Identifying Mutations Responsible for Rare Disorders Using New Technologies

Size: px
Start display at page:

Download "Identifying Mutations Responsible for Rare Disorders Using New Technologies"

Transcription

1 Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada

2 Mendelian Diseases Clear mode of inheritance dominant of recessive High penetrance having the mutation determines the phenotype with near certainty Clear phenotypic consequences Low environmental influence lack of phenocopies Examples Tay-Sachs disease, Cystic Fibrosis

3 Finding causes of Mendelian Disorders Although many of those disorders are rare (1:2000 1:100,000 incidence), taken together they constitute a substantial health burden It is estimated that over 90% of Mendelian disorders are caused by mutations in the coding regions (missense, nonsense, frameshifts, in/dels, splicing) Traditionally, the approach was via genetic linkage analysis, followed by targeted sequencing of candidate genes. In view of new technologies can we do better?

4

5 1993

6

7 Homozygosity mapping Today The American Journal of Human Genetics(2010)doi: /j.ajhg Conventional mutation mapping strategy for autosomal recessive disorders. Here we collected four patients from consanguinous Bedouin families in Qatar with the Van den Ende-Gupta Syndrome (VDEGS). Genotyping using SNP arrays identified a region of shared homozygosity presumably inherited from a common ancestor and containing the mutation mb in length, containing 44 genes.

8 We concurrently conducted conventional Sanger sequencing of candidate genes and whole-exome sequencing. In this case, the targeted candidate approach was the winner, identifying two distinct pathogenic mutations in the SCARF2 gene. A few days later, results from exome sequencing confirmed this result and helped to exclude all other candidate genes in the region. A. Presence and effect of c.1328_1329deltg mutation. B. Presence and effect of c.773g>a mutation. C. Conservation of residues near 773G>A (p.c258y) mutation. D. Exome capture and sequencing results inthe mother of patient 1. Sanger Sequencing and Exome Capture

9 High Throughput Sequencing E.g. Illumina HiSeq, or ABI Solid Main characteristics typically produce millions to hundreds of millions short (50-100bp) sequencing reads per application Reads can be aligned to the reference genome, and variants identified Currently, sequencing of the entire human genome is still quite expensive - $9k today. Can we sequence a subset of the genome?

10 What is Exome Capture? A method that uses specific probes to capture only the coding portions of all annotated exons within the genome. This is followed by high throughput shotgun sequencing. Our group uses the Agilent SureSelect Human All Exon Kit (in solution beads), followed by Illumina GAIIx, 76 bp read sequencing (single lane).

11 Coverage Statistics Exome coverage obtained by Agilent All Exon in solution capture process, followed by Illumina sequencing. The bars represent coverage from 1, 2, and 3 lanes of 76 base reads. E.g., two lanes of sequence produce an average 52.3X coverage of the exome, 90% of the exome is covered at >10X level, and 95% at > 5X. In our experience, 2 lanes of sequencing provide excellent coverage at a reasonable cost. Further, slight improvement in coverage upon increasing the number of lanes is not warranted. Current bottom line should be able to get high quality 50X exome for around $2k

12 Current Analysis Pipeline Exome Capture and Sequencing by Genome Quebec Platforms Base calling, QC standard Illumina Pipeline Alignment to reference genome BWA Retain unique alignments only SNV and in/del calls (SAMTools, GATK) CNV calls (in house) Annotate functional variants as (ANNOVAR) Filtering Other exomes (~50) Key!!! dbsnp 1000 Genomes Relax filtering criteria if necessary

13 END USER OUTPUT

14 Filtering The Data

15 Filtering The Data

16 Visualization, manual QC and inspection

17 Visualization, manual QC and inspection

18 ONGOING Projects Part of the FORGE consortium, Canada-wide (GC/CIHR) Part of the IGNITE project, Dalhousie-Atlantic Canada (GC) RaDiCAL (McGill/MUHC) Numerous collaborations with individual researchers McGill, Quebec, Canada, France, Poland, Qatar, Lebanon

19 Successes so far - new genes Fowler Syndrome Mitochondrial Disease (2) Vitamin B12 metabolism (2) Nephrotic Syndrome LCA Hajdu-Cheney Syndrome Hyper IgM (2) Novel developmental dysmorphisms (2)

20 Two unrelated patients total study time = 2 weeks from DNA sample to gene

21 Schematic of the FLVCR2 mutations found in two patients (F1 and F3). A. The four mutations in FLVCR2 identified in F1 and F3 using whole exome sequencing as visualized using the Integrative Genomics Viewer from the Broad Institute ( B Mutations in FLVCR2 are shown relative to the protein domains.

22 Mol Cell Biol Sep 7. [Epub ahead of print] The Fowler Syndrome associated protein FLVCR2 is an importer of heme. Duffy SP, Shing J, Saraon P, Berger LC, Eiden MV, Wilde A, Tailor CS. Program in Cell Biology, The Hospital for Sick Children, Toronto, ON M5G 1X8, Canada; Department of Molecular Genetics, University of Toronto, Toronto, ON M5G, Canada; National Institute of Mental Health, Laboratory of Cellular & Molecular Regulation, Bethesda, MD USA.

23 Hajdu-Cheney Syndrome (with Mark Samuels and Jeremy Schwartzentruber) Rare dominant disease, characterized by bone deterioration (our first dominant, FORGE project) < 100 patients known worldwide DNA from 3 affected family members, + 3 unrelated individuals Exome sequencing Identification of variants 2 days after sequence data available gene found All patients have truncating mutations in the last exon of the gene Notch2 Paper prepared for publication during the next week But...

24 Monday...

25 Summary Exome Sequencing is a fast and efficient way to identify new disease genes In our hands, success rates vary from 100% (families) to 33% (single individuals) Other applications: - genomic molecular diagnosis - genetic testing

26 Summary Exome sequencing is a rapid and increasingly affordable method of identifying disease mutations CNVs (large structural variants) can be detected We have successfully found mutations in a number of additional recessive disorders, using only a single individual In the next few months dozens of new disease genes/mutations will be identified Next step - Genomic Molecular Diagnosis

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

FORGE Canada: A nation-wide effort to identify genes for rare childhood disorders Kym Boycott, PhD, MD, FRCPC, FCCMG

FORGE Canada: A nation-wide effort to identify genes for rare childhood disorders Kym Boycott, PhD, MD, FRCPC, FCCMG FORGE Canada: A nation-wide effort to identify genes for rare childhood disorders Kym Boycott, PhD, MD, FRCPC, FCCMG Children s Hospital of Eastern Ontario Research Institute University of Ottawa, Canada

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen

Variant Detection & Interpretation in a diagnostic context. Christian Gilissen Variant Detection & Interpretation in a diagnostic context Christian Gilissen c.gilissen@gen.umcn.nl 28-05-2013 So far Sequencing Johan den Dunnen Marja Jakobs Ewart de Bruijn Mapping Victor Guryev Variant

More information

How many disease-causing variants in a normal person? Matthew Hurles

How many disease-causing variants in a normal person? Matthew Hurles How many disease-causing variants in a normal person? Matthew Hurles Summary What is in a genome? What is normal? Depends on age What is a disease-causing variant? Different classes of variation Final

More information

Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray

Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray Implementation of the DDD/ClinGen OGT (CytoSure v3) Microarray OGT UGM Birmingham 08/09/2016 Dom McMullan Birmingham Women's NHS Trust WM chromosomal microarray (CMA) testing Population of ~6 million (10%)

More information

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still

variant led to a premature stop codon p.k316* which resulted in nonsense-mediated mrna decay. Although the exact function of the C19L1 is still 157 Neurological disorders primarily affect and impair the functioning of the brain and/or neurological system. Structural, electrical or metabolic abnormalities in the brain or neurological system can

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve

The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve The Deciphering Development Disorders (DDD) project: What a genomic approach can achieve RCP ADVANCED MEDICINE, LONDON FEB 5 TH 2018 HELEN FIRTH DM FRCP DCH, SANGER INSTITUTE 3,000,000,000 bases in each

More information

Home Brewed Personalized Genomics

Home Brewed Personalized Genomics Home Brewed Personalized Genomics The Quest for Meaningful Analysis Results of a 23andMe Exome Pilot Trio of Myself, Wife, and Son February 22, 2013 Gabe Rudy, Vice President of Product Development Exome

More information

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht

NGS panels in clinical diagnostics: Utrecht experience. Van Gijn ME PhD Genome Diagnostics UMCUtrecht NGS panels in clinical diagnostics: Utrecht experience Van Gijn ME PhD Genome Diagnostics UMCUtrecht 93 Gene panels UMC Utrecht Cardiovascular disease (CAR) (5 panels) Epilepsy (EPI) (11 panels) Hereditary

More information

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi

CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE. Dr. Bahar Naghavi 2 CURRENT GENETIC TESTING TOOLS IN NEONATAL MEDICINE Dr. Bahar Naghavi Assistant professor of Basic Science Department, Shahid Beheshti University of Medical Sciences, Tehran,Iran 3 Introduction Over 4000

More information

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG)

MEDICAL GENOMICS LABORATORY. Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Next-Gen Sequencing and Deletion/Duplication Analysis of NF1 Only (NF1-NG) Ordering Information Acceptable specimen types: Fresh blood sample (3-6 ml EDTA; no time limitations associated with receipt)

More information

Identification of genomic alterations in cervical cancer biopsies by exome sequencing

Identification of genomic alterations in cervical cancer biopsies by exome sequencing Chapter- 4 Identification of genomic alterations in cervical cancer biopsies by exome sequencing 105 4.1 INTRODUCTION Athough HPV has been identified as the prime etiological factor for cervical cancer,

More information

Van test naar diagnose naar

Van test naar diagnose naar Van test naar diagnose naar V therapie op maat Marjolein Kriek, LUMC Joris Veltman, RUNMC Exome diagnostics in genetically heterogeneous disease Joris Veltman, PhD Department of Human Genetics Radboud

More information

PROGRESS: Beginning to Understand the Genetic Predisposition to PSC

PROGRESS: Beginning to Understand the Genetic Predisposition to PSC PROGRESS: Beginning to Understand the Genetic Predisposition to PSC Konstantinos N. Lazaridis, MD Associate Professor of Medicine Division of Gastroenterology and Hepatology Associate Director Center for

More information

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST

PERSONALIZED GENETIC REPORT CLIENT-REPORTED DATA PURPOSE OF THE X-SCREEN TEST INCLUDED IN THIS REPORT: REVIEW OF YOUR GENETIC INFORMATION RELEVANT TO ENDOMETRIOSIS PERSONAL EDUCATIONAL INFORMATION RELEVANT TO YOUR GENES INFORMATION FOR OBTAINING YOUR ENTIRE X-SCREEN DATA FILE PERSONALIZED

More information

Illuminating the genetics of complex human diseases

Illuminating the genetics of complex human diseases Illuminating the genetics of complex human diseases Michael Schatz Sept 27, 2012 Beyond the Genome @mike_schatz / #BTG2012 Outline 1. De novo mutations in human diseases 1. Autism Spectrum Disorder 2.

More information

NGS in neurodegenerative disorders - our experience

NGS in neurodegenerative disorders - our experience Neurology Clinic, Clinical Center of Serbia Faculty of Medicine, University of Belgrade Belgrade, Serbia NGS in neurodegenerative disorders - our experience Marija Branković, MSc Belgrade, 2018 Next Generation

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

NGS in tissue and liquid biopsy

NGS in tissue and liquid biopsy NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences

More information

SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab

SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines

Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Merging single gene-level CNV with sequence variant interpretation following the ACMGG/AMP sequence variant guidelines Tracy Brandt, Ph.D., FACMG Disclosure I am an employee of GeneDx, Inc., a wholly-owned

More information

Supplemental Data. De Novo Truncating Mutations in WASF1. Cause Intellectual Disability with Seizures

Supplemental Data. De Novo Truncating Mutations in WASF1. Cause Intellectual Disability with Seizures The American Journal of Human Genetics, Volume 13 Supplemental Data De Novo Truncating Mutations in WASF1 Cause Intellectual Disability with Seizures Yoko Ito, Keren J. Carss, Sofia T. Duarte, Taila Hartley,

More information

Whole exome sequencing identifies a novel DFNA9 mutation, C162Y

Whole exome sequencing identifies a novel DFNA9 mutation, C162Y Clin Genet 2013: 83: 477 481 Printed in Singapore. All rights reserved Short Report 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd CLINICAL GENETICS doi: 10.1111/cge.12006 Whole exome

More information

The Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012

The Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012 The Promise of Epilepsy Genetics A Personal & Scientific Perspective December 3, 2012 Tracy Dixon-Salazar, Ph.D. University of California, San Diego American Epilepsy Society Annual Meeting 1 Disclosure

More information

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients

AD (Leave blank) TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients AD (Leave blank) Award Number: W81XWH-12-1-0444 TITLE: Genomic Characterization of Brain Metastasis in Non-Small Cell Lung Cancer Patients PRINCIPAL INVESTIGATOR: Mark A. Watson, MD PhD CONTRACTING ORGANIZATION:

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

TP53 mutational profile in CLL : A retrospective study of the FILO group.

TP53 mutational profile in CLL : A retrospective study of the FILO group. TP53 mutational profile in CLL : A retrospective study of the FILO group. Fanny Baran-Marszak Hopital Avicenne Bobigny France 2nd ERIC workshop on TP53 analysis in CLL, Stresa 2017 TP53 abnormalities :

More information

MEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG)

MEDICAL GENOMICS LABORATORY. Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Non-NF1 RASopathy panel by Next-Gen Sequencing and Deletion/Duplication Analysis of SPRED1 (NNP-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with

More information

!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;&

!##$%#&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;& !!! "#$%&'($)*!+&,-$!.)/+$!+$!01,-$1'$!!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo 0$2-3!44566!! +,-./&01,23&34,53&63783.9-.:&;.6-6&-.&;& 582/-:3.3?;/-,.;2&@;5-2>&63:?3:;/-.:&#>A3&B&!-;C3/36&!.&))3'&!(2$&#)$7$23!+$(2$8-$#1'&!+$!177&'&#91!!

More information

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm

Welcome to the Genetic Code: An Overview of Basic Genetics. October 24, :00pm 3:00pm Welcome to the Genetic Code: An Overview of Basic Genetics October 24, 2016 12:00pm 3:00pm Course Schedule 12:00 pm 2:00 pm Principles of Mendelian Genetics Introduction to Genetics of Complex Disease

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Leber congenital amaurosis OMIM number for disease 204000 Disease alternative

More information

Lab Activity Report: Mendelian Genetics - Genetic Disorders

Lab Activity Report: Mendelian Genetics - Genetic Disorders Name Date Period Lab Activity Report: Mendelian Genetics - Genetic Disorders Background: Sometimes genetic disorders are caused by mutations to normal genes. When the mutation has been in the population

More information

Concurrent Practical Session ACMG Classification

Concurrent Practical Session ACMG Classification Variant Effect Prediction Training Course 6-8 November 2017 Prague, Czech Republic Concurrent Practical Session ACMG Classification Andreas Laner / Anna Benet-Pagès 1 Content 1. Background... 3 2. Aim

More information

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space

BWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate

More information

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R

Frequency(%) KRAS G12 KRAS G13 KRAS A146 KRAS Q61 KRAS K117N PIK3CA H1047 PIK3CA E545 PIK3CA E542K PIK3CA Q546. EGFR exon19 NFS-indel EGFR L858R Frequency(%) 1 a b ALK FS-indel ALK R1Q HRAS Q61R HRAS G13R IDH R17K IDH R14Q MET exon14 SS-indel KIT D8Y KIT L76P KIT exon11 NFS-indel SMAD4 R361 IDH1 R13 CTNNB1 S37 CTNNB1 S4 AKT1 E17K ERBB D769H ERBB

More information

CITATION FILE CONTENT/FORMAT

CITATION FILE CONTENT/FORMAT CITATION For any resultant publications using please cite: Matthew A. Field, Vicky Cho, T. Daniel Andrews, and Chris C. Goodnow (2015). "Reliably detecting clinically important variants requires both combined

More information

Title:Exome sequencing helped the fine diagnosis of two siblings afflicted with atypical Timothy syndrome (TS2)

Title:Exome sequencing helped the fine diagnosis of two siblings afflicted with atypical Timothy syndrome (TS2) Author's response to reviews Title:Exome sequencing helped the fine diagnosis of two siblings afflicted with atypical Timothy syndrome (TS2) Authors: Sebastian Fröhler (Sebastian.Froehler@mdc-berlin.de)

More information

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist

TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY. Giuseppe Narzisi, PhD Bioinformatics Scientist TOWARDS ACCURATE GERMLINE AND SOMATIC INDEL DISCOVERY WITH MICRO-ASSEMBLY Giuseppe Narzisi, PhD Bioinformatics Scientist July 29, 2014 Micro-Assembly Approach to detect INDELs 2 Outline 1 Detecting INDELs:

More information

CHROMOSOMAL MICROARRAY (CGH+SNP)

CHROMOSOMAL MICROARRAY (CGH+SNP) Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN

VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN VARIANT PRIORIZATION AND ANALYSIS INCORPORATING PROBLEMATIC REGIONS OF THE GENOME ANIL PATWARDHAN Email: apatwardhan@personalis.com MICHAEL CLARK Email: michael.clark@personalis.com ALEX MORGAN Email:

More information

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.

P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences

More information

WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS

WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS WHOLE EXOME SEQUENCING PIPELINE EVALUATION AND MUTATION DETECTION IN ESOPHAGEAL CANCER PATIENTS SUMMARY Tran Thi Bich Ngoc 1 ; Ho Viet Hoanh 2 ; Vu Phuong Nhung 1 ; Nguyen Hai Ha 1 Nguyen Van Ba 2 ; Nguyen

More information

Detection of copy number variations in PCR-enriched targeted sequencing data

Detection of copy number variations in PCR-enriched targeted sequencing data Detection of copy number variations in PCR-enriched targeted sequencing data German Demidov Parseq Lab, Saint-Petersburg University of Russian Academy of Sciences, current: Center for Genomic Regulation

More information

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT

Genetic Testing and Analysis. (858) MRN: Specimen: Saliva Received: 07/26/2016 GENETIC ANALYSIS REPORT GBinsight Sample Name: GB4411 Race: Gender: Female Reason for Testing: Type 2 diabetes, early onset MRN: 0123456789 Specimen: Saliva Received: 07/26/2016 Test ID: 113-1487118782-4 Test: Type 2 Diabetes

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data. Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype

More information

Benefits and pitfalls of new genetic tests

Benefits and pitfalls of new genetic tests Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

MutationTaster & RegulationSpotter

MutationTaster & RegulationSpotter MutationTaster & RegulationSpotter Pathogenicity Prediction of Sequence Variants: Past, Present and Future Dr. rer. nat. Jana Marie Schwarz Klinik für Pädiatrie m. S. Neurologie Exzellenzcluster NeuroCure

More information

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow

More information

New Enhancements: GWAS Workflows with SVS

New Enhancements: GWAS Workflows with SVS New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences

More information

Chapter 1 : Genetics 101

Chapter 1 : Genetics 101 Chapter 1 : Genetics 101 Understanding the underlying concepts of human genetics and the role of genes, behavior, and the environment will be important to appropriately collecting and applying genetic

More information

No mutations were identified.

No mutations were identified. Hereditary High Cholesterol Test ORDERING PHYSICIAN PRIMARY CONTACT SPECIMEN Report date: Aug 1, 2017 Dr. Jenny Jones Sample Medical Group 123 Main St. Sample, CA Kelly Peters Sample Medical Group 123

More information

NextGen Sequencing and Brain Diseases: a Pot Pourri. Guy A. Rouleau, MD, PhD, FRCP(C) University of McGill Montreal Neurological Institute

NextGen Sequencing and Brain Diseases: a Pot Pourri. Guy A. Rouleau, MD, PhD, FRCP(C) University of McGill Montreal Neurological Institute NextGen Sequencing and Brain Diseases: a Pot Pourri Guy A. Rouleau, MD, PhD, FRCP(C) University of McGill Montreal Neurological Institute Disclamers I have no conflicts of interests in this work I have

More information

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies

Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Cytogenetics 101: Clinical Research and Molecular Genetic Technologies Topics for Today s Presentation 1 Classical vs Molecular Cytogenetics 2 What acgh? 3 What is FISH? 4 What is NGS? 5 How can these

More information

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection

Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis ACE Clinical Exome The First Test to Combine an Enhanced Clinical Exome with Genome- Scale Structural Variant Detection Personalis, Inc. 1350 Willow Road, Suite 202, Menlo Park, California 94025

More information

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014

Challenges of CGH array testing in children with developmental delay. Dr Sally Davies 17 th September 2014 Challenges of CGH array testing in children with developmental delay Dr Sally Davies 17 th September 2014 CGH array What is CGH array? Understanding the test Benefits Results to expect Consent issues Ethical

More information

Human Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980

Human Genetics of Tuberculosis. Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human Genetics of Tuberculosis Laurent Abel Laboratory of Human Genetics of Infectious Diseases University Paris Descartes/INSERM U980 Human genetics in tuberculosis? Concept Epidemiological/familial

More information

Genetics and Genomics: Applications to Developmental Disability

Genetics and Genomics: Applications to Developmental Disability Tuesday, 12:30 2:00, B1 Objective: Genetics and Genomics: Applications to Developmental Disability Helga Toriello 616-234-2712 toriello@msu.edu Identify advances in clinical assessment and management of

More information

Pedigree Analysis Why do Pedigrees? Goals of Pedigree Analysis Basic Symbols More Symbols Y-Linked Inheritance

Pedigree Analysis Why do Pedigrees? Goals of Pedigree Analysis Basic Symbols More Symbols Y-Linked Inheritance Pedigree Analysis Why do Pedigrees? Punnett squares and chi-square tests work well for organisms that have large numbers of offspring and controlled mating, but humans are quite different: Small families.

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider

Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier/Additional Provider TEST DISORDER/CONDITION POPULATION TRIAD Submitting laboratory: Exeter RGC Approved: Sept 2013 1. Disorder/condition

More information

Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals

Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals Bansal et al. BMC Medicine (2017) 15:213 DOI 10.1186/s12916-017-0977-3 RESEARCH ARTICLE Spectrum of mutations in monogenic diabetes genes identified from high-throughput DNA sequencing of 6888 individuals

More information

Genetic Counselling in relation to genetic testing

Genetic Counselling in relation to genetic testing Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major

More information

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels

6/12/2018. Disclosures. Clinical Genomics The CLIA Lab Perspective. Outline. COH HopeSeq Heme Panels Clinical Genomics The CLIA Lab Perspective Disclosures Raju K. Pillai, M.D. Hematopathologist / Molecular Pathologist Director, Pathology Bioinformatics City of Hope National Medical Center, Duarte, CA

More information

Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing

Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing www.sciencemag.org/cgi/content/full/science.1186802/dc1 Supporting Online Material for Analysis of Genetic Inheritance in a Family Quartet by Whole-Genome Sequencing Jared C. Roach, Gustavo Glusman, Arian

More information

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY

CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Reporting TP53 gene analysis results in CLL

Reporting TP53 gene analysis results in CLL Reporting TP53 gene analysis results in CLL Mutations in TP53 - From discovery to clinical practice in CLL Discovery Validation Clinical practice Variant diversity *Leroy at al, Cancer Research Review

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Sequencing studies implicate inherited mutations in autism

Sequencing studies implicate inherited mutations in autism NEWS Sequencing studies implicate inherited mutations in autism BY EMILY SINGER 23 JANUARY 2013 1 / 5 Unusual inheritance: Researchers have found a relatively mild mutation in a gene linked to Cohen syndrome,

More information

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016

Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Multiple Copy Number Variations in a Patient with Developmental Delay ASCLS- March 31, 2016 Marwan Tayeh, PhD, FACMG Director, MMGL Molecular Genetics Assistant Professor of Pediatrics Department of Pediatrics

More information

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology

JULY 21, Genetics 101: SCN1A. Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology JULY 21, 2018 Genetics 101: SCN1A Katie Angione, MS CGC Certified Genetic Counselor CHCO Neurology Disclosures: I have no financial interests or relationships to disclose. Objectives 1. Review genetic

More information

The Foundations of Personalized Medicine

The Foundations of Personalized Medicine The Foundations of Personalized Medicine Jeremy M. Berg Pittsburgh Foundation Professor and Director, Institute for Personalized Medicine University of Pittsburgh Personalized Medicine Physicians have

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

NGS Types of gene dossier applications UKGTN can evaluate

NGS Types of gene dossier applications UKGTN can evaluate NGS Types of gene dossier applications UKGTN can evaluate Jo Whittaker on behalf of the Genetic Test Evaluation Working Group & UKGTN Project team NGS used in a number of ways Replacement technology for

More information

The Application of Whole-Exome Sequencing in Diagnosing Pediatric Rare Disease in Hong Kong

The Application of Whole-Exome Sequencing in Diagnosing Pediatric Rare Disease in Hong Kong North American Journal of Medicine and Science Oct 2014 Vol 7 No.4 139 Review The Application of Whole-Exome Sequencing in Diagnosing Pediatric Rare Disease in Hong Kong Christopher CY Mak, MBChB;^ Dingge

More information

TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges

TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges TPMI Presents: Translational Genomics Research Update, Opportunities and Challenges April 12, 2016 Darren D. O Rielly, Ph.D., FCCMG Director, Molecular Genetics Laboratory, Eastern Health Director, Translational

More information

Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline

Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline Genome Wide Variant Analysis of Simplex Autism Families with an Integrative Clinical-Bioinformatics Pipeline Laura T. Jiménez-Barrón 1,5, Jason A. O Rawe 1,2, Yiyang Wu 1,2, Margaret Yoon 1, Han Fang 1,

More information

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland

PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland AD Award Number: W81XWH-10-1-0589 TITLE: Global Characterization of Protein Altering Mutations in Prostate Cancer PRINCIPAL INVESTIGATOR: Jay Shendure, M.D., Ph.D. CONTRACTING ORGANIZATION: University

More information

Problem set questions from Final Exam Human Genetics, Nondisjunction, and Cancer

Problem set questions from Final Exam Human Genetics, Nondisjunction, and Cancer Problem set questions from Final Exam Human Genetics, Nondisjunction, and ancer Mapping in humans using SSRs and LOD scores 1. You set out to genetically map the locus for color blindness with respect

More information

MutationTaster & RegulationSpotter

MutationTaster & RegulationSpotter Practical MutationTaster & RegulationSpotter Daniela Hombach & Jana Marie Schwarz Exzellenzcluster NeuroCure Charité Universitätsmedizin Berlin AG Translational Genomics 08.11.2017 Rare diseases 7000 8000rare

More information

A guide to understanding variant classification

A guide to understanding variant classification White paper A guide to understanding variant classification In a diagnostic setting, variant classification forms the basis for clinical judgment, making proper classification of variants critical to your

More information

Rare Variant Burden Tests. Biostatistics 666

Rare Variant Burden Tests. Biostatistics 666 Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls

More information

Human Genetics 542 Winter 2018 Syllabus

Human Genetics 542 Winter 2018 Syllabus Human Genetics 542 Winter 2018 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Jan 3 rd Wed Mapping disease genes I: inheritance patterns and linkage analysis

More information

The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients

The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients The 100,000 Genomes Project Harnessing the power of genomics for NHS rare disease and cancer patients Dr Richard Scott, Clinical Lead for Rare Disease Dr Nirupa Murugaesu, Clinical Lead for Cancer Four

More information

Supplementary Information

Supplementary Information 1 Supplementary Information MATERIALS AND METHODS Study subjects Exome-sequenced HBOC patients Clinical characteristics of 24 exome-sequenced HBOC patients are presented in Table 1. Table 1. Clinical characteristics

More information

Dan Koller, Ph.D. Medical and Molecular Genetics

Dan Koller, Ph.D. Medical and Molecular Genetics Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification

More information

Human Genetics 542 Winter 2017 Syllabus

Human Genetics 542 Winter 2017 Syllabus Human Genetics 542 Winter 2017 Syllabus Monday, Wednesday, and Friday 9 10 a.m. 5915 Buhl Course Director: Tony Antonellis Module I: Mapping and characterizing simple genetic diseases Jan 4 th Wed Mapping

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues

Clinical Genetics. Functional validation in a diagnostic context. Robert Hofstra. Leading the way in genetic issues Clinical Genetics Leading the way in genetic issues Functional validation in a diagnostic context Robert Hofstra Clinical Genetics Leading the way in genetic issues Future application of exome sequencing

More information

Understanding The Genetics of Diamond Blackfan Anemia

Understanding The Genetics of Diamond Blackfan Anemia Understanding The Genetics of Diamond Blackfan Anemia Jason Farrar, MD jefarrar@ About Me Assistant Professor of Pediatrics at University of Arkansas for Medical Sciences & Arkansas Children s Hospital

More information