Elution of Tumoricidal Doses of Bortezomib from a Resorbable Cement Carrier Matthew Allen, Vet MB, PhD, Brittani Jones, BS. The Ohio State University, Columbus, OH, USA. Disclosures: M. Allen: 5; Johnson

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1 Correlation between LKB1 and YAP expression in human lung cancer samples. (a) Representative photos showing LKB1 and YAP immunohistochemical staining in human

More information

Christine Pelkman, PhD

Christine Pelkman, PhD Christine Pelkman, PhD Dr. Pelkman is a graduate faculty member in Nutrition, and Director of the Nutrition and Health Research Laboratory at the University of Buffalo. She completed her doctoral and postdoctoral

More information

Regulation of the skeletal mass through the life span

Regulation of the skeletal mass through the life span Regulation of the skeletal mass through the life span Functions of the skeletal system Mechanical protection skull Movement leverage for muscles Mineral metabolism calcium store Erythropoiesis red blood

More information

DEPOSITS. Dentalelle Tutoring 1

DEPOSITS. Dentalelle Tutoring   1 DEPOSITS Dentalelle Tutoring WWW.DENTALELLE.COM 1 PH SCALE WWW.DENTALELLE.COM 2 DENTAL CARIES Dental caries is a dynamic process that involves a susceptible tooth, cariogenic bacteria in dental plaque

More information

CELLS. Cells. Basic unit of life (except virus)

CELLS. Cells. Basic unit of life (except virus) Basic unit of life (except virus) CELLS Prokaryotic, w/o nucleus, bacteria Eukaryotic, w/ nucleus Various cell types specialized for particular function. Differentiation. Over 200 human cell types 56%

More information

Osteoblast Play an Essential Role in Periodontal Bone Loss Through Activation of

Osteoblast Play an Essential Role in Periodontal Bone Loss Through Activation of Osteoblast Play an Essential Role in Periodontal Loss Through Activation of Nuclear Factor-Kappa B Authors: Sandra Pacios 1, Wenmei Xiao 1,2, Marcelo Mattos 1, Jason Lim 1, Rohinton S. Tarapore 1, Sarah

More information

Supporting Information

Supporting Information Supporting Information M1 macrophage-derived nanovesicles potentiate the anticancer efficacy of immune checkpoint inhibitors Yeon Woong Choo, 1, Mikyung Kang, 2, Han Young Kim, 1 Jin Han, 1 Seokyung Kang,

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

Ayman Mesleh & Leen Alnemrawi. Bayan Abusheikha. Faisal

Ayman Mesleh & Leen Alnemrawi. Bayan Abusheikha. Faisal 24 Ayman Mesleh & Leen Alnemrawi Bayan Abusheikha Faisal We were talking last time about receptors for lipid soluble hormones.the general mechanism of receptors for lipid soluble hormones: 1. Receptors

More information

THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE. DEPARTMENTS OF BIOLOGY and BIOCHEMISTRY AND MOLECULAR BIOLOGY

THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE. DEPARTMENTS OF BIOLOGY and BIOCHEMISTRY AND MOLECULAR BIOLOGY THE PENNSYLVANIA STATE UNIVERSITY SCHREYER HONORS COLLEGE DEPARTMENTS OF BIOLOGY and BIOCHEMISTRY AND MOLECULAR BIOLOGY DEADLY KISS: KISSPEPTIN 10 INTERACTION WITH OSTEOBLASTS AND BREAST CANCER METASTATIC

More information

Normocalcemia is maintained in mice under conditions of calcium malabsorption by vitamin D induced inhibition of bone mineralization

Normocalcemia is maintained in mice under conditions of calcium malabsorption by vitamin D induced inhibition of bone mineralization Related article, page 1598 Research article Normocalcemia is maintained in mice under conditions of calcium malabsorption by vitamin D induced inhibition of bone mineralization Liesbet Lieben, 1 Ritsuko

More information

Tenogenic Differentiation of Mesenchymal Stem Cells and Their Applications in Tendon Tissue Engineering

Tenogenic Differentiation of Mesenchymal Stem Cells and Their Applications in Tendon Tissue Engineering Tenogenic Differentiation of Mesenchymal Stem Cells and Their Applications in Tendon Tissue Engineering Professor Gang Li, MBBS, D Phil (Oxon) Department of Orthopaedics and Traumatology, The Chinese University

More information

7.06 Cell Biology EXAM #3 April 24, 2003

7.06 Cell Biology EXAM #3 April 24, 2003 7.06 Spring 2003 Exam 3 Name 1 of 8 7.06 Cell Biology EXAM #3 April 24, 2003 This is an open book exam, and you are allowed access to books and notes. Please write your answers to the questions in the

More information

Fat and HIV persistence, role of fat metabolism and inflammation

Fat and HIV persistence, role of fat metabolism and inflammation NIDDK Workshop Obesity and Fat Metabolism in HIV infected individuals Rockville, MD May 22-23, 2018 Centro de Investigación Biomédica En Red Fisiopatología de la Obesidad y Nutrición Fat and HIV persistence,

More information

PARATHYROID, VITAMIN D AND BONE

PARATHYROID, VITAMIN D AND BONE PARATHYROID, VITAMIN D AND BONE G M Kellerman Pathology North Hunter Service 30/01/2015 BIOLOGY OF BONE Bone consists of protein, polysaccharide components and mineral matrix. The mineral is hydroxylapatite,

More information

March 19 th Batool Aqel

March 19 th Batool Aqel March 19 th - 2013 6 Batool Aqel Hormones That Bind to Nuclear Receptor Proteins Hormones bind to their receptors.whether the receptor is found in the nucleus or the cytoplasm, at the end they are translocated

More information

Key regulatory junctions stabilizing the osteoblast phenotype

Key regulatory junctions stabilizing the osteoblast phenotype Key regulatory junctions stabilizing the osteoblast phenotype Implications for cell and tissue engineering Jan O. Gordeladze 1,2,3, Janne E. Reseland 4 Unni syversen 5 and Mauro Valtieri 6 1 Department

More information

What systems are involved in homeostatic regulation (give an example)?

What systems are involved in homeostatic regulation (give an example)? 1 UNIVERSITY OF PNG SCHOOL OF MEDICINE AND HEALTH SCIENCES DIVISION OF BASIC MEDICAL SCIENCES DISCIPLINE OF BIOCHEMISTRY AND MOLECULAR BIOLOGY GLUCOSE HOMEOSTASIS (Diabetes Mellitus Part 1): An Overview

More information

Insulin mrna to Protein Kit

Insulin mrna to Protein Kit Insulin mrna to Protein Kit A 3DMD Paper BioInformatics and Mini-Toober Folding Activity Student Handout www.3dmoleculardesigns.com Insulin mrna to Protein Kit Contents Becoming Familiar with the Data...

More information

DNA codes for RNA, which guides protein synthesis.

DNA codes for RNA, which guides protein synthesis. Section 3: DNA codes for RNA, which guides protein synthesis. K What I Know W What I Want to Find Out L What I Learned Vocabulary Review synthesis New RNA messenger RNA ribosomal RNA transfer RNA transcription

More information

BONE TISSUE. Dr. Heba Kalbouneh Associate Professor of Anatomy and Histology

BONE TISSUE. Dr. Heba Kalbouneh Associate Professor of Anatomy and Histology BONE TISSUE Dr. Heba Kalbouneh Associate Professor of Anatomy and Histology BONE FUNCTION Support Protection (protect internal organs) Movement (provide leverage system for skeletal muscles, tendons, ligaments

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi: 1.138/nature7221 Brown fat selective genes 12 1 Control Q-RT-PCR (% of Control) 8 6 4 2 Ntrk3 Cox7a1 Cox8b Cox5b ATPase b2 ATPase f1a1 Sirt3 ERRα Elovl3/Cig3 PPARα Zic1 Supplementary Figure S1. stimulates

More information

The Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis

The Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis The Regulation of Bone Formation by the Met-5-enkephalin-Opioid Growth Factor Receptor Signaling Axis Nikhil Thakur, MD, Sean D. DeBoyace, BS, Bryan S. Margulies, PhD. SUNY Upstate Medical University,

More information

doi: /nature14508 Rappsilber et al.

doi: /nature14508 Rappsilber et al. SUPPLEMENTARY INFORMATION doi:1.138/nature1458 Grosso et al. Barbosa et al. 74 72 45 33 47 7 51 Rappsilber et al. Supplementary Figure 1 a, Venn-Diagram of identified splice factors in the work of Barbossa

More information

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희

Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Fructose in Insulin Resistance- Focused on Diabetes 순천향대학교부천병원 내분비내과 정찬희 Introduction Unique characteristics of Fructose Metabolism Mechanism for Fructose-Induced Insulin Resistance Epidemiological Studies

More information

Intake of sugar-sweetened beverages and weight gain: a systematic review REVIEW ARTICLE

Intake of sugar-sweetened beverages and weight gain: a systematic review REVIEW ARTICLE Intake of sugar-sweetened beverages and weight gain: a systematic review REVIEW ARTICLE 1 American Journal of Clinical Nutrition Vol. 84, No. 2, 274-288, August 2006 Vasanti S Malik, Matthias B Schulze

More information

Porphyromonas gingivalis lipopolysaccharide regulates ephrin/eph signalling in human periodontal ligament fibroblasts

Porphyromonas gingivalis lipopolysaccharide regulates ephrin/eph signalling in human periodontal ligament fibroblasts Accepted: 9 March 2017 DOI: 10.1111/jre.12463 ORIGINAL ARTICLE Porphyromonas gingivalis lipopolysaccharide regulates ephrin/eph signalling in human periodontal ligament fibroblasts M. Li 1 C. Zhang 1 L.

More information

Industrialized Food Components and Obesity Risk. Kylie Kavanagh, VMS MS MPH Department of Pathology

Industrialized Food Components and Obesity Risk. Kylie Kavanagh, VMS MS MPH Department of Pathology Industrialized Food Components and Obesity Risk Kylie Kavanagh, VMS MS MPH Department of Pathology Overview Role of science in policy development Components versus calories Past lessons (trans fat) Present

More information

Calcium, phosphate & magnesium regulation

Calcium, phosphate & magnesium regulation Calcium, phosphate & magnesium regulation Tim Arnett Department of Cell and Developmental Biology University College London Bone composition Treated with hydrochloric acid to dissolve mineral leaves organic

More information

Bone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome

Bone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome Bone Metabolism in Postmenopausal Women Influenced by the Metabolic Syndrome Thomas et al. Nutrition Journal (2015) 14:99 DOI 10.1186/s12937-015-0092-2 RESEARCH Open Access Acute effect of a supplemented

More information

s u p p l e m e n ta ry i n f o r m at i o n

s u p p l e m e n ta ry i n f o r m at i o n Figure S1 Characterization of tet-off inducible cell lines expressing GFPprogerin and GFP-wt lamin A. a, Western blot analysis of GFP-progerin- or GFP-wt lamin A- expressing cells before induction (0d)

More information

TRUTH: On average, Canadians consume 11% of energy from added sugars, and consumption has been declining

TRUTH: On average, Canadians consume 11% of energy from added sugars, and consumption has been declining Uncover the truth about sugar: consumption Myth: Canadians are eating more and more sugar TRUTH: On average, Canadians consume 11% of energy from added sugars, and consumption has been declining Three

More information

Water. Nutrition Facts Serving Size 20 fl oz (591 ml) Servings Per Container 1. Amount Per Serving Calories 0 Calories from Fat 0

Water. Nutrition Facts Serving Size 20 fl oz (591 ml) Servings Per Container 1. Amount Per Serving Calories 0 Calories from Fat 0 Water Serving Size 20 fl oz (591 ml) Servings Per Container 1 Calories 0 Calories from Fat 0 Sodium 0mg 0% Total Carbohydrate 0g 0% Sugars 0g Not a significant source of other nutrients. Ingredients: PURIFIED

More information

Osteoporosis and its Association with Rheumatoid Arthritis and Prednisolone Therapy

Osteoporosis and its Association with Rheumatoid Arthritis and Prednisolone Therapy Osteoporosis and its Association with Rheumatoid Arthritis and Prednisolone Therapy Master s Thesis Ane Eriksen Medicine with Industrial Specialization Aalborg University Osteoporosis and its Association

More information

Comment les cellules osseuses communiquent entre elles. Gérard Friedlander Journées UPA 2011

Comment les cellules osseuses communiquent entre elles. Gérard Friedlander Journées UPA 2011 Comment les cellules osseuses communiquent entre elles Gérard Friedlander Journées UPA 2011 Structure de l os Osteocyte Ostéoclaste Remodelage osseux RANKL RANK NF-kB pathway Stem cell progenitor precursor

More information

Endocrine System Notes

Endocrine System Notes Endocrine System Notes is the tendency to maintain a stable internal environment. - parts of the body that secrete hormones directly into the body. - parts of the body that make secretions which travel

More information

number Done by Corrected by Doctor Nayef Karadsheh

number Done by Corrected by Doctor Nayef Karadsheh number 16 Done Huda shaheen by Corrected by حسام أبو عوض Doctor Nayef Karadsheh 1 In the previous lecture, we talked about glycogen metabolism and regulation. In this sheet we will talk about the metabolism

More information

Rooibos tea flavonoids increase mineral content in human osteoblast-like cells. Leslie A. Nash, B.Sc. (Honors) Health Sciences

Rooibos tea flavonoids increase mineral content in human osteoblast-like cells. Leslie A. Nash, B.Sc. (Honors) Health Sciences Rooibos tea flavonoids increase mineral content in human osteoblast-like cells Leslie A. Nash, B.Sc. (Honors) Health Sciences Submitted in partial fulfillment of the requirements for the degree of Master

More information

Journal of Biomedical Science 2012, 19:36

Journal of Biomedical Science 2012, 19:36 Journal of Biomedical Science This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Role of carotenoid

More information

The addition of sugar moiety determines the blood group

The addition of sugar moiety determines the blood group The addition of sugar moiety determines the blood group Sugars attached to glycoproteins and glycolipids on the surfaces of red blood cells determine the blood group termed A, B, and O. The A and B antigens

More information