RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome
|
|
- Jody Rogers
- 5 years ago
- Views:
Transcription
1 RNA-Seq Atlas of Glycine max: A guide to the Soybean Transcriptome
2 How do novel structures or functions evolve?
3 A more relevant example Symbiosis and Nitrogen Fixation Limpens & Bisseling (23) Curr. Opin. Plant Biol. 6: 343
4 Genome duplication followed by asymmetric divergence Evlampiev and Isambert BMC Systems Biology 27 1:49 doi:1.1186/
5 Genome duplication in legumes polyploid duplications Innes, R., et al. 28. Differential accumulation of retroelements and diversification of NB-LRR disease resistance genes in duplicated regions following polyploidy in the ancestor of soybean. Plant Physiology. How do we examine divergence following duplication? Expression of genes from a common ancestor Epigenetics (e.g. methylation) Genetic variants
6 Soybean Illumina Data Overview Gary Stacey Sample Reads Reads Aligned Reads Uniquely Aligned Apical Meristem 6,477,456 5,669,285 (88%) 3,885,54 (6%) Flower 5,176,14 4,275,733 (83%) 3,322,166 (64%) Green Pods 4,183,24 3,694,647 (88%) 1,442,311 (34%) Leaves 5,29,196 4,74,41 (9%) 2,772,753 (52%) Nodule 6,335,851 5,265,596 (83%) 3,386,46 (53%) Root 6,17,312 5,154,176 (84%) 3,74,765 (61%) Root tip 5,154,499 4,212,283 (82%) 3,187,659 (62%) Read length: 36 Average read quality: Number of gene matches: 43,455-49,992 in JGI 8X Genome
7 Figure 3. Color code maps of gene expression across the the 2 soybean chromosomes. For each chromosome, gene expression (i.e. number of sequence reads/million reads aligned; <.5: yellow,.5-2: orange, 2-5: light green, 5-1: green, 1-25: greenish brown, 25-5: brown, 5-1: brownish red, 1: red) is indicated for nine different tissues (from top to bottom: 84 HAS root hairs, 12 HAS root hairs, nodule, root, root tip, SAM, leaf, flower, pod). The final color strip at the bottom of each chromosome represents gene density (i.e. number of genes per 1Kbp; 1-3 > light grey-black). These maps were generated by using the Comparative map and trait viewer (CMTV) software.
8 Homoeologous Soybean BACs gmw1-15k6 FROM: J. A. Schlueter, J. Y. Lin, S. D. Schlueter et al., BMC Genomics 8 (1), 33 (27). gmw1-15h Soybean lines Soybean li nes 3 Soybean li nes Soybean l ines Soybean lines Soybean lines Soybean li nes Soybean l ines Soybean l ines Soybean l ines Soybean l ines Soybean l i nes Soybean li nes Soybean lines Soybean li nes 2 1 Soybean lines Soybean lines Soybean lines Soybean l ines
9 Duplicated regions in the soybean genome
10 Inter-Homoeolog Differential Expression Tissue p=.5 p=1e-1 Root 7,34 2,168 Root Tip 6,57 1,729 Nodule 6,675 2,31 Apical Meristem 7,462 2,175 Leaves 6,6 1,741 Flower 7,245 2,266 Green Pods 5, Of approximately 14, homoeolog pairs
11 Methylome sequencing in soybean
12 Genome duplication in legumes polyploid duplications Innes, R., et al. 28. Differential accumulation of retroelements and diversification of NB-LRR disease resistance genes in duplicated regions following polyploidy in the ancestor of soybean. Plant Physiology.
13 Synteny Glyma18g499 vs. Medtr7g874 Glyma18g498 Glyma18g499 Glyma18g491 Gm18 Medtr7g872 Mt7 Medtr7g882 Medtr7g874 Gm9 Glyma9g3756 Glyma9g3754
14 Shared duplication expression between Glycine and Medicago 1% 9% 8% 7% 6% 5% 4% 3% 2% 1% % 1% 9% 8% 7% 6% 5% 4% 3% 2% 1% % Nodule Nodule Root Root Leaf Leaf Flower Flower Pod Pod Nodule Nodule Root Root Leaf Leaf Flower Flower Pod Pod Mt Gm Mt Gm Mt Gm Mt Gm Mt Gm Mt Gm Mt Gm Mt Gm Mt Gm Mt Gm
15 Whole Transcriptome Shotgun Sequencing of Soybean High vs Low Protein Lines Four seed developmental timepoints From each of two soybean NILs Each exhibiting either high or low protein content Seed Protein 5 W/W% dry matter 45 4 A B Bolon et. al., 21 BMC Plant Biology Stage
16 Area under the QTL The Seed Protein, Oil, and Yield QTL on Soybean Linkage Group I J. Chunga, H. L. Babkab, G. L. Graefc, P. E. Staswickc, D. J. Leec, P. B. Cregand, R. C. Shoemaker and J. E. Specht: Crop Science 43: (23)
17 Data Summary and Alignment to the Soybean Genome Sample Reads Reads Aligned Reads Uniquely Aligned Total SNPs In/Dels Gm_A1 7,835,63 5,88,687 (74%) 2,99,296 (37%) 1,374,62 4,429 Gm_A2 9,673,118 7,49,621 (77%) 2,662,2 (28%) 1,115,564 6,81 Gm_A3 9,12,649 6,7,125 (74%) 4,788,833 (53%) 1,52,187 4,418 Gm_A4 7,52,993 5,339,938 (76%) 3,519,76 (5%) 915,889 3,457 Gm_B1 16,988,687 13,394,686 (79%) 7,783,311 (46%) 2,61,326 8,545 Gm_B2 7,95,528 6,296,363 (79%) 2,181,665 (27%) 885,383 5,128 Gm_B3 9,21,789 7,4,21 (8%) 4,16,899 (45%) 1,14,933 5,677 Gm_B4 8,99,676 6,831,318 (77%) 4,161,16 (47%) 1,11,387 5,316
18 Supporting gene annotation via RNA-seq in Legumes
19 JGI gene annotated, but all libraries support larger gene model JGI Annotation Region of Read Alignments
20 No gene annotated, but all libraries suggest transcribed region No annotation
21 No gene annotated, expression only in low-protein line A No annotation SNPs Expression only in A
22 Gene expression within QTL region Four differentially expressed genes 124 novel exons Known Genes Novel Exons
23 Decreasing sequence costs over time
24 How can we simultaneously compare (visualize) 1,s of genomes or transcriptomes?
25 Converting nucleotide sequence to ordered pixels
26 Rendering DNA into images A region of human chromosome 17 Conversion of image to grayscale as filter (e.g. methylation) Animation of 1 superimposed images
27 Extensive experience in comparative image analysis software exists in other fields
28 How far can we take this concept? What field has even more experience Maize in visualization? Transcriptomes Breeder Content rated by ESRB
Supplemental Figure 1. Small RNA size distribution from different soybean tissues.
Supplemental Figure 1. Small RNA size distribution from different soybean tissues. The size of small RNAs was plotted versus frequency (percentage) among total sequences (A, C, E and G) or distinct sequences
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationVariant Classification. Author: Mike Thiesen, Golden Helix, Inc.
Variant Classification Author: Mike Thiesen, Golden Helix, Inc. Overview Sequencing pipelines are able to identify rare variants not found in catalogs such as dbsnp. As a result, variants in these datasets
More informationUNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES. Many things come in many forms. Give me an example of something that comes in many forms.
UNIT 3 GENETICS LESSON #30: TRAITS, GENES, & ALLELES Many things come in many forms. Give me an example of something that comes in many forms. Genes, too, come in many forms. Main Idea #1 The same gene
More information(39) INOCULATION OF RHIZOBIUM JAPONICUM AND β- SITOSTEROL EFFECT ON GROWTH, YIELD AND SOME BIOCHEMICAL CONSTITUENTS OF SOYBEAN (Glycine max L.
(39) INOCULATION OF RHIZOBIUM JAPONICUM AND β- SITOSTEROL EFFECT ON GROWTH, YIELD AND SOME BIOCHEMICAL CONSTITUENTS OF SOYBEAN (Glycine max L.) PLANT M.S.A., Abd El-Wahed Botany Department, National Research
More informationgenomics for systems biology / ISB2020 RNA sequencing (RNA-seq)
RNA sequencing (RNA-seq) Module Outline MO 13-Mar-2017 RNA sequencing: Introduction 1 WE 15-Mar-2017 RNA sequencing: Introduction 2 MO 20-Mar-2017 Paper: PMID 25954002: Human genomics. The human transcriptome
More informationTutorial: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures
: RNA-Seq Analysis Part II: Non-Specific Matches and Expression Measures March 15, 2013 CLC bio Finlandsgade 10-12 8200 Aarhus N Denmark Telephone: +45 70 22 55 09 Fax: +45 70 22 55 19 www.clcbio.com support@clcbio.com
More informationNature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationAnalysis with SureCall 2.1
Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationChapter 12 Multiple Choice
Chapter 12 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. What did Gregor Mendel do to study different characteristics in his genetics experiments? a.
More informationStudying Alternative Splicing
Studying Alternative Splicing Meelis Kull PhD student in the University of Tartu supervisor: Jaak Vilo CS Theory Days Rõuge 27 Overview Alternative splicing Its biological function Studying splicing Technology
More informationIdentifying Mutations Responsible for Rare Disorders Using New Technologies
Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationIDENTIFICATION OF IN SILICO MIRNAS IN FOUR PLANT SPECIES FROM FABACEAE FAMILY
Original scientific paper 10.7251/AGRENG1803122A UDC633:34+582.736.3]:577.2 IDENTIFICATION OF IN SILICO MIRNAS IN FOUR PLANT SPECIES FROM FABACEAE FAMILY Bihter AVSAR 1*, Danial ESMAEILI ALIABADI 2 1 Sabanci
More informationHuman nutrition requirement
N assimilation Organic N Proteins 20 amino acids DNA RNA nucleic acids Chlorophylls Secondary products More hormones N in the environment NH, 4 NH 3 (oxid st 3) NO 3 (oxid st 5) N 2 (oxid st 0) Next to
More informationMODULE 4: SPLICING. Removal of introns from messenger RNA by splicing
Last update: 05/10/2017 MODULE 4: SPLICING Lesson Plan: Title MEG LAAKSO Removal of introns from messenger RNA by splicing Objectives Identify splice donor and acceptor sites that are best supported by
More informationAmbient temperature regulated flowering time
Ambient temperature regulated flowering time Applications of RNAseq RNA- seq course: The power of RNA-seq June 7 th, 2013; Richard Immink Overview Introduction: Biological research question/hypothesis
More informationANALYSIS OF SOYBEAN SMALL RNA POPULATIONS HLAING HLAING WIN THESIS
ANALYSIS OF SOYBEAN SMALL RNA POPULATIONS BY HLAING HLAING WIN THESIS Submitted in partial fulfillment of the requirements for the degree of Master of Science in Bioinformatics in the Graduate College
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationIdentification of loci and genes responsible for sodium and chloride exclusion in rootstocks for use in marker assisted selection
Identification of loci and genes responsible for sodium and chloride exclusion in rootstocks for use in marker assisted selection Jake Dunlevy, Deidre Blackmore, Everard Edwards, Rob Walker and Mandy Walker
More informationChromosomes and Human Inheritance. Chapter 11
Chromosomes and Human Inheritance Chapter 11 11.1 Human Chromosomes Human body cells have 23 pairs of homologous chromosomes 22 pairs of autosomes 1 pair of sex chromosomes Autosomes and Sex Chromosomes
More informationHuman Genetics (Learning Objectives)
Human Genetics (Learning Objectives) Recognize Mendel s contribution to the field of genetics. Review what you know about a karyotype: autosomes and sex chromosomes. Understand and define the terms: characteristic,
More informationCan Brachypodium distachyon provide insight into FHB? Paul Nicholson Disease and Stress Biology Department John Innes Centre
Can Brachypodium distachyon provide insight into FHB? Paul Nicholson Disease and Stress Biology Department John Innes Centre Genetics and mechanisms of FHB resistance in wheat DON (mg kḡ 1 ) ET-silenced
More informationLecture 9: Hybrid Vigor (Heterosis) Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013
Lecture 9: Hybrid Vigor (Heterosis) Michael Gore lecture notes Tucson Winter Institute version 18 Jan 2013 Breaking Yield Barriers for 2050 Phillips 2010 Crop Sci. 50:S-99-S-108 Hybrid maize is a modern
More informationChapter 1 : Genetics 101
Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationChallenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014
Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical
More informationChromHMM Tutorial. Jason Ernst Assistant Professor University of California, Los Angeles
ChromHMM Tutorial Jason Ernst Assistant Professor University of California, Los Angeles Talk Outline Chromatin states analysis and ChromHMM Accessing chromatin state annotations for ENCODE2 and Roadmap
More informationFigure S2. Distribution of acgh probes on all ten chromosomes of the RIL M0022
96 APPENDIX B. Supporting Information for chapter 4 "changes in genome content generated via segregation of non-allelic homologs" Figure S1. Potential de novo CNV probes and sizes of apparently de novo
More informationSupplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
More informationGuided Reading and Study. Definition a. The scientific study of heredity. b. Physical characteristics
Genetics: The Science of Heredity Mendel's Work Guided Reading and Study This section describes how Gregor Mendel identified the method by which characteristics are passed from parents to their offspring.
More informationGenerating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University
Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic
More informationMicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting sirnas
RESOURCE/METHODOLOGY MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting sirnas Jixian Zhai, 1,2 Dong-Hoon Jeong, 1,2 Emanuele De Paoli, 1,2,7
More informationSection Chapter 14. Go to Section:
Section 12-3 Chapter 14 Go to Section: Content Objectives Write these Down! I will be able to identify: The origin of genetic differences among organisms. The possible kinds of different mutations. The
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationMendel s Methods: Monohybrid Cross
Mendel s Methods: Monohybrid Cross Mendel investigated whether the white-flowered form disappeared entirely by breeding the F1 purple flowers with each other. Crossing two purple F1 monohybrid plants is
More informationMendel explained how a dominant allele can mask the presence of a recessive allele.
Section 2: Mendel explained how a dominant allele can mask the presence of a recessive allele. K What I Know W What I Want to Find Out L What I Learned Essential Questions What is the significance of Mendel
More informationStructural Variation and Medical Genomics
Structural Variation and Medical Genomics Andrew King Department of Biomedical Informatics July 8, 2014 You already know about small scale genetic mutations Single nucleotide polymorphism (SNPs) Deletions,
More informationPatterns of Histone Methylation and Chromatin Organization in Grapevine Leaf. Rachel Schwope EPIGEN May 24-27, 2016
Patterns of Histone Methylation and Chromatin Organization in Grapevine Leaf Rachel Schwope EPIGEN May 24-27, 2016 What does H3K4 methylation do? Plant of interest: Vitis vinifera Culturally important
More informationSexual Reproduction and Genetics. Section 1. Meiosis
Chromosomes and Chromosome Number! Human body cells have 46 chromosomes! Each parent contributes 23 chromosomes! Homologous chromosomes one of two paired chromosomes, one from each parent Chromosomes and
More informationMR. DALLINGA S BIOLOGY
MR. DALLINGA S BIOLOGY Gregor Mendel Facts Born July 22 nd 1822 in Czechoslovakia A region of Austria. Today is Czech republic. Life of Poverty Entered a monastery to get an education The monastery was
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationSoybean Nutrient Profile
Soybean Nutrient Profile Nitrogen This nitrogen profile is the fourth of a 13 part weekly series dedicated to the function of the essential nutrients in soybean. After excluding carbon, hydrogen, and oxygen,
More informationToxicity and Genotoxicity of Pendimethalin in Maize and Onion
Kasetsart J. (Nat. Sci.) 44 : 1010-1015 (2010) Toxicity and Genotoxicity of Pendimethalin in Maize and Onion Nuttapol Promkaew 1, Puangpaka Soontornchainaksaeng 1 *, Sansern Jampatong 2 and Piangchan Rojanavipart
More informationData mining with Ensembl Biomart. Stéphanie Le Gras
Data mining with Ensembl Biomart Stéphanie Le Gras (slegras@igbmc.fr) Guidelines Genome data Genome browsers Getting access to genomic data: Ensembl/BioMart 2 Genome Sequencing Example: Human genome 2000:
More informationMineral Nutrients and their functions in plants
Mineral Nutrients and their functions in plants PLANT NUTRITION The term "nutrition" refers to the interrelated steps by which a living organism assimilates food and uses it for growth and replacement
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationMetabolomic and Proteomics Solutions for Integrated Biology. Christine Miller Omics Market Manager ASMS 2015
Metabolomic and Proteomics Solutions for Integrated Biology Christine Miller Omics Market Manager ASMS 2015 Integrating Biological Analysis Using Pathways Protein A R HO R Protein B Protein X Identifies
More informationResults. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationHao D. H., Ma W. G., Sheng Y. L., Zhang J. B., Jin Y. F., Yang H. Q., Li Z. G., Wang S. S., GONG Ming*
Comparison of transcriptomes and gene expression profiles of two chilling- and drought-tolerant and intolerant Nicotiana tabacum varieties under low temperature and drought stress Hao D. H., Ma W. G.,
More informationTest Booklet. Subject: SC, Grade: HS Genetics Assessment. Student name:
Test Booklet Subject: SC, Grade: HS Genetics Assessment Student name: Author: Megan Kitchens School: SHAW HIGH SCHOOL Printed: Monday January 30, 2017 1 In fruit flies, the gray body color (G) is dominant
More informationUnit B: Seed Germination, Growth, and Development. Lesson 4: Determining Nutrient Functions and Utilization
Unit B: Seed Germination, Growth, and Development Lesson 4: Determining Nutrient Functions and Utilization 1 Terms Denitrification Leach Macronutrient Micronutrient Nitrification Nitrogen cycle Nitrogen
More informationTHE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15
THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 What you must know: Inheritance in sex-linked genes. Inheritance of linked genes and chromosomal mapping. How alteration of chromosome number or structurally
More information2. Was there a scientific way to predict the outcome of a cross between two parents?
Name Date Period Heredity WebQuest DNA from the Beginning Mendelian Genetics Go to http://www.dnaftb.org/dnaftb/1/concept/index.html Children resemble their parents Read the text and answer the following
More informationMODULE 3: TRANSCRIPTION PART II
MODULE 3: TRANSCRIPTION PART II Lesson Plan: Title S. CATHERINE SILVER KEY, CHIYEDZA SMALL Transcription Part II: What happens to the initial (premrna) transcript made by RNA pol II? Objectives Explain
More informationTEST NAME:review TEST ID: GRADE:07 Seventh Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: My Classroom
TEST NAME:review TEST ID:1070005 GRADE:07 Seventh Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: My Classroom review Page 1 of 18 Student: Class: Date: 1. There are four blood types: A, B, AB,
More informationChapter 15 Notes 15.1: Mendelian inheritance chromosome theory of inheritance wild type 15.2: Sex-linked genes
Chapter 15 Notes The Chromosomal Basis of Inheritance Mendel s hereditary factors were genes, though this wasn t known at the time Now we know that genes are located on The location of a particular gene
More informationHeredity and Meiosis AP BIOLOGY. Heredity. Slide 1 / 142 Slide 2 / 142. Slide 4 / 142. Slide 3 / 142. Slide 6 / 142. Slide 5 / 142.
Slide 1 / 142 Slide 2 / 142 AP BIOLOGY Heredity Slide 3 / 142 Slide 4 / 142 Heredity Unit Topics Click on the topic to go to that section Heredity & Meiosis Law of Independent Assortment What Mendel Didn't
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationMendelian Genetics. Biology 3201 Unit 3
Mendelian Genetics Biology 3201 Unit 3 Recall: Terms Genetics is a branch of biology dealing with the principles of variation and inheritance in animals and plants. Heredity the passing of traits from
More informationQTs IV: miraculous and missing heritability
QTs IV: miraculous and missing heritability (1) Selection should use up V A, by fixing the favorable alleles. But it doesn t (at least in many cases). The Illinois Long-term Selection Experiment (1896-2015,
More informationTranscriptome maps of Populus tomentosa: Characteristics and its applications
Transcriptome maps of Populus tomentosa: Characteristics and its applications PhD. Li bo & Pro.Zhang Zhiyi 2008.10.29 Discrete traits and quantitative traits Discrete trait: color, gender, et al Quantitative
More information10/19/2017. How Nutritional Genomics Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH
Disclosures Joyanna Hansen How Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH Consultant Nutricia North America Research Support Academy of Nutrition
More informationAbstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction
Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant
More informationGenetics, Analysis & Principles/5e ANSWERS TO PROBLEM SETS CHAPTER 1
Genetics, Analysis & Principles/5e ANSWERS TO PROBLEM SETS CHAPTER 1 Note: the answers to the Comprehension questions are at the end of the textbook. Concept check questions (in figure legends) FIGURE
More informationIntroduction. Introduction
Introduction We are leveraging genome sequencing data from The Cancer Genome Atlas (TCGA) to more accurately define mutated and stable genes and dysregulated metabolic pathways in solid tumors. These efforts
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationThe Chromosomal Basis Of Inheritance
The Chromosomal Basis Of Inheritance Chapter 15 Objectives Explain the chromosomal theory of inheritance and its discovery. Explain why sex-linked diseases are more common in human males than females.
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationGenes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
More informationUnit E: Plant Propagation. Lesson 1: Understanding Sexual Reproduction
Unit E: Plant Propagation Lesson 1: Understanding Sexual Reproduction 1 Vocabulary Cross-pollination Diploid Endosperm Fertilization Gametes Genes Haploid Hybrids Pollination Seed Self-pollination Sexual
More informationSupplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,
More informationDNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called
DNA is the genetic material that provides instructions for what our bodies look like and how they function. DNA is packaged into structures called chromosomes. We have 23 pairs of chromosomes (for a total
More informationRecent soybean fertility studies. R. Jay Goos and Hannah Ohm Department of Soil Science North Dakota State University
Recent soybean fertility studies R. Jay Goos and Hannah Ohm Department of Soil Science North Dakota State University Two recent soybean fertility studies Calibration of the ureide tissue test under field
More informationModeling Chromosome Inheritance
Task 2 Modeling Chromosome Inheritance In this task, you will model chromosome inheritance from parent to offspring for the species you created in task 1. You will use the genotypes you developed for the
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationFoliar Micronutrients for Broad Acre Crops Higher yield and better quality Balanced trace element supply for healthy crops Insurance against
B S Zn Mn Mo Foliar Micronutrients for Broad Acre Crops Higher yield and better quality Balanced trace element supply for healthy crops Insurance against deficiencies of micronutrients Crop adapted nutrient
More informationDownloaded from Chapter 5 Principles of Inheritance and Variation
Chapter 5 Principles of Inheritance and Variation Genetics: Genetics is a branch of biology which deals with principles of inheritance and its practices. Heredity: It is transmission of traits from one
More informationPlant, Soil, and Nutrients
Plant, Soil, and Nutrients 1 Where do plants get their nutrients? - Atmospheric Deposition (N, S) - Irrigation water - Shallow groundwater 2 What is surface exchange? Soil has an overall charge Overall
More informationIntroduction to Genetics & DNA {DNA
Introduction to Genetics & DNA {DNA What is Heredity? Heredity explains how traits may be passed from parents to offspring. Heredity People have bred plants and animals for thousands of years to get desirable
More informationMutations. Any change in DNA sequence is called a mutation.
Mutations Mutations Any change in DNA sequence is called a mutation. Mutations can be caused by errors in replication, transcription, cell division, or by external agents. Mutations Mutations can be harmful.
More informationAnnotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009
Annotation of Chimp Chunk 2-10 Jerome M Molleston 5/4/2009 1 Abstract A stretch of chimpanzee DNA was annotated using tools including BLAST, BLAT, and Genscan. Analysis of Genscan predicted genes revealed
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Heatmap of GO terms for differentially expressed genes. The terms were hierarchically clustered using the GO term enrichment beta. Darker red, higher positive
More informationCancer Informatics Lecture
Cancer Informatics Lecture Mayo-UIUC Computational Genomics Course June 22, 2018 Krishna Rani Kalari Ph.D. Associate Professor 2017 MFMER 3702274-1 Outline The Cancer Genome Atlas (TCGA) Genomic Data Commons
More informationLesson Overview 11.1 The Work of Gregor Mendel
THINK ABOUT IT What is an inheritance? Lesson Overview 11.1 The Work of Gregor Mendel It is something we each receive from our parents a contribution that determines our blood type, the color of our hair,
More information2009 LANDES BIOSCIENCE. DO NOT DISTRIBUTE.
[Epigenetics 4:2, 1-6; 16 February 2009]; 2009 Landes Bioscience Research Paper Determining the conservation of DNA methylation in Arabidopsis This manuscript has been published online, prior to printing.once
More information2. By breeding the pea plants he was growing in the monastery s garden, he discovered the
Name: _ Date: Directions: Navigate to https://goo.gl/tcd8l4 to view the corresponding PowerPoint. Be sure to click PRESENT in the upper right hand corner! Answer the following questions from the PowerPoint.
More informationLesson 2 Meeting the Nutritional Needs of Animals
Unit B Understanding Animal Body Systems Lesson 2 Meeting the Nutritional Needs of Animals 1 Terms Animal Proteins Basal Maintenance Requirement Concentrates Feed Feedstuff Fetus Forages Free Access Gestation
More informationDry Bean Fertility Dave Franzen NDSU Soil Science Specialist
Dry Bean Fertility Dave Franzen NDSU Soil Science Specialist Dry bean is responsive to fertilizer when soil levels are inadequate to support yield levels possible with existing soil moisture and growing
More informationMeiosis. 4. There are multiple alleles for the ABO blood group. Why are there only two of these alleles normally present in any one individual?
Name: ate: 1. The diagram shown represents a cell that will undergo mitosis. Which diagrams below best illustrate the nuclei of the daughter cells that result from a normal mitotic cell division of the
More informationFamily Trees for all grades. Learning Objectives. Materials, Resources, and Preparation
page 2 Page 2 2 Introduction Family Trees for all grades Goals Discover Darwin all over Pittsburgh in 2009 with Darwin 2009: Exploration is Never Extinct. Lesson plans, including this one, are available
More information17 Cell Differentiation and Gene Expression In m ost h u m a n cells, the nucleus contains a full set of 23 pairs of chromosomes,
17 Cell Differentiation and Gene Expression In m ost h u m a n cells, the nucleus contains a full set of 23 pairs of chromosomes, which carry 20,000 25,000 genes. These genes are identical from cell to
More informationSUPPLEMENTARY INFORMATION
doi: 1.138/nature8645 Physical coverage (x haploid genomes) 11 6.4 4.9 6.9 6.7 4.4 5.9 9.1 7.6 125 Neither end mapped One end mapped Chimaeras Correct Reads (million ns) 1 75 5 25 HCC1187 HCC1395 HCC1599
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationUnit 5: Genetics Notes
Unit 5: Genetics Notes https://goo.gl/fgtzef Name: Period: Test Date: Table of Contents Title of Page Page Number Date Warm-ups 3-4 Mendelian Genetics Notes 5-6 Mendelian Genetics Lets Practice 7 Monohybrid
More informationGROWTH AND NODULATION OF MUNGBEAN (VIGNA RADIATA [L.] WILCZEK) AS AFFECTED BY SODIUM CHLORIDE
Journal of Research (Science), Bahauddin Zakariya University, Multan, Pakistan. Vol.15, No.2, June 2004, pp. 139-143 ISSN 1021-1012 GROWTH AND NODULATION OF MUNGBEAN (VIGNA RADIATA [L.] WILCZEK) AS AFFECTED
More informationEffects of Soil-Delivered Manufactured Nanomaterials on Soybean Plants
DBI-0830117, -1266377 Effects of Soil-Delivered Manufactured Nanomaterials on Soybean Plants 2 nd Sustainable Nanotechnology Organization Conference November 3, 2013 John H. Priester, Jorge L. Gardea-Torresdey,
More information