Whole-exome sequencing expands the phenotype of Hunter syndrome

Transcription

1 Clin Genet 2014: 86: Printed in Singapore. All rights reserved Short Report 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd CLINICAL GENETICS doi: /cge Whole-exome sequencing expands the phenotype of Hunter syndrome Nikkel S.M., Huang L., Lachman R., Beaulieu C.L., Schwartzentruber J., FORGE Canada Consortium, Majewski J., Geraghty M.T., Boycott K.M. Whole-exome sequencing expands the phenotype of Hunter syndrome. Clin Genet 2014: 86: John Wiley & Sons A/S. Published by John Wiley & Sons Ltd, 2013 Whole-exome sequencing (WES) has proven its utility in finding novel genes associated with rare conditions and its usefulness is being further demonstrated in expanding the phenotypes of well known diseases. We present here a family with a previously undiagnosed X-linked condition characterized by progressive restriction of joint range of motion, prominence of the supraorbital ridge, audiology issues and hernias. They had an average stature, normal occipitofrontal circumference and intelligence, absence of dysostosis multiplex and otherwise good health. A diagnosis of Hunter syndrome was determined using WES and further supported by biochemical investigations. The phenotype of this family does not correspond to either the severe or attenuated clinical subtypes of Hunter syndrome. As further atypical families are reported, this classification will need to be modified. Our findings highlight the utility of WES in expanding the recognized phenotypic spectrum of known syndromes. Conflict of interest The authors have no conflict of interest to declare. S.M. Nikkel a,b, L. Huang a, R. Lachman c, C.L. Beaulieu b,d, J. Schwartzentruber e, FORGE Canada Consortium b,d, J. Majewski e, M.T. Geraghty b,f and K.M. Boycott a,b,d a Department of Genetics, Children s Hospital of Eastern Ontario, Ottawa, ON, Canada, b University of Ottawa, Ottawa, ON, Canada, c International Skeletal Dysplasia Registry, Palo Alto, California, USA, d Children s Hospital of Eastern Ontario Research Institute, e McGill University and Genome Quebec Innovation Centre, Montréal, QC, Canada, and f Department of Pediatrics, Children s Hospital of Eastern Ontario, Ottawa, ON, Canada Key words: attenuated dysostosis multiplex Hunter syndrome mucopolysaccharidosis type II whole-exome sequencing Corresponding author: Sarah M Nikkel, Department of Genetics, Children s Hospital of Eastern Ontario, 401 Smyth Road, Ottawa, Ontario, Canada K1H 8 L1. Tel.: +(613) x2611; fax: +(613) ; snikkel@cheo.on.ca Received 31 May 2013, revised and accepted for publication 3 July 2013 Over the past several years, whole-exome sequencing (WES) has proven to be a very useful tool in uncovering the genetic basis of a number of rare diseases with an increasing number of novel genes being discovered (1). Importantly, WES is also playing a significant role in expanding our understanding of the clinical spectrum of known diseases (2) by identifying the extreme ends of the clinical presentation. The FORGE (Finding Of Rare Disease GEnes) Canada project has enabled WES analysis of families with undiagnosed rare pediatric-onset diseases with the primary aim of discovering novel disease genes. However, the experience of FORGE is showing us that WES also has a significant role to play in expanding our knowledge of clinical phenotypes due to alteration of known disease genes. We present here a family with an undiagnosed X-linked syndrome characterized by normal intelligence, craniofacial changes and joint restriction, and demonstrate the clinical utility of WES in increasing our understanding of a classic metabolic syndrome. Materials and methods Subjects A three generation family with an undiagnosed craniotubular bone disorder was identified. This family was presented at a number of international venues and no 172

2 Whole-exome sequencing expands the phenotype of Hunter syndrome clear diagnosis was made. As the family was believed to have a unique phenotype, the samples were sent for WES under a research protocol (FORGE) with the aim to identify a novel gene to explain the clinical features observed in this family. Informed consent was obtained from all participating individuals according to the Declaration of Helsinki and the study was approved by the Research Ethics Boards of the Children s Hospital of Eastern Ontario. We used standard methods to isolate genomic DNA from peripheral blood and saliva from the family members. Whole-exome sequencing Exome capture and high-throughput sequencing was performed at McGill University and Genome Québec Innovation Centre (Montréal, Canada). Read alignment, variant calling and annotation were carried out as for previous FORGE projects (3) with a pipeline based on BWA, Picard, Samtools mpileup v , Annovar, and custom annotation scripts. All samples had >92% of bases in the consensus coding sequences (CCDS) covered by at least 10 reads. Sanger sequencing The mutation identified in the family was confirmed to segregate as expected using Sanger sequencing. The primer pair used for segregation analysis was: 5 GCTCTGTCGCTTCCTGTTTC 3 /5 GGAAGGGAG- CACATCACATT 3. Sequencing was performed under standard conditions (available upon request). Results Clinical features The proband (III-3) was referred to the Genetics Clinic by Orthopedics as his mother reported that he was developing features that were similar to that of his two maternal uncles, II-3 and II-4 (Fig. 1). At 7 years of age, he was of average stature and intelligence, but was developing a supraorbital prominence and the range of motion of his joints was becoming restricted. His past medical history included inguinal hernia repairs at ages 1 and 4 years. He has had a number of tympanostomy-tube placements for excess fluid accumulation. There was no evidence of upper airway constriction, organomegaly or other health concerns. The elder of the two uncles (II-3) was born with talipes equinovarus that was treated with bracing/casting. He also had bilateral hernia repairs and numerous tympanostomy tube placements. He has mixed (conductive/sensorineural) hearing loss for which he wears aids. Family photographs demonstrated the progression of prominence of the supraorbital ridge. He developed limitations of mobility and joint pain in adolescence. He is unable to raise his arms above his head and has restrictions at the elbows, knees, hips and shoulders. He has camptodactyly. In order to maintain joint mobility, he is active and very physically fit and has quite defined musculature. He is of average height (25th percentile) and normal intelligence. He has had good health and has a healthy son. The second uncle (II-4) has very similar joint restriction with more involvement of his hands: he is unable to extend his thumb and has limited thumb flexion. He too maintains a high level of physical activity and has quite defined musculature. He is of average height (25 50th percentile) and occipitofrontal circumference (OFC) is at the 75th percentile. He has sensorineural hearing loss and a bicuspid aortic valve. He too has had progression of his facial appearance with the development of a very prominent supraorbital ridge. There was no evidence of organomegaly on examination. The mother (II-1) and the maternal grandmother (1, 2) of the proband do not have joint restriction or any related health issues. However, they both have deep set eyes and a more prominent supraorbital ridge. The mother s sister (II-2) does not have this finding and has two unaffected sons. Radiographs were obtained on the proband at age 7, his mother at age 38, and the younger uncle at age 31 years. A prominent frontal sinus was noted in the uncle, which would explain the prominence of the supraorbital ridge (Fig. 2). The sinus enlargement was also found in the proband s mother, although not to the same extent as her brother, but this finding was not apparent in the proband. There were other some mild, Fig. 1. The family pedigree showing the affected males (filled in boxes) and the carrier females (shaded circles). 173

3 Nikkel et al. (a) (b) (c) Fig. 2. (a) Lateral skull films of the proband (III-3) at the age of 7 years; (b) his mother (II-1); (c) his uncle (II-4). The frontal sinus is quite large in the uncle, resulting in a prominent supraorbital ridge. This feature is also present in the mother, but to a lesser extent. The sella turcicas appear normal in all three individuals. non-specific radiographic changes (Fig. 3), but nothing to suggest a specific diagnosis. Pedigree analysis of this family was highly suggestive of an X-linked craniotubular condition associated with normal intelligence and a mild phenotype in the suspected female carriers. There are not many X-linked conditions that meet these parameters. Frontometaphyseal dysplasia (FMD, OMIM #305620), was considered on the differential diagnosis (4), but sequencing of the FLNA gene in the proband did not identify a mutation. Given the lack of diagnosis in this family, they were entered into the FORGE project for analysis by WES Exome sequencing Exome capture and high-throughput sequencing of DNA from the proband, his mother, and uncle (II-4) was performed. Variants on the X chromosome were considered as candidates if they were shared between all the three family members sequenced. After filtering out all existent variants in Single Nucleotide Polymorphism Database (dbsnp), the 1000 genomes, the NHLBI Exome Sequencing project, and our in-house variant database (500 exomes), only one novel variant in the IDS gene (NM_ : c.1392c>g; p.ser464arg) (5) appeared compelling, suggesting a diagnosis of Hunter syndrome (mucopolysaccharidosis type II; MPS II, OMIM #309900). Mutation validation Sanger sequencing was used to verify this mutation and it was found to segregate with the phenotype in the family (see Fig. 1). To further validate this mutation as disease-causing, urine from the proband was sent for the mucopolysaccaride screen and the result was positive. Furthermore, assessment of iduronate- 2-sulfatase (IDS) activity, performed on fibroblasts from the proband, demonstrated low enzyme activity (1.3 nmol/h/mg protein control 73.7 nmol/h/mg protein). These results confirm that enzyme activity is impaired and the IDS p.ser464arg is the diseasecausing mutation. Review of phenotype In light of the diagnosis of Hunter syndrome in the proband, we arranged an echocardiogram, which demonstrated mild thickening and redundancy of the mitral and aortic valves with preserved function. Abdominal ultrasound showed a mildly enlarged liver that was non-palpable, with no other organ involvement. At 14 years of age, he continues to be active, healthy and well grown (height at the 50th percentile and OFC at the 75th percentile). His musculature has become more defined with age. Although recent skull films are not available, he now has a very prominent supraorbital ridge, which likely reflects the expansion of the frontal sinus. The two uncles continue to be in good health. No one in the family has difficulties with the upper airway. Enzyme replacement therapy (ERT) was discussed as a possible treatment option, but was declined by the family at this time. The skeletal surveys that were available on the proband and uncle (II-4) were re-reviewed to assess for features of dysostosis multiplex (DM, Figs 2 and 3). The majority of the bones were unremarkable, as were the sella in both the proband and his uncle. In the uncle, the ribs were slightly thickened, as were his clavicles, a finding which can only be seen in the recent chest film of the proband. The pelvis of the proband is unremarkable, but the uncle s pelvis showed a double contoured lower lateral ileum, without distal tapering; this finding, although not specific for DM, can be seen uncommonly (Lachman personal experience, not previously reported). Discussion Hunter syndrome is an X-linked disorder caused by a deficiency of the lysosomal enzyme IDS. The accumulation of glycosaminoglycans (GAGs) in organs contributes the progressive clinical course of the disease. Typical manifestations of the condition include: hepatosplenomegaly, conductive and sensorineural hearing loss, cardiac valvular disease, airway obstruction, joint contractures and short stature with skeletal findings of DM (6). Classically, the spectrum of Hunter syndrome 174

4 Whole-exome sequencing expands the phenotype of Hunter syndrome (ai) (bi) (bii) (aii) (ei) (di) (dii) (ci) (cii) (eii) Fig. 3. Radiographs of (i) proband (III-3) at age 7 and 14; (ii) his uncle (II-4) at age 31 showing a few non-specific features that can be seen with a mucopolysaccharidosis, but there are no findings to strongly suggest dysostosis multiplex. (ai) Normal pelvis and long femoral necks. (aii) Narrow lower ileum, with double contour to the lower lateral walls (arrows). Normal femoral necks. (bi) Thoracic film carried out at 14 years broad clavicles and questionably thick ribs. (bii) Broad clavicles and mildly broad ribs without paddle-shaping. (ci) Normal hand and wrist with mild fifth finger clinodactyly. (cii) Normal hand and wrist. (di, dii) No evidence of vertebral body abnormalities. (ei) Normal knees. (eii) Lower limbs showing normal variant mild bowing of fibula. Unremarkable metaphyses. is divided into those who have a severe form with progressive neurodegeneration (approximately 75%) and those who have an attenuated form. The later group presents with a slower progression of the condition and average intelligence, but the majority of those affected with the attenuated form still succumb in early adulthood due to complications (7). A storage disorder was not initially considered for this family. In retrospect, there were features suggestive of a MPS that included progression of the condition, both in range of motion of the joints as well as changes of the facial phenotype, as well as the presence of hernias and auditory features in the affected males. Applying a scoring system used to identify individuals with Hunter syndrome (8), the proband and his uncles would each have had scores of six, which is the minimum score to detect 95% of individuals with Hunter syndrome. However, the minimum score for the majority of newly diagnosed individuals (average age 4 years) is at least seven (range 7 16). By age 14 (current age of proband), most individuals with classic Hunter syndrome have already developed severe disease with neurologic damage, while individuals in the attenuated group show signs of upper airway obstruction, organomegaly, and significant musculoskeletal impairment. The family reported here did not have the hallmark features, such as classic DM, skin thickening, short stature, macrocephaly or major internal organ involvement that would have suggested an MPS during their diagnostic work-up. Non-classical presentations of MPS II are reported in the literature, but very few with mild presentations. Quaio et al. (9) recently reported a very attenuated presentation in a Brazilian family with a novel missense mutation (p.ala77asp) in the IDS gene. Their features were quite minimal with many affected males remaining asymptomatic and requiring no medical interventions. Many of the family members were of average stature and some had craniofacial manifestations and musculoskeletal issues. Some of the males in this pedigree had children, but outside of this extended family and the one uncle that we report here, there has been only one other account of a male reproducing (10). The clinical data on the Brazilian family and the family reported here significantly expands the clinical phenotype of this syndrome. The term attenuated was agreed upon to describe CNS-sparing Hunter syndrome, as the term mild did not acknowledge the significant health complications 175

5 Nikkel et al. typical in this group. However, the classification system will need to be reconsidered as more atypical presentations, such as the one presented here, are described. These findings also suggest that significantly attenuated forms of some of the other MPS conditions, such as Hurler Scheie syndrome (MPS I), Maroteux Lamy syndrome (MPS VI) and Sly syndrome (MPS VII), may also exist and should be included in the differential diagnosis of patients with progressive conditions involving the joints. MPS II is one of the few lysosomal conditions where ERT (recombinant idursulfatase, Elaprase, Shire Human Genetic Therapies, Lexington, MA) is available. It has been shown to reduce GAG excretion in the urine, improve upon the distance obtained in the 6 min walk test, and there is improved forced vital capacity. There has been little improvement in joint range of motion noted (11). These observations are interesting given the presentation in this family of predominantly joint issues and raises the question as to whether higher levels of IDS activity are needed to ameliorate this aspect of the phenotype. The utility of ERT in such attenuated or atypical forms of the condition is uncertain and this must be weighed against the associated risks and costs. In conclusion, our findings highlight the utility of WES in facilitating the diagnosis of atypical presentations of rare diseases. The natural history of Hunter syndrome can be variable, even within the same family, nonetheless, the prognosis for the proband of this family appears optimistic and appropriate monitoring of the family is now in place. With the increased use of WES in clinical practice, the phenotypic spectrum of known syndromes will continue to expand and will challenge what we think we know about these diseases. Acknowledgements The authors would like to thank the family for their participation and assistance, especially II-1. The authors also wish to acknowledge the contribution of the high-throughput sequencing platform of the McGill University and Genome Quebec Innovation Centre (Montreal, Canada). Funding was provided by the Government of Canada through Genome Canada, the Canadian Institutes of Health Research (CIHR) and the Ontario Genomics Institute (OGI-049), by Genome Québec and Genome British Columbia. This work was selected for study by the FORGE Canada Steering Committee, which consists of K. Boycott (University of Ottawa), J. Friedman (University of British Columbia), J. Michaud (University of Montreal), F. Bernier (University of Calgary), M. Brudno (University of Toronto), B. Fernandez (Memorial University), B. Knoppers (McGill University), M. Samuels (Université de Montréal), and S. Scherer (University of Toronto). References 1. Bamshad MJ, Ng SB, Bigham AW et al. Exome sequencing as a tool for Mendelian disease gene discovery. Nat Rev Genet 2011: 12: Dixon-Salazar TJ, Silhavy JL, Udpa N et al. Exome sequencing can improve diagnosis and alter patient management. Sci Transl Med 2012: 4: 138ra Srour M, Hamdan FF, Schwartzentruber JA et al. Mutations in TMEM231 cause Joubert syndrome in French Canadians. J Med Genet 2012: 49: Robertson SP, Jenkins ZA, Morgan T et al. Frontometaphyseal dysplasia: mutations in FLNA and phenotypic diversity. Am J Med Genet 2006: 140A: Stenson PD, Ball E, Mort M et al. The Human Gene Mutation Database (HGMD ): 2003 Update. Hum Mutat 2003: 21: Wraith JE, Beck M, Giugliani R et al. Initial report from the Hunter outcome survey. Genet Med 2008: 10: Jones SA, Almassy Z, Beck M et al. Mortality and cause of death in mucopolysaccharidosis type II-a historical review based on data from the Hunter Outcome Survey (HOS). J Inherit Metab Dis 2009: 32: Cohn GM, Morin I, Whiteman DA, Hunter Outcome Survey Investigators. Development of a mnemonic screening tool for identifying subjects with Hunter syndrome. Eur J Pediatr 2013: 172: Quaio CR, Grinberg H, Vieira ML et al. Report of a large Brazilian family with a very attenuated form of Hunter syndrome (MPS II). JIMD Rep 2012: 4: DiFerrante N, Nichols BL. A case of the Hunter syndrome with progeny. Johns Hopkins Med J 1972: 130: Muenzer J, Gucsavas-Calikoglu M, McCandless SE, Schuetz TJ, Kimura A. A phase I/II clinical trial of enzyme replacement therapy in mucopolysaccharidosis II (Hunter syndrome). Mol Genet Metab 2007: 90: