ACCEPTED NOTE. Evaluation of three real-time PCR assays for the detection of Mycoplasma. pneumoniae in an outbreak investigation

Transcription

1 JCM Accepts, published online ahead of print on July 00 J. Clin. Microbiol. doi:./jcm Copyright 00, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved NOTE Evaluation of three real-time PCR assays for the detection of Mycoplasma pneumoniae in an outbreak investigation Running Title: Real-time PCR of M. pneumoniae in an outbreak Authors Jonas M. Winchell 1,, Kathleen A. Thurman 1, Stephanie L. Mitchell 1, W. Lanier Thacker 1, Barry S. Fields 1 Affiliations: 1 Respiratory Diseases Branch, Centers for Disease Control and Prevention, Atlanta, Georgia Corresponding author: Centers for Disease Control and Prevention 0 Clifton Rd. N.E. MS: G-0 Atlanta, GA 0 (0)-1 (0)-1 fax jwinchell@cdc.gov Downloaded from on May, 01 by guest

2 Abstract We compared the performance of three recently optimized real-time PCR assays derived from distinct genomic regions of M. pneumoniae during an outbreak. Comprehensive evaluation established that a newly described toxin gene represents a superior target for detecting M. pneumoniae DNA in clinical specimens, although use of multiple targets may increase testing confidence. Downloaded from on May, 01 by guest

3 Mycoplasma pneumoniae accounts for approximately 1-0% of all communityacquired pneumonia cases and is a common cause of outbreaks (,1,1). Outbreaks have been reported to occur in - year intervals and although all age groups are susceptible, incidence rates vary by age and may occur more frequently in certain settings (,1,1). M. pneumoniae infection spreads efficiently within households and close- living quarters with incubation periods as long as weeks (1). The insidious nature of this infection and protracted disease course make this agent a predominant cause of walking pneumonia that can persist within the population and cause community or institutional outbreaks. Upper and lower respiratory tract symptoms are often mild, resulting in tracheobronchitis, headache and cough. Occasionally, severe cases with extrapulmonary involvement can result in hospitalization and death due to neurological disease, such as encephalitis (1,,,1,1). The high rate of morbidity and the occasional mortality reinforces the need for timely diagnosis for administering proper antibiotic treatment (,). Conventional tests for detecting M. pneumoniae are fraught with limitations (). M. pneumoniae culture can often take several weeks, requires special media and expertise, is insensitive and prone to contaminants and inhibitors. Serological assays such as complement fixation and commercially available immunoglobulin detection kits are by nature retrospective, requiring paired serum samples from both acute and convalescent phases and possess questionable specificity and sensitivity. In sum, these approaches are impractical for a rapid diagnosis. A variety of nucleic acid-based tests based upon PCR have been developed for the rapid and sensitive detection of M. pneumoniae (,,1,1,1). The range of variables within each PCR study (specimen type, nucleic Downloaded from on May, 01 by guest

4 acid extraction and amplification procedures, target selection, definitions used in calculating data, etc.) makes it difficult to compare results and draw a single, comprehensive approach for reliable detection. Recent community outbreaks of M. pneumoniae underscore a need among public health departments and local hospitals for a rapid and reliable diagnostic assay (1,,1,1,1). Moreover, this test should be highly specific, sensitive and be evaluated in an outbreak setting. The aim of the current study was to evaluate the use of three recently optimized real-time PCR assays for the detection of M. pneumoniae in respiratory samples from a recent outbreak. To our knowledge this is the first prospective and comparative study of real-time PCR targets used to identify cases during an outbreak investigation of M. pneumoniae and the first report of targeting the recently identified ADP-ribosylating toxin gene encoding the CARDS (community-acquired respiratory distress syndrome) toxin for real-time PCR detection. Multiple TaqMan primer/probe sets targeting the ATPase gene (accession U) and the CARDS toxin gene (accession DQ0) of M. pneumoniae were designed using Primer Express v.0 (Applied Biosystems, Foster City, CA) (). The real-time PCR mixture was prepared in a total volume of ul. Each PCR mixture contained the following per reaction: 1. ul of Platinum Quantitative PCR SuperMix- UDG (Invitrogen, cat# 0-0), 1. ul of 0 mm MgCl, 0. um final concentrations of each primer, 0.1 um final concentration of the probe, 1. U Platinum Taq DNA Polymerase (Invitrogen, cat# -0, U/ul), 1 ul of mm PCR Nucleotide Mix (Promega cat# C1), ul of extracted nucleic acid from each specimen and nucleasefree water (Promega, cat# P) to ul final volume. Real-time PCR for each target Downloaded from on May, 01 by guest

5 was performed using the ABI 00 (Applied Biosystems, cat# 0) with the following conditions: initial activation of 0 C-min., followed by cycles of 0 C- sec., 0 0 C 0sec. After thorough analysis and evaluation of the primer/probe sets, which involved BLAST searches, one toxin (Mp) and two ATPase (Mp, Mp) gene targets were selected based upon specificity and sensitivity performance and optimized to achieve optimal efficiency (Table 1). Each assay demonstrated >% efficiency, calculated using a standardized dilution series of quantitated DNA of M. pneumoniae tested in six replicates over six logs (0pg-1fg). The average from these data is reported as the square of the coefficient of regression values (efficiency) in Table 1. sensitivity of each assay was determined by extracting a series of dilutions from quantitated stocks of both prototypical strains of M. pneumoniae, M1 (type I) and FH (type ) using ChargeSwitch gdna Mini Bacteria Kit (Invitrogen, cat# CS01) following manufacturer s instructions. The CFU/ml of each dilution was determined using the hemolytic plaque formation procedure as previously described (). The Each dilution was then tested with each assay in six replicates and values are reported in Table 1 as total CFUs detected within each real-time PCR reaction. Mp consistently detected between 1- CFUs, while both Mp and Mp were slightly less sensitive, detecting -0 CFUs. Each assay was also tested for specificity with an extensive bacterial and viral pathogen panel and showed no cross-reactivity (Table ). These assays were used to identify a recent M. pneumoniae outbreak within a college setting. A total of respiratory samples (oropharyngeal/nasopharyngeal swabs) from patients (n=) and negative controls (n=1) ages 1 to years (mean 1.) were tested in triplicate with each M. pneumoniae specific assay (Mp, Mp, and Mp) Downloaded from on May, 01 by guest

6 along with an RNaseP internal control to ensure proper nucleic acid extraction and integrity. The data in Table demonstrate that 1 of pneumonia cases (~1%), defined as fever (> 0. 0 F) and cough or pneumonia diagnosed by chest x-ray or clinical examination during a 1-week outbreak period, were positive with all three signature sequences. Of note, Mp routinely exhibited earlier Ct values than both Mp and Mp (p < and p = 0.0, respectively, following student s t test), concordant with the sensitivity data of Table 1. The Ct values ranged from ~ to ~, depending on the target, and displayed a typical sigmoidal curve similar to positive controls, as did all RNaseP assays (data not shown). All negative controls (defined as age-matched asymptomatic subjects within the same population) and samples from 1 patients demonstrated no reactivity with any of the M. pneumoniae specific markers but had positive RNase P signals (data not shown). The lack of PCR reactivity in the 1 cases may reflect an infection with a different pathogen or poor sample quality. Serum samples were collected on a limited number of subjects and proved to be of little value for diagnosis. Serological assays are often unreliable due to specificity and sensitivity limitations and the documented persistence of antibodies in patients (). This study evaluated three real-time PCR assays targeting the ATPase and newly described CARDS toxin genes during a recent outbreak for the purposes of assessing its utility in such instances. Although other real-time PCR assays for the detection of M. pneumoniae have been reported, none have been applied to an investigation involving an outbreak. Interestingly, the assay targeting the CARDS toxin gene (Mp) proved to be the most sensitive in identifying positive specimens during this outbreak and has been subsequently used to positively identify M. pneumoniae DNA in other specimens Downloaded from on May, 01 by guest

7 1 1 (respiratory and CSF) in sporadic cases. These data support the use of the Mp assay as an initial screening marker for detecting the presence of M. pneumoniae DNA in respiratory clinical specimens, although the inclusion of Mp and Mp may provide an increased level of confidence for the reporting of results. The use of these assays may allow for the rapid identification of an M. pneumoniae outbreak at the local and state levels if testing is implemented in a timely manner. Further investigation of each assay may be warranted for possible use in clinical practice. We thank Lauri Hicks, Nick Walter, Gavin Grant, and Utpala Bandy for providing specimens and helpful discussions surrounding this report. We also thank Lauri Hicks for critical review of the manuscript and Bernard J. Wolff for assistance with statistical analysis. Downloaded from on May, 01 by guest

8 References 1. Alexander, N. E., H. Jordan, J. Sejvar, J. Winchell, K. Thurman, N. D. Walter, L. Hicks, U. Bandy, and P. Dennehy. 00. Mycoplasma pneumoniae Neurological Disease Associated with a Community Respiratory Outbreak Rhode Island, Program and abstracts of the th Infectious Diseases Society of America Annual Conference.. Cunha, B. A. 00. The atypical pneumonias: clinical diagnosis and importance. Clinical Microbiology and Infection 1:1-.. Daxboeck, F., R. Krause, and C. Wenisch. 00. Laboratory diagnosis of Mycoplasma pneumoniae infection. Clinical Microbiology and Infection :-.. Dorigo-Zetsma, J. W., R. P. Verkooyen, H. P. Van Helden, H. Van Der Nat, and J. Van Den Bosch Molecular detection of Mycoplasma pneumoniae in adults with community-acquired pneumonia requiring hospitalization. Journal of Clinical Microbiology :-. Downloaded from on May, 01 by guest Gullsby, K., M. Storm, and K. Bondeson. 00. Simultaneous Detection of Chlamydophila pneumoniae and Mycoplasma pneumoniae by Use of Molecular Beacons in a Duplex Real-Time PCR. Journal of Clinical Microbiology :- 1.

9 Hedreyda, C. T. and D. C. Krause. 1. Identification of a possible cytadherence regulatory locus in Mycoplasma pneumoniae. Infection and Immunity :-.. Hyde, T. B., M. Gilbert, S. Schwartz, R. Zell, J. Watt, W. L. Thacker, D. F. Talkington, and R. Besser Azithromycin prophylaxis during a hospital outbreak of Mycoplasma pneumoniae pneumonia. The Journal of Infectious Diseases 1:0-1.. Kannan, T. R. and J. B. Baseman. 00. ADP-ribosylating and vacuolating cytotoxin of Mycoplasma pneumoniae represents unique virulence determinant among bacterial pathogens. Proceedings of the National Academy of Sciences of the United States of America :-.. Klausner, J. D., D. Passaro, J. Rosenberg, W. L. Thacker, D. F. Talkington, S. B. Werner, and D. J. Vugia. 1. Enhanced control of an outbreak of Mycoplasma pneumoniae pneumonia with azithromycin prophylaxis. The Journal of Infectious Diseases 1:-1.. Klement, E., D. F. Talkington, O. Wasserzug, R. Kayouf, N. Davidovitch, R. Dumke, Y. Bar-Zeev, R. Merav, J. Boxman, W. L. Thacker, D. Wolf, T. Lazarovich, Y. Shemer-Avni, D. Glikman, E. Jacobs, I. Grotto, C. Block, and R. Nir-Paz. 00. Identification of risk factors for infection in an outbreak of Mycoplasma pneumoniae respiratory tract disease. Clinical Infectious Diseases :1-1. Downloaded from on May, 01 by guest

10 Loens, K., D. Ursi, H. Goossens, and M. Ieven. 00. Molecular Diagnosis of Mycoplasma pneumoniae Respiratory Tract Infections. Journal of Clinical Microbiology 1: Mezarina, K. B., A. Huffmire, J. Downing, N. Core, K. Gershman, and R. Hoffman Outbreak of Community-Acquired Pneumonia Caused by Mycoplasma pneumoniae - Colorado 000. MMWR 0: Pitcher, D., V. J. Chalker, C. Sheppard, R. C. George, and T. G. Harrison. 00. Real-time detection of Mycoplasma pneumoniae in respiratory samples with an internal processing control. Journal of Medical Microbiology : Saito, R., Y. Misawa, K. Moriya, K. Koike, K. Ubukata, and N. Okamura. 00. Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of Mycoplasma pneumoniae. Journal of Medical Microbiology : Tsiodras, S., I. Kelesidis, T. Kelesidis, E. Stamboulis, and H. Giamarellou. 00. Central nervous system manifestations of Mycoplasma pneumoniae infections. Journal of Infection 1:-. Downloaded from on May, 01 by guest Waites, K. B. and D. F. Talkington. 00. Mycoplasma pneumoniae and Its Role as a Human Pathogen. Clinical Microbiology Reviews 1: Walter, N. D., G. Grant, J. Winchell, S. Schwartz, N. Alexander, U. Bandy, and M. Moore. 00. Community outbreak of Mycoplasma pneumoniae - Rhode

11 Island, 00. Program and Abstracts of the th Infectious Diseases Society of America Annual Conference. 1. Waring, A. L., T. A. Halse, C. K. Csiza, C. J. Carlyn, K. A. Musser, and R. J. Limberger Development of a Genomics-Based PCR Assay for Detection of Mycoplasma pneumoniae in a Large Outbreak in New York State. Journal of Clinical Microbiology :1-10. Downloaded from on May, 01 by guest

12 Table 1. Primers and probes for real-time amplification of M. pneumoniae targets Primer / Sequence ( ) Gene Target Product Efficiency Sensitivity Probe 1 (bp) Mp-F Mp-R Mp-P Mp-F Mp-R Mp-P Mp-F Mp-R Mp-P tttggtagctggttacgggaat ggtcggcacgaatttcatataag tgtaccagagcaccccagaagggct cgatctatgtgccagctgatga agcatccaggtgggtaaaggt ttgactgaccccgctccggc actaacaattaccgtgcttacaatgaa ccacacctttgtcttggatcac actctt(t)gccaaccaacaaaacgag tcct CARDS Tx 0. ~1- CFU ATPase 0.1 ~-0 CFU ATPase 0. ~-0 CFU 1 probes were labeled with FAM and BHQ1 except for Mp-P which was internally quenched with BHQ1 on the (t). CARDS Tx, Community-acquired respiratory distress syndrome toxin Downloaded from on May, 01 by guest 1

13 Table. Specificity panel of organisms tested for cross reactivity 1 Mycoplasma faucium Chlamydia trachomatis Mycoplasma lipophilum Chlamydophila psittaci Mycoplasma salivarium Chlamydophila pneumoniae Mycoplasma pirum Streptococcus pyogenes Mycoplasma orale Haemophilus influenzae Mycoplasma penetrans Neisseria elongata Mycoplasma genitalium Pseudomonas aeruginosa Mycoplasma hominis Moraxella catarrhalis Mycoplasma fermentans Mycobacterium tuberculosis Mycoplasma buccale Candida albicans Mycoplasma arginini Escherichia coli Mycoplasma hyorhinis Staphylococcus aureus Mycoplasma amphoriforme Ureaplasma parvum Lactobacillus planitarium Human DNA Corynebacterium diphtheriae Human Coronavirus Staphylococcus epidermidis Human rhinovirus Coxiella burnetii Human parainfluenza virus Streptococcus salivarius Human parainfluenza virus Bordetella pertussis Human adenovirus Legionella pneumophila Influenza virus A Legionella longbeachae Influenza virus B Streptococcus pneumoniae Respiratory syncytial virus A Ureaplasma urealyticum Respiratory syncytial virus B Neisseria meningitidis 1 All targets were tested with at least 1ng of nucleic acid Downloaded from on May, 01 by guest 1

14 Table. Average Ct values for Mp, Mp and Mp from clinically defined cases of pneumonia with positive real-time PCR data 1 Case number Mp C t +/- S.D. Mp C t +/- S.D. Mp C t +/- S.D. 1. +/ / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / / /- 0/0 1. +/ / / N/D N/D 1 Total number of samples tested = ; total number of pneumonia cases = ; total number negative controls = 1; total number of PCR negative cases = 1. All samples were tested in triplicate for each marker except case # 1 which contained limited sample volume. Ct = Crossing threshold not done Downloaded from on May, 01 by guest 1