Networks of gene expression and brain function
|
|
- William Carson
- 5 years ago
- Views:
Transcription
1 Networks of gene expression and brain function OHBM 25 June 2017 VILAS MENON HHMI JANELIA RESEARCH CAMPUS
2 Introduction to Imaging Genetics A brief history of imaging genetics JB Poline The modern day endophenotype Roberto Toro Networks of gene expression & brain function Vilas Menon Utilizing big datasets in imaging genetics Derrek Hibar Rare variant associations David Glahn Imaging Epigenetics Sylvane Desrivieres After the association Jason Stein
3 Outline Gene expression overview Relating gene expression to functional imaging networks Richiardi, Altmann et al. (2015) & Hawrylycz et al. (2016) Linking functional connectomes to gene co-expression Wang et al. (2015) Linking gene expression to the default mode network Summary and Interpretations
4 Gene expression overview Quantification of messenger RNA in a biological sample Genome Dictionary Genes Words Gene expression profile Story
5 Relating imaging and gene expression data Samples/Regions Imaging-based parcellation Genes Map gene expression samples to imaging-based coordinates Region Region Gene expression Region Imaging metric Gene expression Correlate quantified gene expression and imaging-derived metric Region Region
6 Relating gene expression to brain region inter-connectivity
7 Gene expression and imaging data sets Internally generated functional Imaging data set Gene expression: Allen Human Brain Atlas (brain-map.org) 6 brains, ~500 tissue samples/brain Human Connectome Project (hummanconnectome.org)
8 Aligning functional imaging and gene expression data Richiardi, Altmann, et al. (2015)
9 Identifying genes correlated with connectivity Strength fraction = Sum of gene expression correlations of samples within a functional network Sum of gene expression correlations of samples not in a functional network Generate consensus list of genes most strongly contributing to significant strength fraction Richiardi, Altmann, et. al (2015)
10 Examining consensus genes in other contexts Validation on IMAGEN data set, showing connectivity differences between 20 individuals with highest and lowest genetic score based on consensus list of genes Examination of mouse structural connection weights (Allen Mouse Connectivity Atlas) and gene expression using consensus list of gens Richiardi, Altmann, et al. (2015)
11 Examining genes with conserved expression across individuals Differentially stable genes segregate into network modules/clusters with region- and cell type-specific patterns PCDH8 shows stable differential expression pattern across 6 brains Hawrylycz et al. (2016)
12 Conserved genes tend to be more related to functional connectivity Hawrylycz et al. (2016)
13 Relating gene expression to the default mode network falff = fractional amplitude of low-frequency ( Hz) fluctuations Wang et al. (2015)
14 How is gene expression correlated with the DMN? Significant genes are enriched in neurons Wang et al. (2015) Genes downregulated in ASD (Voineagu et al. 2011) are also represented in this set
15 Main findings Significant correlations exist between gene expression and functional connectivity These genes tend to be ion channel/brain specific, and are often associated with disease Variation in these genes is associated with changes in functional connectivity Genes with conserved expression patterns across individuals tend to be correlated more strongly to connectivity Possible interpretations: 1. Gene products are responsible for establishing and maintaining functional networks 2. Network mechanisms may drive expression of these genes 3. Neurons participating in networks may express these genes
16 What have we learned? The field is wide open initial conclusions are very broad On the horizon: Re-analyzing relationships using new image-based parcellations Incorporating higher resolution measurements (single-cell gene expression, better imaging, etc.) Addressing individual and network/task-level variability Linking gene expression to brain endophenotypes Extending analysis to subcortical regions
Computational Approaches to Transcriptome Signatures in the Human Brain
Computational Approaches to Transcriptome Signatures in the Human Brain Agilent Technologies eseminar February 18, 2016 Mike Hawrylycz, Ph.D. ALLEN Adult Human Atlas Online tools An Anatomic Transcriptional
More informationGene co-expression networks in the mouse, monkey, and human brain July 16, Jeremy Miller Scientist I
Gene co-expression networks in the mouse, monkey, and human brain July 16, 2013 Jeremy Miller Scientist I jeremym@alleninstitute.org Outline 1. Brief introduction to previous WGCNA studies in brain 2.
More information38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16
38 Int'l Conf. Bioinformatics and Computational Biology BIOCOMP'16 PGAR: ASD Candidate Gene Prioritization System Using Expression Patterns Steven Cogill and Liangjiang Wang Department of Genetics and
More informationAvalanche dynamics and the human connectome
Avalanche dynamics and the human connectome J. Matias Palva Neuroscience Center, University of Helsinki http://www.helsinki.fi/neurosci/groups/palva.html matias.palva@helsinki.fi Three tiers of systems
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationResults. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationARTICLE A Self-Study Tutorial using the Allen Brain Explorer and Brain Atlas to Teach Concepts of Mammalian Neuroanatomy and Brain Function
ARTICLE A Self-Study Tutorial using the Allen Brain Explorer and Brain Atlas to Teach Concepts of Mammalian Neuroanatomy and Brain Function Bruce G. Jenks Donders Institute for Brain, Cognition and Behaviour,
More informationA Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis
A Practical Guide to Integrative Genomics by RNA-seq and ChIP-seq Analysis Jian Xu, Ph.D. Children s Research Institute, UTSW Introduction Outline Overview of genomic and next-gen sequencing technologies
More informationBrain mapping 2.0: Putting together fmri datasets to map cognitive ontologies to the brain. Bertrand Thirion
Brain mapping 2.0: Putting together fmri datasets to map cognitive ontologies to the brain Bertrand Thirion bertrand.thirion@inria.fr 1 Outline Introduction: statistical inference in neuroimaging and big
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationSession 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016
Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators
More informationConserved properties of dentate gyrus neurogenesis across postnatal development revealed by single-cell RNA sequencing
SUPPLEMENTARY INFORMATION Resource https://doi.org/10.1038/s41593-017-0056-2 In the format provided by the authors and unedited. Conserved properties of dentate gyrus neurogenesis across postnatal development
More information22 BIOMEDICAL COMPUTATION REVIEW Summer
22 BIOMEDICAL COMPUTATION REVIEW Summer 2015 www.biomedicalcomputationreview.org In an oft-cited story, six blind men each touch an elephant to describe its essential nature. The one who touches the tail
More informationZNZ Annual Symposium 2017
ZNZ Annual Symposium 2017 Thursday, 14 September 2017 UZH Central Campus, Lecture Hall HAH E3, Häldeliweg 2, Zurich 8:30 8:45 Introduction Prof. Fritjof Helmchen, Director ZNZ 8:45 9:30 Volker-Henn Lecture
More informationThe Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
More informationObstacles and challenges in the analysis of microrna sequencing data
Obstacles and challenges in the analysis of microrna sequencing data (mirna-seq) David Humphreys Genomics core Dr Victor Chang AC 1936-1991, Pioneering Cardiothoracic Surgeon and Humanitarian The ABCs
More informationGinkgo Interactive analysis and quality assessment of single-cell CNV data
Ginkgo Interactive analysis and quality assessment of single-cell CNV data @RobAboukhalil Robert Aboukhalil, Tyler Garvin, Jude Kendall, Timour Baslan, Gurinder S. Atwal, Jim Hicks, Michael Wigler, Michael
More informationChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles
ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap
More informationChapter 1. Introduction
Chapter 1 Introduction 1.1 Motivation and Goals The increasing availability and decreasing cost of high-throughput (HT) technologies coupled with the availability of computational tools and data form a
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationConditional spectrum-based ground motion selection. Part II: Intensity-based assessments and evaluation of alternative target spectra
EARTHQUAKE ENGINEERING & STRUCTURAL DYNAMICS Published online 9 May 203 in Wiley Online Library (wileyonlinelibrary.com)..2303 Conditional spectrum-based ground motion selection. Part II: Intensity-based
More informationOverview. Fundamentals of functional MRI. Task related versus resting state functional imaging for sensorimotor mapping
Functional MRI and the Sensorimotor System in MS Nancy Sicotte, MD, FAAN Professor and Vice Chair Director, Multiple Sclerosis Program Director, Neurology Residency Program Cedars-Sinai Medical Center
More informationWorkgroup Webinar Tuesday, May 26, :00 p.m.
NIDA Strategic Planning Gene x Environment x Development Interactions (GEDI) Co-Chairs: Naimah Weinberg and Jonathan Pollock SPB Coordinator: Michele Rankin Workgroup Webinar Tuesday, May 26, 2015 3:00
More informationCorrelation, Coherence and Causality
Connectivity Analysis Correlation, Coherence and Causality Albert C. Yang, M.D., Ph.D. Beth Israel Deaconess Medical Center Harvard Medical School, Boston, USA Aug 10, 2018 cyang1@bidmc.harvard.edu Connectivity
More informationRNA-seq Introduction
RNA-seq Introduction DNA is the same in all cells but which RNAs that is present is different in all cells There is a wide variety of different functional RNAs Which RNAs (and sometimes then translated
More informationBST227 Introduction to Statistical Genetics. Lecture 4: Introduction to linkage and association analysis
BST227 Introduction to Statistical Genetics Lecture 4: Introduction to linkage and association analysis 1 Housekeeping Homework #1 due today Homework #2 posted (due Monday) Lab at 5:30PM today (FXB G13)
More informationIntroduction to Systems Biology of Cancer Lecture 2
Introduction to Systems Biology of Cancer Lecture 2 Gustavo Stolovitzky IBM Research Icahn School of Medicine at Mt Sinai DREAM Challenges High throughput measurements: The age of omics Systems Biology
More informationGenome - Wide Linkage Mapping
Biological Sciences Initiative HHMI Genome - Wide Linkage Mapping Introduction This activity is based on the work of Dr. Christine Seidman et al that was published in Circulation, 1998, vol 97, pgs 2043-2048.
More informationA Quick-Start Guide for rseqdiff
A Quick-Start Guide for rseqdiff Yang Shi (email: shyboy@umich.edu) and Hui Jiang (email: jianghui@umich.edu) 09/05/2013 Introduction rseqdiff is an R package that can detect differential gene and isoform
More informationPain Management Pathway Redesign. Briefing on Patient Journey Mapping approach to patient interviews
Pain Management Pathway Redesign Briefing on Patient Journey Mapping approach to patient interviews Purpose This proposal outlines the approach being undertaken to capture and report patient experience
More informationNetwork-based pattern recognition models for neuroimaging
Network-based pattern recognition models for neuroimaging Maria J. Rosa Centre for Neuroimaging Sciences, Institute of Psychiatry King s College London, UK Outline Introduction Pattern recognition Network-based
More informationThe genetics of complex traits Amazing progress (much by ppl in this room)
The genetics of complex traits Amazing progress (much by ppl in this room) Nick Martin Queensland Institute of Medical Research Brisbane Boulder workshop March 11, 2016 Genetic Epidemiology: Stages of
More informationApoE, Brain Networks and Behavior: A Cautionary Tale
ApoE, Brain Networks and Behavior: A Cautionary Tale Michael Greicius, MD Functional Imaging in Neuropsychiatric Disorders (FIND) Lab Department of Neurology and Neurological Sciences Stanford University
More informationStudying Alternative Splicing
Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology
More informationProcessing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data
Processing, integrating and analysing chromatin immunoprecipitation followed by sequencing (ChIP-seq) data Bioinformatics methods, models and applications to disease Alex Essebier ChIP-seq experiment To
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationElectrophysiologic approaches to delirium. Overview
Electrophysiologic approaches to delirium Alvaro Pascual Leone, MD, PhD Mouhsin Shafi, MD, PhD Overview Overview of the problem and techniques Electrophysiological studies in delirium Electrophysiological
More informationThe modular and integrative functional architecture of the human brain
The modular and integrative functional architecture of the human brain Maxwell A. Bertolero a,b,1, B. T. Thomas Yeo c,d,e,f, and Mark D Esposito a,b a Helen Wills Neuroscience Institute, University of
More informationAnalysis of in-vivo extracellular recordings. Ryan Morrill Bootcamp 9/10/2014
Analysis of in-vivo extracellular recordings Ryan Morrill Bootcamp 9/10/2014 Goals for the lecture Be able to: Conceptually understand some of the analysis and jargon encountered in a typical (sensory)
More informationChIP-seq hands-on. Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs
ChIP-seq hands-on Iros Barozzi, Campus IFOM-IEO (Milan) Saverio Minucci, Gioacchino Natoli Labs Main goals Becoming familiar with essential tools and formats Visualizing and contextualizing raw data Understand
More informationTutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures
: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures March 15, 2013 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com
More informationANALYTISCHE STRATEGIE Tissue Imaging. Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich
ANALYTISCHE STRATEGIE Tissue Imaging Bernd Bodenmiller Institute of Molecular Life Sciences University of Zurich Quantitative Breast single cancer cell analysis Switzerland Brain Breast Lung Colon-rectum
More informationSUPPLEMENTARY INFORMATION. Rett Syndrome Mutation MeCP2 T158A Disrupts DNA Binding, Protein Stability and ERP Responses
SUPPLEMENTARY INFORMATION Rett Syndrome Mutation T158A Disrupts DNA Binding, Protein Stability and ERP Responses Darren Goffin, Megan Allen, Le Zhang, Maria Amorim, I-Ting Judy Wang, Arith-Ruth S. Reyes,
More informationComputational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project
Computational Identification and Prediction of Tissue-Specific Alternative Splicing in H. Sapiens. Eric Van Nostrand CS229 Final Project Introduction RNA splicing is a critical step in eukaryotic gene
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
More informationHigh AU content: a signature of upregulated mirna in cardiac diseases
https://helda.helsinki.fi High AU content: a signature of upregulated mirna in cardiac diseases Gupta, Richa 2010-09-20 Gupta, R, Soni, N, Patnaik, P, Sood, I, Singh, R, Rawal, K & Rani, V 2010, ' High
More informationBuilding on Our Strengths
Association of Local Public Health Agencies 2014-16 Strategic Plan Building on Our Strengths Promoting Representing Enriching Supporting Connecting INTRODUCTION This document outlines elements in alpha
More informationUser Guide. Protein Clpper. Statistical scoring of protease cleavage sites. 1. Introduction Protein Clpper Analysis Procedure...
User Guide Protein Clpper Statistical scoring of protease cleavage sites Content 1. Introduction... 2 2. Protein Clpper Analysis Procedure... 3 3. Input and Output Files... 9 4. Contact Information...
More informationInteractive analysis and quality assessment of single-cell copy-number variations
Interactive analysis and quality assessment of single-cell copy-number variations Tyler Garvin, Robert Aboukhalil, Jude Kendall, Timour Baslan, Gurinder S. Atwal, James Hicks, Michael Wigler, Michael C.
More informationNature Neuroscience doi: /nn Supplementary Figure 1. Characterization of viral injections.
Supplementary Figure 1 Characterization of viral injections. (a) Dorsal view of a mouse brain (dashed white outline) after receiving a large, unilateral thalamic injection (~100 nl); demonstrating that
More informationInferring Biological Meaning from Cap Analysis Gene Expression Data
Inferring Biological Meaning from Cap Analysis Gene Expression Data HRYSOULA PAPADAKIS 1. Introduction This project is inspired by the recent development of the Cap analysis gene expression (CAGE) method,
More informationThe human brain. of cognition need to make sense gives the structure of the brain (duh). ! What is the basic physiology of this organ?
The human brain The human brain! What is the basic physiology of this organ?! Understanding the parts of this organ provides a hypothesis space for its function perhaps different parts perform different
More informationGenetic alterations of histone lysine methyltransferases and their significance in breast cancer
Genetic alterations of histone lysine methyltransferases and their significance in breast cancer Supplementary Materials and Methods Phylogenetic tree of the HMT superfamily The phylogeny outlined in the
More informationActions in the Eye: Dynamic Gaze Datasets and Learnt Saliency Models for Visual Recognition
Actions in the Eye: Dynamic Gaze Datasets and Learnt Saliency Models for Visual Recognition Stefan Mathe, Cristian Sminchisescu Presented by Mit Shah Motivation Current Computer Vision Annotations subjectively
More informationBroad Integration of Expression Maps and Co-Expression Networks Compassing Novel Gene Functions in the Brain
Supplementary Information Broad Integration of Expression Maps and Co-Expression Networks Compassing Novel Gene Functions in the Brain Yuko Okamura-Oho a, b, *, Kazuro Shimokawa c, Masaomi Nishimura b,
More informationAutism Pathways Analysis: A Functional Framework and Clues for Further Investigation. Martha Herbert PhD MD Ya Wen PhD July 2016
Autism Pathways Analysis: A Functional Framework and Clues for Further Investigation Martha Herbert PhD MD Ya Wen PhD July 2016 1 Report on pathway network analyses in autism, based on open-access paper
More informationProtein Reports CPTAC Common Data Analysis Pipeline (CDAP)
Protein Reports CPTAC Common Data Analysis Pipeline (CDAP) v. 05/03/2016 Summary The purpose of this document is to describe the protein reports generated as part of the CPTAC Common Data Analysis Pipeline
More informationComputational aspects of ChIP-seq. John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory
Computational aspects of ChIP-seq John Marioni Research Group Leader European Bioinformatics Institute European Molecular Biology Laboratory ChIP-seq Using highthroughput sequencing to investigate DNA
More informationSum of Neurally Distinct Stimulus- and Task-Related Components.
SUPPLEMENTARY MATERIAL for Cardoso et al. 22 The Neuroimaging Signal is a Linear Sum of Neurally Distinct Stimulus- and Task-Related Components. : Appendix: Homogeneous Linear ( Null ) and Modified Linear
More informationInhibition of DYRK1A stimulates human beta-cell proliferation
Inhibition of DYRK1A stimulates human beta-cell proliferation Ercument Dirice 1,, Deepika Walpita 2,, Amedeo Vetere 2, Bennett C. Meier 2,5, Sevim Kahraman 1, Jiang Hu 1, Vlado Dančík 2, Sean M. Burns
More informationA Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza A and the Novel Influenza A(H1N1) Strain
Viruses 2009, 1, 1204-1208; doi:10.3390/v1031204 OPEN ACCESS viruses ISSN 1999-4915 www.mdpi.com/journal/viruses Article A Novel Duplex Real-Time Reverse-Transcription PCR Assay for the Detection of Influenza
More informationLecture: Introduction to nervous system development
Lecture: Introduction to nervous system development Prof. Ilan Davis, Department of Biochemistry. Wellcome Senior Research Fellow Senior Research Fellow, Jesus College ilan.davis@bioch.ox.ac.uk http://www.ilandavis.com
More informationRNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome
RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome How do novel structures or functions evolve? A more relevant example Symbiosis and Nitrogen Fixation Limpens & Bisseling (23) Curr. Opin.
More informationSupplementary Figure 1
Supplementary Figure 1 a Location of GUUUCA motif relative to RNA position 4e+05 3e+05 Reads 2e+05 1e+05 0e+00 35 40 45 50 55 60 65 Distance upstream b 1: Egg 2: L3 3: Adult 4: HES 4e+05 3e+05 2e+05 start
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationPostmortem brain transcriptomes in Dup15q and idiopathic autism. T Grant Belgard, DPhil Dan Geschwind s Lab UCLA Neuropsychiatric Institute
Postmortem brain transcriptomes in Dup15q and idiopathic autism T Grant Belgard, DPhil Dan Geschwind s Lab UCLA Neuropsychiatric Institute Many genetic causes of autism, none particularly dominant Is there
More information10 NEW WAYS TO PEER INTO YOUR BRAIN
10 NEW WAYS TO PEER INTO YOUR BRAIN page 42 MIND BEHAVIOR BRAIN SCIENCE INSIGHTS November/December 2011 www.scientificamerican.com/mind GREAT IDEA! YOU MUST BE DREAMING Creatively solve problems in your
More informationFunctional connectivity models: from blobs to (dynamic) networks
Functional connectivity models: from blobs to (dynamic) networks Dimitri Van De Ville Medical Image Processing Laboratory (MIP:lab) Institute of Bioengineering/Center for Neuroprosthetics Ecole Polytechnique
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Atlas representations of the midcingulate (MCC) region targeted in this study compared against the anterior cingulate (ACC) region commonly reported. Coronal sections are shown on
More informationNature Neuroscience: doi: /nn Supplementary Figure 1
Supplementary Figure 1 Illustration of the working of network-based SVM to confidently predict a new (and now confirmed) ASD gene. Gene CTNND2 s brain network neighborhood that enabled its prediction by
More informationSupporting Information
Revisiting default mode network function in major depression: evidence for disrupted subsystem connectivity Fabio Sambataro 1,*, Nadine Wolf 2, Maria Pennuto 3, Nenad Vasic 4, Robert Christian Wolf 5,*
More informationIlluminating the genetics of complex human diseases
Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.
More informationIdentification of Tissue Independent Cancer Driver Genes
Identification of Tissue Independent Cancer Driver Genes Alexandros Manolakos, Idoia Ochoa, Kartik Venkat Supervisor: Olivier Gevaert Abstract Identification of genomic patterns in tumors is an important
More informationDETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING. John Archer. Faculty of Life Sciences University of Manchester
DETECTION OF LOW FREQUENCY CXCR4-USING HIV-1 WITH ULTRA-DEEP PYROSEQUENCING John Archer Faculty of Life Sciences University of Manchester HIV Dynamics and Evolution, 2008, Santa Fe, New Mexico. Overview
More informationGene Finding in Eukaryotes
Gene Finding in Eukaryotes Jan-Jaap Wesselink jjwesselink@cnio.es Computational and Structural Biology Group, Centro Nacional de Investigaciones Oncológicas Madrid, April 2008 Jan-Jaap Wesselink jjwesselink@cnio.es
More informationCognitive, affective, & social neuroscience
Cognitive, affective, & social neuroscience Time: Wed, 10:15 to 11:45 Prof. Dr. Björn Rasch, Division of Cognitive Biopsychology University of Fribourg 1 Content } 5.11. Introduction to imaging genetics
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationAssociation mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative
Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47
More informationAlternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins.
Alternative RNA processing: Two examples of complex eukaryotic transcription units and the effect of mutations on expression of the encoded proteins. The RNA transcribed from a complex transcription unit
More informationPathway Exercises Metabolism and Pathways
1. Find the metabolic pathway for glycolysis. For this exercise use PlasmoDB.org Pathway Exercises Metabolism and Pathways a. Navigate to the search page for Identify Metabolic Pathways based on Pathway
More informationORVal Short Case Study: Millennium & Doorstep Greens: Worth the investment? (Version 2.0)
ORVal Short Case Study: Millennium & Doorstep Greens: Worth the investment? (Version 2.0) Introduction The ORVal Tool is a web application (accessed at https://www.leep.exeter.ac.uk/orval) developed by
More informationThe Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician
The Amazing Brain Webinar Series: Select Topics in Neuroscience and Child Development for the Clinician Part VII Recent Advances in the Genetics of Autism Spectrum Disorders Abha R. Gupta, MD, PhD Jointly
More informationNeural Signatures of Autism in High Risk Infants
Neural Signatures of Autism in High Risk Infants Charles A. Nelson III, Ph.D. Professor of Pediatrics and Neuroscience Harvard Medical School Director of Research Division of Developmental Medicine Children
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationNature Biotechnology: doi: /nbt Supplementary Figure 1. Experimental design and workflow utilized to generate the WMG Protein Atlas.
Supplementary Figure 1 Experimental design and workflow utilized to generate the WMG Protein Atlas. (a) Illustration of the plant organs and nodule infection time points analyzed. (b) Proteomic workflow
More informationBST227: Introduction to Statistical Genetics
BST227: Introduction to Statistical Genetics Lecture 11: Heritability from summary statistics & epigenetic enrichments Guest Lecturer: Caleb Lareau Success of GWAS EBI Human GWAS Catalog As of this morning
More informationSUPPLEMENTARY INFORMATION
Supplementary Figure 1. Normal AMPAR-mediated fepsp input-output curve in CA3-Psen cdko mice. Input-output curves, which are plotted initial slopes of the evoked fepsp as function of the amplitude of the
More informationMulti-modal Patient Cohort Identification from EEG Report and Signal Data
Multi-modal Patient Cohort Identification from EEG Report and Signal Data Travis R. Goodwin and Sanda M. Harabagiu The University of Texas at Dallas Human Language Technology Research Institute http://www.hlt.utdallas.edu
More informationMultiple Act criterion:
Common Features of Trait Theories Generality and Stability of Traits: Trait theorists all use consistencies in an individual s behavior and explain why persons respond in different ways to the same stimulus
More informationBIMM 143. RNA sequencing overview. Genome Informatics II. Barry Grant. Lecture In vivo. In vitro.
RNA sequencing overview BIMM 143 Genome Informatics II Lecture 14 Barry Grant http://thegrantlab.org/bimm143 In vivo In vitro In silico ( control) Goal: RNA quantification, transcript discovery, variant
More informationSUPPLEMENTARY FIGURE LEGENDS
SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Negative correlation between mir-375 and its predicted target genes, as demonstrated by gene set enrichment analysis (GSEA). 1 The correlation between
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationHuman Genetics 542 Winter 2018 Syllabus
Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis
More informationGraph Theory. Steffie Tomson UCLA NITP 2013
Graph Theory Steffie Tomson UCLA NITP 2013 What is graph theory? Mathematical descriptions of relationships between regions Node Opsahl et al. 2010 Why use graphs? Nodal Measures: Participation Coefficient
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Frequency of alternative-cassette-exon engagement with the ribosome is consistent across data from multiple human cell types and from mouse stem cells. Box plots showing AS frequency
More informationSupplemental Information For: The genetics of splicing in neuroblastoma
Supplemental Information For: The genetics of splicing in neuroblastoma Justin Chen, Christopher S. Hackett, Shile Zhang, Young K. Song, Robert J.A. Bell, Annette M. Molinaro, David A. Quigley, Allan Balmain,
More informationChapter 5: Global Analysis of the Effect of Densin. Knockout on Gene Transcription in the Brain
Chapter 5: Global Analysis of the Effect of Densin Knockout on Gene Transcription in the Brain Introduction High throughput methods for analyzing transcriptional changes in response to deletion or mutation
More informationHuman Genetics 542 Winter 2017 Syllabus
Human Genetics 542 Winter 2017 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Module I: Mapping and characterizing simple genetic diseases Jan 4 th Wed Mapping
More informationU.S. Low Dose Radiation Research Program
U.S. Low Dose Radiation Research Program Update November 2010 ISCORS NF Metting, ScD, Program Manager Office of Science Office of Biological and Environmental Research The Department of Energy Office of
More information