Networks of gene expression and brain function

Size: px
Start display at page:

Download "Networks of gene expression and brain function"

Transcription

1 Networks of gene expression and brain function OHBM 25 June 2017 VILAS MENON HHMI JANELIA RESEARCH CAMPUS

2 Introduction to Imaging Genetics A brief history of imaging genetics JB Poline The modern day endophenotype Roberto Toro Networks of gene expression & brain function Vilas Menon Utilizing big datasets in imaging genetics Derrek Hibar Rare variant associations David Glahn Imaging Epigenetics Sylvane Desrivieres After the association Jason Stein

3 Outline Gene expression overview Relating gene expression to functional imaging networks Richiardi, Altmann et al. (2015) & Hawrylycz et al. (2016) Linking functional connectomes to gene co-expression Wang et al. (2015) Linking gene expression to the default mode network Summary and Interpretations

4 Gene expression overview Quantification of messenger RNA in a biological sample Genome Dictionary Genes Words Gene expression profile Story

5 Relating imaging and gene expression data Samples/Regions Imaging-based parcellation Genes Map gene expression samples to imaging-based coordinates Region Region Gene expression Region Imaging metric Gene expression Correlate quantified gene expression and imaging-derived metric Region Region

6 Relating gene expression to brain region inter-connectivity

7 Gene expression and imaging data sets Internally generated functional Imaging data set Gene expression: Allen Human Brain Atlas (brain-map.org) 6 brains, ~500 tissue samples/brain Human Connectome Project (hummanconnectome.org)

8 Aligning functional imaging and gene expression data Richiardi, Altmann, et al. (2015)

9 Identifying genes correlated with connectivity Strength fraction = Sum of gene expression correlations of samples within a functional network Sum of gene expression correlations of samples not in a functional network Generate consensus list of genes most strongly contributing to significant strength fraction Richiardi, Altmann, et. al (2015)

10 Examining consensus genes in other contexts Validation on IMAGEN data set, showing connectivity differences between 20 individuals with highest and lowest genetic score based on consensus list of genes Examination of mouse structural connection weights (Allen Mouse Connectivity Atlas) and gene expression using consensus list of gens Richiardi, Altmann, et al. (2015)

11 Examining genes with conserved expression across individuals Differentially stable genes segregate into network modules/clusters with region- and cell type-specific patterns PCDH8 shows stable differential expression pattern across 6 brains Hawrylycz et al. (2016)

12 Conserved genes tend to be more related to functional connectivity Hawrylycz et al. (2016)

13 Relating gene expression to the default mode network falff = fractional amplitude of low-frequency ( Hz) fluctuations Wang et al. (2015)

14 How is gene expression correlated with the DMN? Significant genes are enriched in neurons Wang et al. (2015) Genes downregulated in ASD (Voineagu et al. 2011) are also represented in this set

15 Main findings Significant correlations exist between gene expression and functional connectivity These genes tend to be ion channel/brain specific, and are often associated with disease Variation in these genes is associated with changes in functional connectivity Genes with conserved expression patterns across individuals tend to be correlated more strongly to connectivity Possible interpretations: 1. Gene products are responsible for establishing and maintaining functional networks 2. Network mechanisms may drive expression of these genes 3. Neurons participating in networks may express these genes

16 What have we learned? The field is wide open initial conclusions are very broad On the horizon: Re-analyzing relationships using new image-based parcellations Incorporating higher resolution measurements (single-cell gene expression, better imaging, etc.) Addressing individual and network/task-level variability Linking gene expression to brain endophenotypes Extending analysis to subcortical regions

Computational Approaches to Transcriptome Signatures in the Human Brain

Computational Approaches to Transcriptome Signatures in the Human Brain Computational Approaches to Transcriptome Signatures in the Human Brain Agilent Technologies eseminar February 18, 2016 Mike Hawrylycz, Ph.D. ALLEN Adult Human Atlas Online tools An Anatomic Transcriptional

More information

Gene co-expression networks in the mouse, monkey, and human brain July 16, Jeremy Miller Scientist I

Gene co-expression networks in the mouse, monkey, and human brain July 16, Jeremy Miller Scientist I Gene co-expression networks in the mouse, monkey, and human brain July 16, 2013 Jeremy Miller Scientist I jeremym@alleninstitute.org Outline 1. Brief introduction to previous WGCNA studies in brain 2.

More information

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16

38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and

More information

Avalanche dynamics and the human connectome

Avalanche dynamics and the human connectome Avalanche dynamics and the human connectome J. Matias Palva Neuroscience Center, University of Helsinki http://www.helsinki.fi/neurosci/groups/palva.html matias.palva@helsinki.fi Three tiers of systems

More information

Ambient temperature regulated flowering time

Ambient temperature regulated flowering time Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis

More information

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Results. Abstract. Introduc4on. Conclusions. Methods. Funding . expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole

More information

ARTICLE A Self-Study Tutorial using the Allen Brain Explorer and Brain Atlas to Teach Concepts of Mammalian Neuroanatomy and Brain Function

ARTICLE A Self-Study Tutorial using the Allen Brain Explorer and Brain Atlas to Teach Concepts of Mammalian Neuroanatomy and Brain Function ARTICLE A Self-Study Tutorial using the Allen Brain Explorer and Brain Atlas to Teach Concepts of Mammalian Neuroanatomy and Brain Function Bruce G. Jenks Donders Institute for Brain, Cognition and Behaviour,

More information

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis

A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies

More information

Brain mapping 2.0: Putting together fmri datasets to map cognitive ontologies to the brain. Bertrand Thirion

Brain mapping 2.0: Putting together fmri datasets to map cognitive ontologies to the brain. Bertrand Thirion Brain mapping 2.0: Putting together fmri datasets to map cognitive ontologies to the brain Bertrand Thirion bertrand.thirion@inria.fr 1 Outline Introduction: statistical inference in neuroimaging and big

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016

Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators

More information

Conserved properties of dentate gyrus neurogenesis across postnatal development revealed by single-cell RNA sequencing

Conserved properties of dentate gyrus neurogenesis across postnatal development revealed by single-cell RNA sequencing SUPPLEMENTARY INFORMATION Resource https://doi.org/10.1038/s41593-017-0056-2 In the format provided by the authors and unedited. Conserved properties of dentate gyrus neurogenesis across postnatal development

More information

22 BIOMEDICAL COMPUTATION REVIEW Summer

22 BIOMEDICAL COMPUTATION REVIEW Summer 22 BIOMEDICAL COMPUTATION REVIEW Summer 2015 www.biomedicalcomputationreview.org In an oft-cited story, six blind men each touch an elephant to describe its essential nature. The one who touches the tail

More information

ZNZ Annual Symposium 2017

ZNZ Annual Symposium 2017 ZNZ Annual Symposium 2017 Thursday, 14 September 2017 UZH Central Campus, Lecture Hall HAH E3, Häldeliweg 2, Zurich 8:30 8:45 Introduction Prof. Fritjof Helmchen, Director ZNZ 8:45 9:30 Volker-Henn Lecture

More information

The Epigenome Tools 2: ChIP-Seq and Data Analysis

The Epigenome Tools 2: ChIP-Seq and Data Analysis The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview

More information

Obstacles and challenges in the analysis of microrna sequencing data

Obstacles and challenges in the analysis of microrna sequencing data Obstacles and challenges in the analysis of microrna sequencing data (mirna-seq) David Humphreys Genomics core Dr Victor Chang AC 1936-1991, Pioneering Cardiothoracic Surgeon and Humanitarian The ABCs

More information

Ginkgo Interactive analysis and quality assessment of single-cell CNV data

Ginkgo Interactive analysis and quality assessment of single-cell CNV data Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael

More information

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles

ChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap

More information

Chapter 1. Introduction

Chapter 1. Introduction Chapter 1 Introduction 1.1 Motivation and Goals The increasing availability and decreasing cost of high-throughput (HT) technologies coupled with the availability of computational tools and data form a

More information

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing

Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not

More information

Conditional spectrum-based ground motion selection. Part II: Intensity-based assessments and evaluation of alternative target spectra

Conditional spectrum-based ground motion selection. Part II: Intensity-based assessments and evaluation of alternative target spectra EARTHQUAKE ENGINEERING & STRUCTURAL DYNAMICS Published online 9 May 203 in Wiley Online Library (wileyonlinelibrary.com)..2303 Conditional spectrum-based ground motion selection. Part II: Intensity-based

More information

Overview. Fundamentals of functional MRI. Task related versus resting state functional imaging for sensorimotor mapping

Overview. Fundamentals of functional MRI. Task related versus resting state functional imaging for sensorimotor mapping Functional MRI and the Sensorimotor System in MS Nancy Sicotte, MD, FAAN Professor and Vice Chair Director, Multiple Sclerosis Program Director, Neurology Residency Program Cedars-Sinai Medical Center

More information

Workgroup Webinar Tuesday, May 26, :00 p.m.

Workgroup Webinar Tuesday, May 26, :00 p.m. NIDA Strategic Planning Gene x Environment x Development Interactions (GEDI) Co-Chairs: Naimah Weinberg and Jonathan Pollock SPB Coordinator: Michele Rankin Workgroup Webinar Tuesday, May 26, 2015 3:00

More information

Correlation, Coherence and Causality

Correlation, Coherence and Causality Connectivity Analysis Correlation, Coherence and Causality Albert C. Yang, M.D., Ph.D. Beth Israel Deaconess Medical Center Harvard Medical School, Boston, USA Aug 10, 2018 cyang1@bidmc.harvard.edu Connectivity

More information

RNA-seq Introduction

RNA-seq Introduction RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated

More information

BST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis

BST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)

More information

Introduction to Systems Biology of Cancer Lecture 2

Introduction to Systems Biology of Cancer Lecture 2 Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology

More information

Genome - Wide Linkage Mapping

Genome - Wide Linkage Mapping Biological Sciences Initiative HHMI Genome - Wide Linkage Mapping Introduction This activity is based on the work of Dr. Christine Seidman et al that was published in Circulation, 1998, vol 97, pgs 2043-2048.

More information

A Quick-Start Guide for rseqdiff

A Quick-Start Guide for rseqdiff A Quick-Start Guide for rseqdiff Yang Shi (email: shyboy@umich.edu) and Hui Jiang (email: jianghui@umich.edu) 09/05/2013 Introduction rseqdiff is an R package that can detect differential gene and isoform

More information

Pain Management Pathway Redesign. Briefing on Patient Journey Mapping approach to patient interviews

Pain Management Pathway Redesign. Briefing on Patient Journey Mapping approach to patient interviews Pain Management Pathway Redesign Briefing on Patient Journey Mapping approach to patient interviews Purpose This proposal outlines the approach being undertaken to capture and report patient experience

More information

Network-based pattern recognition models for neuroimaging

Network-based pattern recognition models for neuroimaging Network-based pattern recognition models for neuroimaging Maria J. Rosa Centre for Neuroimaging Sciences, Institute of Psychiatry King s College London, UK Outline Introduction Pattern recognition Network-based

More information

The genetics of complex traits Amazing progress (much by ppl in this room)

The genetics of complex traits Amazing progress (much by ppl in this room) The genetics of complex traits Amazing progress (much by ppl in this room) Nick Martin Queensland Institute of Medical Research Brisbane Boulder workshop March 11, 2016 Genetic Epidemiology: Stages of

More information

ApoE, Brain Networks and Behavior: A Cautionary Tale

ApoE, Brain Networks and Behavior: A Cautionary Tale ApoE, Brain Networks and Behavior: A Cautionary Tale Michael Greicius, MD Functional Imaging in Neuropsychiatric Disorders (FIND) Lab Department of Neurology and Neurological Sciences Stanford University

More information

Studying Alternative Splicing

Studying Alternative Splicing Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology

More information

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data

Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Electrophysiologic approaches to delirium. Overview

Electrophysiologic approaches to delirium. Overview Electrophysiologic approaches to delirium Alvaro Pascual Leone, MD, PhD Mouhsin Shafi, MD, PhD Overview Overview of the problem and techniques Electrophysiological studies in delirium Electrophysiological

More information

The modular and integrative functional architecture of the human brain

The modular and integrative functional architecture of the human brain The modular and integrative functional architecture of the human brain Maxwell A. Bertolero a,b,1, B. T. Thomas Yeo c,d,e,f, and Mark D Esposito a,b a Helen Wills Neuroscience Institute, University of

More information

Analysis of in-vivo extracellular recordings. Ryan Morrill Bootcamp 9/10/2014

Analysis of in-vivo extracellular recordings. Ryan Morrill Bootcamp 9/10/2014 Analysis of in-vivo extracellular recordings Ryan Morrill Bootcamp 9/10/2014 Goals for the lecture Be able to: Conceptually understand some of the analysis and jargon encountered in a typical (sensory)

More information

ChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs

ChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs ChIP-seq hands-on Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs Main goals Becoming familiar with essential tools and formats Visualizing and contextualizing raw data Understand

More information

Tutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures

Tutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures : RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures March 15, 2013 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com

More information

ANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich

ANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich ANALYTISCHE STRATEGIE Tissue Imaging Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich Quantitative Breast single cancer cell analysis Switzerland Brain Breast Lung Colon-rectum

More information

SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses

SUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes,

More information

Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project

Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more

More information

High AU content: a signature of upregulated mirna in cardiac diseases

High AU content: a signature of upregulated mirna in cardiac diseases https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High

More information

Building on Our Strengths

Building on Our Strengths Association of Local Public Health Agencies 2014-16 Strategic Plan Building on Our Strengths Promoting Representing Enriching Supporting Connecting INTRODUCTION This document outlines elements in alpha

More information

User Guide. Protein Clpper. Statistical scoring of protease cleavage sites. 1. Introduction Protein Clpper Analysis Procedure...

User Guide. Protein Clpper. Statistical scoring of protease cleavage sites. 1. Introduction Protein Clpper Analysis Procedure... User Guide Protein Clpper Statistical scoring of protease cleavage sites Content 1. Introduction... 2 2. Protein Clpper Analysis Procedure... 3 3. Input and Output Files... 9 4. Contact Information...

More information

Interactive analysis and quality assessment of single-cell copy-number variations

Interactive analysis and quality assessment of single-cell copy-number variations Interactive analysis and quality assessment of single-cell copy-number variations Tyler Garvin, Robert Aboukhalil, Jude Kendall, Timour Baslan, Gurinder S. Atwal, James Hicks, Michael Wigler, Michael C.

More information

Nature Neuroscience doi: /nn Supplementary Figure 1. Characterization of viral injections.

Nature Neuroscience doi: /nn Supplementary Figure 1. Characterization of viral injections. Supplementary Figure 1 Characterization of viral injections. (a) Dorsal view of a mouse brain (dashed white outline) after receiving a large, unilateral thalamic injection (~100 nl); demonstrating that

More information

Inferring Biological Meaning from Cap Analysis Gene Expression Data

Inferring Biological Meaning from Cap Analysis Gene Expression Data Inferring Biological Meaning from Cap Analysis Gene Expression Data HRYSOULA PAPADAKIS 1. Introduction This project is inspired by the recent development of the Cap analysis gene expression (CAGE) method,

More information

The human brain. of cognition need to make sense gives the structure of the brain (duh). ! What is the basic physiology of this organ?

The human brain. of cognition need to make sense gives the structure of the brain (duh). ! What is the basic physiology of this organ? The human brain The human brain! What is the basic physiology of this organ?! Understanding the parts of this organ provides a hypothesis space for its function perhaps different parts perform different

More information

Genetic alterations of histone lysine methyltransferases and their significance in breast cancer

Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the

More information

Actions in the Eye: Dynamic Gaze Datasets and Learnt Saliency Models for Visual Recognition

Actions in the Eye: Dynamic Gaze Datasets and Learnt Saliency Models for Visual Recognition Actions in the Eye: Dynamic Gaze Datasets and Learnt Saliency Models for Visual Recognition Stefan Mathe, Cristian Sminchisescu Presented by Mit Shah Motivation Current Computer Vision Annotations subjectively

More information

Broad Integration of Expression Maps and Co-Expression Networks Compassing Novel Gene Functions in the Brain

Broad Integration of Expression Maps and Co-Expression Networks Compassing Novel Gene Functions in the Brain Supplementary Information Broad Integration of Expression Maps and Co-Expression Networks Compassing Novel Gene Functions in the Brain Yuko Okamura-Oho a, b, *, Kazuro Shimokawa c, Masaomi Nishimura b,

More information

Autism Pathways Analysis: A Functional Framework and Clues for Further Investigation. Martha Herbert PhD MD Ya Wen PhD July 2016

Autism Pathways Analysis: A Functional Framework and Clues for Further Investigation. Martha Herbert PhD MD Ya Wen PhD July 2016 Autism Pathways Analysis: A Functional Framework and Clues for Further Investigation Martha Herbert PhD MD Ya Wen PhD July 2016 1 Report on pathway network analyses in autism, based on open-access paper

More information

Protein Reports CPTAC Common Data Analysis Pipeline (CDAP)

Protein Reports CPTAC Common Data Analysis Pipeline (CDAP) Protein Reports CPTAC Common Data Analysis Pipeline (CDAP) v. 05/03/2016 Summary The purpose of this document is to describe the protein reports generated as part of the CPTAC Common Data Analysis Pipeline

More information

Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory

Computational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA

More information

Sum of Neurally Distinct Stimulus- and Task-Related Components.

Sum of Neurally Distinct Stimulus- and Task-Related Components. SUPPLEMENTARY MATERIAL for Cardoso et al. 22 The Neuroimaging Signal is a Linear Sum of Neurally Distinct Stimulus- and Task-Related Components. : Appendix: Homogeneous Linear ( Null ) and Modified Linear

More information

Inhibition of DYRK1A stimulates human beta-cell proliferation

Inhibition of DYRK1A stimulates human beta-cell proliferation Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns

More information

A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain

A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain Viruses 2009, 1, 1204-1208; doi:10.3390/v1031204 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Article A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza

More information

Lecture: Introduction to nervous system development

Lecture: Introduction to nervous system development Lecture: Introduction to nervous system development Prof. Ilan Davis, Department of Biochemistry. Wellcome Senior Research Fellow Senior Research Fellow, Jesus College ilan.davis@bioch.ox.ac.uk http://www.ilandavis.com

More information

RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome

RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome How do novel structures or functions evolve? A more relevant example Symbiosis and Nitrogen Fixation Limpens & Bisseling (23) Curr. Opin.

More information

Supplementary Figure 1

Supplementary Figure 1 Supplementary Figure 1 a Location of GUUUCA motif relative to RNA position 4e+05 3e+05 Reads 2e+05 1e+05 0e+00 35 40 45 50 55 60 65 Distance upstream b 1: Egg 2: L3 3: Adult 4: HES 4e+05 3e+05 2e+05 start

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive

More information

Postmortem brain transcriptomes in Dup15q and idiopathic autism. T Grant Belgard, DPhil Dan Geschwind s Lab UCLA Neuropsychiatric Institute

Postmortem brain transcriptomes in Dup15q and idiopathic autism. T Grant Belgard, DPhil Dan Geschwind s Lab UCLA Neuropsychiatric Institute Postmortem brain transcriptomes in Dup15q and idiopathic autism T Grant Belgard, DPhil Dan Geschwind s Lab UCLA Neuropsychiatric Institute Many genetic causes of autism, none particularly dominant Is there

More information

10 NEW WAYS TO PEER INTO YOUR BRAIN

10 NEW WAYS TO PEER INTO YOUR BRAIN 10 NEW WAYS TO PEER INTO YOUR BRAIN page 42 MIND BEHAVIOR BRAIN SCIENCE INSIGHTS November/December 2011 www.scientificamerican.com/mind GREAT IDEA! YOU MUST BE DREAMING Creatively solve problems in your

More information

Functional connectivity models: from blobs to (dynamic) networks

Functional connectivity models: from blobs to (dynamic) networks Functional connectivity models: from blobs to (dynamic) networks Dimitri Van De Ville Medical Image Processing Laboratory (MIP:lab) Institute of Bioengineering/Center for Neuroprosthetics Ecole Polytechnique

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1

Nature Neuroscience: doi: /nn Supplementary Figure 1 Supplementary Figure 1 Illustration of the working of network-based SVM to confidently predict a new (and now confirmed) ASD gene. Gene CTNND2 s brain network neighborhood that enabled its prediction by

More information

Supporting Information

Supporting Information Revisiting default mode network function in major depression: evidence for disrupted subsystem connectivity Fabio Sambataro 1,*, Nadine Wolf 2, Maria Pennuto 3, Nenad Vasic 4, Robert Christian Wolf 5,*

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

Identification of Tissue Independent Cancer Driver Genes

Identification of Tissue Independent Cancer Driver Genes Identification of Tissue Independent Cancer Driver Genes Alexandros Manolakos, Idoia Ochoa, Kartik Venkat Supervisor: Olivier Gevaert Abstract Identification of genomic patterns in tumors is an important

More information

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester

DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview

More information

Gene Finding in Eukaryotes

Gene Finding in Eukaryotes Gene Finding in Eukaryotes Jan-Jaap Wesselink jjwesselink@cnio.es Computational and Structural Biology Group, Centro Nacional de Investigaciones Oncológicas Madrid, April 2008 Jan-Jaap Wesselink jjwesselink@cnio.es

More information

Cognitive, affective, & social neuroscience

Cognitive, affective, & social neuroscience Cognitive, affective, & social neuroscience Time: Wed, 10:15 to 11:45 Prof. Dr. Björn Rasch, Division of Cognitive Biopsychology University of Fribourg 1 Content } 5.11. Introduction to imaging genetics

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47

More information

Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.

Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit

More information

Pathway Exercises Metabolism and Pathways

Pathway Exercises Metabolism and Pathways 1. Find the metabolic pathway for glycolysis. For this exercise use PlasmoDB.org Pathway Exercises Metabolism and Pathways a. Navigate to the search page for Identify Metabolic Pathways based on Pathway

More information

ORVal Short Case Study: Millennium & Doorstep Greens: Worth the investment? (Version 2.0)

ORVal Short Case Study: Millennium & Doorstep Greens: Worth the investment? (Version 2.0) ORVal Short Case Study: Millennium & Doorstep Greens: Worth the investment? (Version 2.0) Introduction The ORVal Tool is a web application (accessed at https://www.leep.exeter.ac.uk/orval) developed by

More information

The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician

The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician Part VII Recent Advances in the Genetics of Autism Spectrum Disorders Abha R. Gupta, MD, PhD Jointly

More information

Neural Signatures of Autism in High Risk Infants

Neural Signatures of Autism in High Risk Infants Neural Signatures of Autism in High Risk Infants Charles A. Nelson III, Ph.D. Professor of Pediatrics and Neuroscience Harvard Medical School Director of Research Division of Developmental Medicine Children

More information

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq)

genomics for systems biology / ISB2020 RNA sequencing (RNA-seq) RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome

More information

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Experimental design and workflow utilized to generate the WMG Protein Atlas.

Nature Biotechnology: doi: /nbt Supplementary Figure 1. Experimental design and workflow utilized to generate the WMG Protein Atlas. Supplementary Figure 1 Experimental design and workflow utilized to generate the WMG Protein Atlas. (a) Illustration of the plant organs and nodule infection time points analyzed. (b) Proteomic workflow

More information

BST227: Introduction to Statistical Genetics

BST227: Introduction to Statistical Genetics BST227: Introduction to Statistical Genetics Lecture 11: Heritability from summary statistics & epigenetic enrichments Guest Lecturer: Caleb Lareau Success of GWAS EBI Human GWAS Catalog As of this morning

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the

More information

Multi-modal Patient Cohort Identification from EEG Report and Signal Data

Multi-modal Patient Cohort Identification from EEG Report and Signal Data Multi-modal Patient Cohort Identification from EEG Report and Signal Data Travis R. Goodwin and Sanda M. Harabagiu The University of Texas at Dallas Human Language Technology Research Institute http://www.hlt.utdallas.edu

More information

Multiple Act criterion:

Multiple Act criterion: Common Features of Trait Theories Generality and Stability of Traits: Trait theorists all use consistencies in an individual s behavior and explain why persons respond in different ways to the same stimulus

More information

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.

BIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro. RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant

More information

SUPPLEMENTARY FIGURE LEGENDS

SUPPLEMENTARY FIGURE LEGENDS SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between

More information

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015

Computer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015 Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a

More information

Human Genetics 542 Winter 2018 Syllabus

Human Genetics 542 Winter 2018 Syllabus Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis

More information

Graph Theory. Steffie Tomson UCLA NITP 2013

Graph Theory. Steffie Tomson UCLA NITP 2013 Graph Theory Steffie Tomson UCLA NITP 2013 What is graph theory? Mathematical descriptions of relationships between regions Node Opsahl et al. 2010 Why use graphs? Nodal Measures: Participation Coefficient

More information

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1

Nature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1 Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency

More information

Supplemental Information For: The genetics of splicing in neuroblastoma

Supplemental Information For: The genetics of splicing in neuroblastoma Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,

More information

Chapter 5: Global Analysis of the Effect of Densin. Knockout on Gene Transcription in the Brain

Chapter 5: Global Analysis of the Effect of Densin. Knockout on Gene Transcription in the Brain Chapter 5: Global Analysis of the Effect of Densin Knockout on Gene Transcription in the Brain Introduction High throughput methods for analyzing transcriptional changes in response to deletion or mutation

More information

Human Genetics 542 Winter 2017 Syllabus

Human Genetics 542 Winter 2017 Syllabus Human Genetics 542 Winter 2017 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Module I: Mapping and characterizing simple genetic diseases Jan 4 th Wed Mapping

More information

U.S. Low Dose Radiation Research Program

U.S. Low Dose Radiation Research Program U.S. Low Dose Radiation Research Program Update November 2010 ISCORS NF Metting, ScD, Program Manager Office of Science Office of Biological and Environmental Research The Department of Energy Office of

More information