Quality Control Analysis of Add Health GWAS Data

Size: px
Start display at page:

Download "Quality Control Analysis of Add Health GWAS Data"

Transcription

1 2018 Add Health Documentation Report prepared by Heather M. Highland Quality Control Analysis of Add Health GWAS Data Christy L. Avery Qing Duan Yun Li Kathleen Mullan Harris CAROLINA POPULATION CENTER CAROLINA SQUARE - SUITE WEST FRANKLIN STREET CHAPEL HILL, NC Add Health GWAS data was funded by Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) Grants R01 HD to Kathleen Mullan Harris and R01 HD to Kathleen Mullan Harris, Jason D. Boardman, and Matthew B. McQueen, and is supported by NICHD grant P01 HD31921, with cooperative funding from 23 other federal agencies and foundations. Further information may be obtained by contacting Add Health at adhealth@unc.edu.

2 Quality Control Analysis of Add Health GWAS Data Heather M. Highland, Christy L. Avery, Qing Duan, Yun Li, and Kathleen Mullan Harris University of North Carolina at Chapel Hill Add Health design The National Longitudinal Study of Adolescent to Adult Health (Add Health) is an ongoing, nationally-representative longitudinal study of the social, behavioral, and biological linkages in health and developmental trajectories from early adolescence into adulthood. The Add Health cohort was drawn from a probability sample of 132 middle and high schools and is representative of American adolescents in grades 7-12 in The adolescent cohort has been followed for 20+ years with in-home interviews in 1995 (Wave I, 79% response rate), 1996 (Wave II, 89% response rate), (Wave III, 77% response rate), and 2008 (Wave IV, 80% response rate). Wave V is currently underway in when respondents are aged The Add Health design included an embedded genetic sample of pairs of identical twins, fraternal twins, full sibs, half sibs, and adolescents who grew up in the same household but have no biological relationship. Add Health is a multiracial and multiethnic sample with substantial numbers of individuals with Hispanic and Asian ancestry. For more information about the design of Add Health see Harris 2010 and Harris et al Genome-wide Genotyping At Wave IV, Add Health collected Oragene saliva samples from consenting participants (96% of n=15,701), and requested a second consent to archive their samples for future genomic studies. Approximately 80% consented to archive and were thus eligible for genome-wide genotyping. Genotyping was completed over three years funded by R01 HD (PI Harris) and R01 HD (PIs Harris, Boardman, and McQueen). Add Health utilized two Illumina platforms for genotyping: the Illumina Human Omni1-Quad BeadChip for the majority of samples and the Illumina Human Omni-2.5 Quad BeadChip for the remainder. The two platforms utilized tag SNP technology to identify and include over 1.1 million and 2.5 million genetic markers respectively from Omni1 and Omni2.5 derived from the International HapMap Project and the most informative markers from the 1000 Genomes Project (1KGP). The genetic markers include known diseaseassociated SNPs from multiple sources, ancestry-informative markers, sex chromosomes, and ABO blood typing markers. The platforms also included probes for the detection of copy number variation (CNV) covering all common CNV regions and more than 5,000 rare CNV regions. After quality control procedures (described below), genotype data were available for 9,974 individuals: n=7,917 from the Illumina HumanOmni1-Quad chip and for 2,057 individuals from the Illumina HumanOmni2.5-Quad chip (Figure 1). After filtering, the Add Health genotype GWAS data contained n=609,130 single-nucleotide polymorphisms (SNPs) common to both chips to enable joint imputation to the entire Add Health population (see below). Quality Control (QC) report for Illumina HumanOmni1-Quad. Below we describe our approach to participant- and SNP-level exclusions (Table 1). SNP Marker Set. Initially, 9,344 individuals (Add Health samples, duplicates, and HapMap controls) were genotyped by Illumina HumanOmni1-Quad with 1,140,419 markers each. A total of 1,058,111 markers are annotated by Illumina annotation file HumanOmni1-Quad-v1-0_H (82,308 markers excluded). The following markers were removed: 142,695 A/T or G/C markers due to alignment uncertainty; 1,985 markers that were triallelic or did not map to chromosome 1-22 or chromosome X. After these exclusions, 913,431 markers entered the first-pass marker level QC. Next, we removed markers with call rates < 90% (N=20,008) and minor allele frequency (MAF) < 0.5% (N=33,333). After the first-pass marker level QC, 860,090 markers remained.

3 Sample-level QC. Next we conducted sample level QC by removing 308 individuals with < 90% call rate. After this step, the total genotyping rate in the remaining 9,036 individuals reached We then converted IDs assigned during genotyping to Add Health ID or HapMap ID, dropping three individuals who could not be mapped (n=9,033 remained). After excluding 106 HapMap controls, a total of 8,927 Add Health samples (with duplicates) remained. HapMap controls concordance check. A total of 106 HapMap controls were genotyped together with the Add Health samples, 99 of which were HapMap sample NA12003 and 7 of which were HapMap sample NA We then compared the strand of HapMap controls and the external HapMap sample, NA12003, and performed the concordance check using the 518,630 overlapping and bi-allelic markers. The mean genotype matching error was and the mean allele matching error was Out of 518,630 markers, 5600 (1%) had mismatch rate > Duplicate Concordance. A total of 288 duplicate pairs were genotyped. Using PLINK to estimate IBD, 281 of the pairs had a PI_HAT >0.99. The seven pairs with PI_HAT<0.99 were dropped and the two plates on which these pairs resided were flagged for additional QC. For matching pairs, the genotyping instance with the highest call rate was retained. Sex check and heterozygosity check. We inferred genetic sex based on X chromosome heterozygosity as implemented in PLINK separately by self-reported race/ethnicity. Autosomal heterozygosity was also calculated and compared to X chromosome estimates. Using the heterozygosity estimate (F), genetic sex was defined to be female if F < 0.2 and male if F > 0.8 (PLINK default); F values indicated an ambiguous sex. A total of 94 genetic sexdiscordant samples were dropped and the plates on which the samples resided were flagged for additional QC. An additional 44 individuals with higher than expected autosomal heterozygosity or ambiguous X heterozygosity that may indicate a sex mismatch also were dropped; sex mismatches did not favor a particular direction, indicating that sample swaps, not contamination, was the likely problem (Table 2; Figure 2). Second-pass marker QC, HWE by ancestry. Marker level QC was repeated on the remaining individuals. Six markers were removed due to a call rate <90%; 120 markers were removed due to a MAF<0.5%; and 7,953 were removed due an ancestry specific Hardy-Weinberg Equilibrium P<5x10-5. Further we removed 4,375 variants that shows low concordance between duplicate pairs. Summary. The five preceding QC steps identified 55 plates with no evidence of sample switching through sex-mismatches or duplicate mismatch and 50 plates with evidence of at least one sample swap. Our strategy to identify participants with high certainty of sample identity on the 50 plates with evidence of sample misidentification was performed in conjunction with the data genotyped on the Omni 2.5 and therefore follows our description of Omni 2.5 QC. QC report for Illumina HumanOmni2.5-Quad. Below we describe our approach to participantand SNP-level exclusions (Table 1). SNP Marker Set. Initially, 2,461 individuals (Add Health samples, duplicates, and HapMap controls) were genotyped by Illumina HumanOmni2.5-Quad with 2,369,541 markers each. All markers were in the annotation file and none were removed due to alignment uncertainty. We then removed 9,328 markers not on chromosome 1-22 and chromosome X, leaving 2,360,213

4 markers entering the first-pass marker level QC. Further, for first pass QC, we removed markers with call rate < 90% (N=56,182) and MAF < 0.5% (N=571,200). After the first-pass marker level QC, 1,732,831 markers remained. Sample level QC. Next we conduct sample level QC by, first, removing 65 individuals with <90% call rate. After this step, the total genotyping rate in the remaining 2,396 individuals reached Next, we converted IDs assigned during genotyping to Add Health ID or HapMap ID; eight individuals could not be mapped (n=2,391 individuals remaining). Finally, after excluding the 30 HapMap controls, a total of 2,361 Add Health samples (with duplicates) remained. HapMap controls concordance check. A total of 30 HapMap controls were genotyped together with the Add Health samples, all of which were from HapMap sample NA For example, we compared the strand of HapMap controls and the external HapMap sample, NA12003, and performed the concordance check using the 468,501 overlapping and bi-allelic markers. Out of 464,508 markers, 2,166 (0.5%) had mismatch rate > 0.01, with remaining markers mean mismatch rate =0. Duplicate Concordance. A total of 48 duplicate pairs were genotyped. Using PLINK to estimate IBD, all of the pairs had a PI_HAT >0.99. Sex check and heterozygosity check. We inferred genetic sex based on X chromosome heterozygosity, as implemented in PLINK, separately within each self-reported race/ethnicity. Autosomal heterozygosity was also calculated and compared to X chromosome estimates. Genetic sex was again defined to be female if F < 0.2 and male if F > 0.8 (PLINK default), with F values indicative of ambiguous sex. Samples that were the opposite of self-reported sex (N=23) were dropped and plates on which these samples resided were flagged for additional QC. In addition, individuals with higher than expected autosomal heterozygosity, or ambiguous X heterozygosity that may indicate a sex mismatch (N=16) were also dropped. Sex mismatches did not favor a particular direction, indicating sample swapping, rather than contamination as the likely problem (Table 2, Figure 2). Second-pass marker QC, HWE by ancestry. Marker level QC was repeated on the remaining individuals. One hundred ninety three markers were removed due to a call rate <90%; 6,508 markers were removed due to a MAF<0.5%; and 4,607 were removed due an ancestry specific Hardy-Weinberg Equilibrium P<5x10-5. Further we removed 5,581 variants that shows low concordance between duplicate pairs. Summary. In total, the five preceding QC steps identified 13 plates with no evidence of sample switching through sex-mismatches or duplicate mismatch and 14 plates with evidence of at least one sample swap. Below we describe our strategy to identify participants with high certainty of sample identity on the 14 plates with evidence of sample misidentification. This was done in conjunction with the data genotyped on the Omni 1. Add Health Exome Chip data. Given the non-negligible proportion of plates with at least one potential instance of sample swapping, we performed a third round of QC by comparing all individuals genotyped on Omni 1 or 2.5 to previously performed Exome Chip genotyping, funded by R01 HD (PIs: Gordon-Larsen and North). Because the samples used for the exome genotyping were the first specimens selected from the Add Health DNA archive, they are considered to be of higher quality than those used for subsequent genotyping. (Consistent with

5 this expectation, QC of Exome Chip data indicated genotypes of high fidelity (e.g. >99% concordance in genetic vs. self-reported sex; 97% of participants with SNP missingness <3%). Exome Pairs. First, data from the Exome Chip and both Omni arrays were aligned and combined. Only markers well-genotyped on all three arrays were retained (n=2,961markers). A common dataset was then constructed, which included n= 20,150 individuals (with duplicates) and relatedness between these 20,150 individuals was calculated using PRIMUS 4 ( Of the 8,662 expected pairs (i.e. individuals genotyped on the Exome Chip and one of the Omni arrays), 8,585 matched (99%). Although the majority individuals that did not match their Exome Chip genotype resided on plates already flagged for additional follow up, an additional 11 plates were identified as containing a mismatch and flagged for additional QC. Sample Retention. All samples that resided on any of the 67 plates without evidence of sample swaps were retained (n=5,539), as were all Omni 1 and 2.5 array individuals who matched their ExomeChip pair (n=4,164) (Figure 1). For individuals that were not genotyped on the Exome Chip, they were retained if they showed a relationship as expected by self-report (i.e. if A and B reported they were full siblings and they showed IBD estimates consistent with that relationship or a one degree further away relationship (i.e. half-sibs), we retained both individuals) (n=338) (Figure 3). In total, 10,041 samples were retained. Merging Omni1 and Omni2.5 arrays and imputation. After initial QC, we merged the two genotyped SNP data sets. There were a total of 1,954,448 markers on the two arrays, of which 609,130 were common to both arrays and passed the above QC steps (call rate in merged data > 80%). As strand files were not available, all palindromic (i.e. G/C or A/T) SNPs were dropped. Two imputation releases are provided: imputation of European ancestral participants using the HRC imputation panel and the GSCAN protocol (see below); and imputation of all (i.e. multiethnic) Add Health participants to the 1000 Genomes Phase 3 imputation panel using the GLGC/GIANT protocol (see below). No filtering was performed after imputation. Relatedness More precise relatedness was calculated in all remaining individuals using PRIMUS 4 ( A set of 66 (n=10,041-66; 0.66%; 9,974 unique participants retained) participants appeared to be closely related to more individuals than is plausible. Because excessive relatedness can reflect genotyping error, these participants were removed from the genotype data. We also removed one unintentional duplicate. In the remaining 9,974 participants, the genetic relatedness matrix (GRM) was calculated using PLINK s --make-rel command. Among previously identified pairs, we genetically confirmed 143 monozygotic twin pairs, 185 dizygotic twin pairs, 499 full sibling pairs, and 158 half-sibling pairs. Population structure. To evaluate population structure, we calculated principal components in the unrelated subset in eigenstrat 5. The remaining individuals and HapMap3 reference samples were projected into this space (Figure 4). These eigenvectors may be used as covariates in the statistical model used for association testing to adjust for possible population stratification.

6 Table 1. SNP- and sample-level exclusions yielding n=10,778* unique Add Health participants for second-pass QC. Procedure Omni1 Omni 2.5 N. N. markers individuals N. markers N. individuals Start 1,140,419 9,344 2,369,541 2,461 Markers in the annotation file 1,058,111 9,344 na na Removing A/T G/C markers and markers with both alleles missing/alignment uncertainty 915,416 9,344 na na Removing triallelic markers and markers not on chromosomes ,431 9,344 2,360,213 2,461 Removing markers with call rate < 90% 893,423 9,344 2,304,031 2,461 Removing markers with call rate MAF < 0.5% 860,090 9,344 1,732,831 2,461 Removing individuals with call rate < 90% 860,090 9,036 1,732,831 2,396 Updating EAID to AID 860,090 9,033 1,732,831 2,391 Exclude HapMap controls 860,090 8,927 1,732,831 2,361 Duplicate concordance check 860,090 8,645 1,732,831 2,314 Sex check 860,090 8,551 1,732,831 2,291 Het check + sex check 860,090 8,507 1,732,831 2,275 2nd-pass call rate< 90% 860,084 8,507 1,732,638 2,275 2nd-pass MAF 859,964 8,507 1,726,130 2,275 HWE 852,011 8,508 1,721,523 2,275 Poor duplicate concordance 847,636 8,508 1,715,942 2,275 *Five Add Health participants were genotyped on both Omni 1 and Omni 2.5 chips, yielding a combined sample size of 10,783; n=10,778 unique participants.

7 Table 2: Direction of Sex Mismatches. F < 0.2, female; F > 0.8, male Omni1 Omni2.5 Reported sex M; genetic sex F Reported sex F; genetic sex M Reported sex M; genetic sex F Reported sex F; genetic sex M White Black 6 6 NA NA Native American Asian Hispanic

8 Figure 1. Second-pass QC sample retention strategy. Of the initial 10,778 samples retained after SNP- and sample-level exclusions (Table 1), 5,539 samples were genotyped only on plates with no evidence of sex mismatches or duplicate errors. In order to maximize our sample size, we then performed third pass QC, which examined independently genotyped exome chip data and previously reported kinship. Using these independent sources, we retained a total of n=4,164 whose Omni and Exome Chip data matched, n=338 participants that showed a biologically plausible relationship (within 1 degree of self-reported relationship) with another genotyped participant that passed QC (either Exome or Omni data). After these QC steps, we identified a sample size of n=10,041 participants.

9 Figure 2. Autosomal and sex heterozygosity, by race/ethnicity and genotyping platform.

10 Figure 3. Allele sharing color coded by self-reported relationship

11 Figure 4. PCA plots overall and by self-reported race/ethnicity.

12 LITERATURE CITED 1. Altshuler, D. et al. A haplotype map of the human genome. Nature 437, (2005). 2. Altshuler, D. et al. A map of human genome variation from population-scale sequencing. Nature 467, (2010). 3. Bahlo, M. et al. Saliva-Derived DNA Performs Well in Large-Scale, High-Density Single- Nucleotide Polymorphism Microarray Studies. Cancer Epidemiology Biomarkers & Prevention 19, (2010). 4. Staples, J. et al. PRIMUS: rapid reconstruction of pedigrees from genome-wide estimates of identity by descent. Am J Hum Genet 95, (2014). 5. Patterson, N., Price, A.L. & Reich, D. Population structure and eigenanalysis. PLoS Genet 2, e190 (2006).

13 Add Health Haplotype Reference Consortium (HRC) Imputation Protocol Summary: Europeans in the final release of the Add Health genotyped data were imputed with Release 1 of the Haplotype Reference Consortium reference panel (HRCr1.1). 1 The HRC panel currently provides the most comprehensive imputation panel for European ancestry. Amongst other uses, HRC imputed data may commonly be used both for genome-wide association studies or for the construction of polygenic scores using imputed (rather than genotyped) data. For imputation of non-european samples, the 1000 Genomes Phase 3 reference panel 2 is currently more appropriate. SNP-Level Filters: Before imputation, some SNP-level filters were applied. Of 606,673 variants in the final Add Health genotyped data, 13,721 were removed with a per-variant missing call rate filter of 0.02; 245,589 were removed with a Hardy-Weinberg Equilibrium filter of , and 609 were removed with a minor allele frequency filter of 0.01, leaving 346,754 SNPs carried through to imputation. Individual-Level Filters: Some individual-level filters were also applied. First, the sample was reduced to only individuals of genetically-determined European ethnicity. European ethnicity was ascertained through the protocol developed for the common variant association analysis of the GWAS & Sequencing Consortium of Alcohol and Nicotine use (GSCAN). The GSCAN website is available here: and the ethnicity protocol can be found in the GSCAN GWAS analysis plan available here: 2.

14 Results of that Principal-Components based analysis are plotted here: In total, of 9,974 individuals in the final Add Health genotyped data, 4,187 non-european individuals were dropped. Next, individuals with high rates of genotyping failures were removed with a per-sample missing call rate of In total, of 9,974 individuals in the final Add Health genotyped data, 40 nonindividuals were dropped. Finally, individuals with excessively high or low rates of heterozygosity were removed by dropping those with an F-statistic lower than -0.3 or higher than 0.3. In total, of 9,974 individuals in the final Add Health genotyped data, 58 individuals were dropped. Ancestral outliers were screened for using the Plink Identity-By-State (IBS) binomial test with a threshold of 0.05, though no outliers were identified. In summary, 5,690 individuals were carried through to imputation.

15 Imputation: Imputation was performed with the Michigan Imputation Server 3, using the HRC r reference panel and ShapeIt v2.r790 phasing software. Options were specified for a European ( EUR ) population and for Quality Control & Imputation mode. The free Michigan Imputation Server is available here: Imputation was completed and imputed.vcf files downloaded on July 25, 2017; imputation execution time lasted 38 hours, 40 minutes, and 19 seconds. All imputation procedures were conducted by Robbee Wedow, University of Colorado Boulder.

16 Add Health 1KG phase 3 Imputation Protocol Summary: As described above, 1000 Genomes imputation is more appropriate for non-european samples. Thus, Add Health investigators used the Global Lipids Genetics/GIANT Consortium Imputation and Analysis Plan, version 2 (updated March 17 th, 2017) to guide imputation to the 1000 Genomes reference panel. Imputation was performed on the University of Michigan imputation server ( All n=9,974 Add Health participants were imputed using this analysis plan. There were two major components to this analysis plan: 1) Genome-wide genotypes must be on the correct build (37/hg19) and correct strand (forward). 2) Imputation of genotypes is performed using the 1KG phase 3 Standard pre-imputation QC criteria were applied: Sample call rate (cut off >95% threshold recommended) Exclude samples with heterozygosity > median + 3*IQR Remove gender mismatches Remove duplicates Remove PCA outliers using a PCA projection of the study samples onto 1KG reference samples. Hardy-Weinberg p>10-6, SNP call rate 98% Remove monomorphic markers Prepare files for imputation The HRC/1KG Imputation Preparation and Checking Tool developed by Will Rayner was used to check input data for accuracy relative to expected HRC or 1000G inputs prior to imputation. This process was used to identify errors in input data, including incorrect REF/ALT designations, incorrect strand designations, extreme deviations from expected allele frequencies, and palindromic (A/T and G/C) SNPs with allele frequency near 0.5 that are often the source of imputation errors, and generates commands to make files that have fixed or removed these problematic variants. The tool can be downloaded here: Impute to 1KG phase 3 panel The 1KG phase 3 samples has both European and non-european samples and includes SNPs, indels, and CNVs. The following options at the Michigan Imputation Server were used: Reference Panel: 1000G Phase3 v5 Phasing: Eagle v2.3 Population: as appropriate for the study (used only for quality control purposes) Mode: Quality Control & Imputation Note: Chromosome X will need to be imputed separate from other chromosomes after reformatting plink code 23 to X in the VCF file. Currently, SHAPEIT is the only available method for phasing chrx.

17 Imputation was completed and imputed.vcf files downloaded in November All imputation procedures were conducted by Robbee Wedow, University of Colorado Boulder. Send questions to See the Add Health website for additional information about the study.

18 References 1. McCarthy, S. et al. A reference panel of 64,976 haplotypes for genotype imputation. Nat. Genet. 48, (2016). 2. Auton, A. et al. A global reference for human genetic variation. Nature 526, (2015). 3. Das, S. et al. Next-generation genotype imputation service and methods. Nat. Genet. 48, (2016).

During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin,

During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin, ESM Methods Hyperinsulinemic-euglycemic clamp procedure During the hyperinsulinemic-euglycemic clamp [1], a priming dose of human insulin (Novolin, Clayton, NC) was followed by a constant rate (60 mu m

More information

Tutorial on Genome-Wide Association Studies

Tutorial on Genome-Wide Association Studies Tutorial on Genome-Wide Association Studies Assistant Professor Institute for Computational Biology Department of Epidemiology and Biostatistics Case Western Reserve University Acknowledgements Dana Crawford

More information

New Enhancements: GWAS Workflows with SVS

New Enhancements: GWAS Workflows with SVS New Enhancements: GWAS Workflows with SVS August 9 th, 2017 Gabe Rudy VP Product & Engineering 20 most promising Biotech Technology Providers Top 10 Analytics Solution Providers Hype Cycle for Life sciences

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Fig 1. Comparison of sub-samples on the first two principal components of genetic variation. TheBritishsampleisplottedwithredpoints.The sub-samples of the diverse sample

More information

Supplementary Figure 1. Principal components analysis of European ancestry in the African American, Native Hawaiian and Latino populations.

Supplementary Figure 1. Principal components analysis of European ancestry in the African American, Native Hawaiian and Latino populations. Supplementary Figure. Principal components analysis of European ancestry in the African American, Native Hawaiian and Latino populations. a Eigenvector 2.5..5.5. African Americans European Americans e

More information

Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene. McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S.

Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene. McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S. Genome-wide Association Analysis Applied to Asthma-Susceptibility Gene McCaw, Z., Wu, W., Hsiao, S., McKhann, A., Tracy, S. December 17, 2014 1 Introduction Asthma is a chronic respiratory disease affecting

More information

CS2220 Introduction to Computational Biology

CS2220 Introduction to Computational Biology CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS

More information

2) Cases and controls were genotyped on different platforms. The comparability of the platforms should be discussed.

2) Cases and controls were genotyped on different platforms. The comparability of the platforms should be discussed. Reviewers' Comments: Reviewer #1 (Remarks to the Author) The manuscript titled 'Association of variations in HLA-class II and other loci with susceptibility to lung adenocarcinoma with EGFR mutation' evaluated

More information

1) Postmenopausal invasive breast cancer case-control study nested within the NHS

1) Postmenopausal invasive breast cancer case-control study nested within the NHS Supplementary Methods NHS & HPFS set: 1) Postmenopausal invasive breast cancer case-control study nested within the NHS (CGEMS): Eligible cases in this study consisted of women with pathologically confirmed

More information

Genome-wide association studies (case/control and family-based) Heather J. Cordell, Institute of Genetic Medicine Newcastle University, UK

Genome-wide association studies (case/control and family-based) Heather J. Cordell, Institute of Genetic Medicine Newcastle University, UK Genome-wide association studies (case/control and family-based) Heather J. Cordell, Institute of Genetic Medicine Newcastle University, UK GWAS For the last 8 years, genome-wide association studies (GWAS)

More information

Genetics and Genomics in Medicine Chapter 8 Questions

Genetics and Genomics in Medicine Chapter 8 Questions Genetics and Genomics in Medicine Chapter 8 Questions Linkage Analysis Question Question 8.1 Affected members of the pedigree above have an autosomal dominant disorder, and cytogenetic analyses using conventional

More information

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data. Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype

More information

Heritability of surface area and cortical thickness: a comparison between the Human Connectome Project and the UK Biobank dataset

Heritability of surface area and cortical thickness: a comparison between the Human Connectome Project and the UK Biobank dataset Heritability of surface area and cortical thickness: a comparison between the Human Connectome Project and the UK Biobank dataset Yann Le Guen, Slim Karkar, Antoine Grigis, Cathy Philippe, Jean-François

More information

Human population sub-structure and genetic association studies

Human population sub-structure and genetic association studies Human population sub-structure and genetic association studies Stephanie A. Santorico, Ph.D. Department of Mathematical & Statistical Sciences Stephanie.Santorico@ucdenver.edu Global Similarity Map from

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

Golden Helix s End-to-End Solution for Clinical Labs

Golden Helix s End-to-End Solution for Clinical Labs Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics

More information

GENOME-WIDE ASSOCIATION STUDIES

GENOME-WIDE ASSOCIATION STUDIES GENOME-WIDE ASSOCIATION STUDIES SUCCESSES AND PITFALLS IBT 2012 Human Genetics & Molecular Medicine Zané Lombard IDENTIFYING DISEASE GENES??? Nature, 15 Feb 2001 Science, 16 Feb 2001 IDENTIFYING DISEASE

More information

1) Postmenopausal invasive breast cancer case-control study nested within the NHS

1) Postmenopausal invasive breast cancer case-control study nested within the NHS Supplementary Methods Melanoma Discovery set in Harvard: 1) Postmenopausal invasive breast cancer case-control study nested within the NHS (CGEMS): Eligible cases in this study consisted of women with

More information

Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels.

Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels. Supplementary Online Material Genome-wide association study identifies variants in TMPRSS6 associated with hemoglobin levels. John C Chambers, Weihua Zhang, Yun Li, Joban Sehmi, Mark N Wass, Delilah Zabaneh,

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

Division of Public Health Sciences, Department of Biostatistics, Wake Forest University Health Sciences, Winston-Salem, NC, USA; 2

Division of Public Health Sciences, Department of Biostatistics, Wake Forest University Health Sciences, Winston-Salem, NC, USA; 2 (2009) 10, S5 S15 & 2009 Macmillan Publishers Limited All rights reserved 1466-4879/09 $32.00 www.nature.com/gene ORIGINAL ARTICLE WM Brown 1, JJ Pierce 1, JE Hilner 2, LH Perdue 1, K Lohman 1,LLu 1, PIW

More information

Large-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017

Large-scale identity-by-descent mapping discovers rare haplotypes of large effect. Suyash Shringarpure 23andMe, Inc. ASHG 2017 Large-scale identity-by-descent mapping discovers rare haplotypes of large effect Suyash Shringarpure 23andMe, Inc. ASHG 2017 1 Why care about rare variants of large effect? Months from randomization 2

More information

Predicting Country of Origin from Genetic Data G. David Poznik

Predicting Country of Origin from Genetic Data G. David Poznik Predicting Country of Origin from Genetic Data G. David Poznik Introduction Genetic variation in Europe is spatially structured; similarity decays with geographic distance. The most striking visual manifestation

More information

SUPPLEMENTARY DATA. 1. Characteristics of individual studies

SUPPLEMENTARY DATA. 1. Characteristics of individual studies 1. Characteristics of individual studies 1.1. RISC (Relationship between Insulin Sensitivity and Cardiovascular disease) The RISC study is based on unrelated individuals of European descent, aged 30 60

More information

Title: Pinpointing resilience in Bipolar Disorder

Title: Pinpointing resilience in Bipolar Disorder Title: Pinpointing resilience in Bipolar Disorder 1. AIM OF THE RESEARCH AND BRIEF BACKGROUND Bipolar disorder (BD) is a mood disorder characterised by episodes of depression and mania. It ranks as one

More information

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency

Nature Neuroscience: doi: /nn Supplementary Figure 1. Missense damaging predictions as a function of allele frequency Supplementary Figure 1 Missense damaging predictions as a function of allele frequency Percentage of missense variants classified as damaging by eight different classifiers and a classifier consisting

More information

Introduction to the Genetics of Complex Disease

Introduction to the Genetics of Complex Disease Introduction to the Genetics of Complex Disease Jeremiah M. Scharf, MD, PhD Departments of Neurology, Psychiatry and Center for Human Genetic Research Massachusetts General Hospital Breakthroughs in Genome

More information

Pirna Sequence Variants Associated With Prostate Cancer In African Americans And Caucasians

Pirna Sequence Variants Associated With Prostate Cancer In African Americans And Caucasians Yale University EliScholar A Digital Platform for Scholarly Publishing at Yale Public Health Theses School of Public Health January 2015 Pirna Sequence Variants Associated With Prostate Cancer In African

More information

Dan Koller, Ph.D. Medical and Molecular Genetics

Dan Koller, Ph.D. Medical and Molecular Genetics Design of Genetic Studies Dan Koller, Ph.D. Research Assistant Professor Medical and Molecular Genetics Genetics and Medicine Over the past decade, advances from genetics have permeated medicine Identification

More information

New methods for discovering common and rare genetic variants in human disease

New methods for discovering common and rare genetic variants in human disease Washington University in St. Louis Washington University Open Scholarship All Theses and Dissertations (ETDs) 1-1-2011 New methods for discovering common and rare genetic variants in human disease Peng

More information

Identifying Mutations Responsible for Rare Disorders Using New Technologies

Identifying Mutations Responsible for Rare Disorders Using New Technologies Identifying Mutations Responsible for Rare Disorders Using New Technologies Jacek Majewski, Department of Human Genetics, McGill University, Montreal, QC Canada Mendelian Diseases Clear mode of inheritance

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

Problem 3: Simulated Rheumatoid Arthritis Data

Problem 3: Simulated Rheumatoid Arthritis Data Problem 3: Simulated Rheumatoid Arthritis Data Michael B Miller Michael Li Gregg Lind Soon-Young Jang The plan

More information

Assessing Accuracy of Genotype Imputation in American Indians

Assessing Accuracy of Genotype Imputation in American Indians Assessing Accuracy of Genotype Imputation in American Indians Alka Malhotra*, Sayuko Kobes, Clifton Bogardus, William C. Knowler, Leslie J. Baier, Robert L. Hanson Phoenix Epidemiology and Clinical Research

More information

White Paper Estimating Complex Phenotype Prevalence Using Predictive Models

White Paper Estimating Complex Phenotype Prevalence Using Predictive Models White Paper 23-12 Estimating Complex Phenotype Prevalence Using Predictive Models Authors: Nicholas A. Furlotte Aaron Kleinman Robin Smith David Hinds Created: September 25 th, 2015 September 25th, 2015

More information

Extended Abstract prepared for the Integrating Genetics in the Social Sciences Meeting 2014

Extended Abstract prepared for the Integrating Genetics in the Social Sciences Meeting 2014 Understanding the role of social and economic factors in GCTA heritability estimates David H Rehkopf, Stanford University School of Medicine, Division of General Medical Disciplines 1265 Welch Road, MSOB

More information

Nature Genetics: doi: /ng Supplementary Figure 1

Nature Genetics: doi: /ng Supplementary Figure 1 Supplementary Figure 1 Illustrative example of ptdt using height The expected value of a child s polygenic risk score (PRS) for a trait is the average of maternal and paternal PRS values. For example,

More information

Shared additive genetic variation for alcohol dependence among subjects of African and European ancestry

Shared additive genetic variation for alcohol dependence among subjects of African and European ancestry bs_bs_banner ORIGINAL ARTICLE doi:10.1111/adb.12578 Shared additive genetic variation for alcohol dependence among subjects of African and European ancestry Leslie A. Brick 1,2, Matthew C. Keller 3, Valerie

More information

Supplementary Material S1. 1. Genotyping for Genome-wide Association and Quality Control

Supplementary Material S1. 1. Genotyping for Genome-wide Association and Quality Control Shah H, Gao H, Morieri ML, et al. Genetic predictors of cardiovascular mortality during intensive glycemic control in type 2 diabetes. Supplementary Material S1. 1. Genotyping for Genome-wide Association

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

An Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018

An Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018 An Introduction to Quantitative Genetics I Heather A Lawson Advanced Genetics Spring2018 Outline What is Quantitative Genetics? Genotypic Values and Genetic Effects Heritability Linkage Disequilibrium

More information

Detecting Identity by Descent and Homozygosity Mapping in Whole-Exome Sequencing Data

Detecting Identity by Descent and Homozygosity Mapping in Whole-Exome Sequencing Data Detecting Identity by Descent and Homozygosity Mapping in Whole-Exome Sequencing Data Zhong Zhuang 1 *., Alexander Gusev 1., Judy Cho 3, Itsik e er 1,2 1 Department of Computer Science, Columbia University,

More information

Supplementary Methods, Tables and Figures

Supplementary Methods, Tables and Figures Supplementary Methods, Tables and Figures 1.1 Autism Genetic Resource Exchange (AGRE) The Autism Genetic Resource Exchange (AGRE; http://www.agre.org) has a collection of DNA samples and clinical information

More information

Analysis with SureCall 2.1

Analysis with SureCall 2.1 Analysis with SureCall 2.1 Danielle Fletcher Field Application Scientist July 2014 1 Stages of NGS Analysis Primary analysis, base calling Control Software FASTQ file reads + quality 2 Stages of NGS Analysis

More information

Mendelian & Complex Traits. Quantitative Imaging Genomics. Genetics Terminology 2. Genetics Terminology 1. Human Genome. Genetics Terminology 3

Mendelian & Complex Traits. Quantitative Imaging Genomics. Genetics Terminology 2. Genetics Terminology 1. Human Genome. Genetics Terminology 3 Mendelian & Complex Traits Quantitative Imaging Genomics David C. Glahn, PhD Olin Neuropsychiatry Research Center & Department of Psychiatry, Yale University July, 010 Mendelian Trait A trait influenced

More information

Transferability of Type 2 Diabetes Implicated Loci in Multi-Ethnic Cohorts from Southeast Asia

Transferability of Type 2 Diabetes Implicated Loci in Multi-Ethnic Cohorts from Southeast Asia Transferability of Type 2 Diabetes Implicated Loci in Multi-Ethnic Cohorts from Southeast Asia Xueling Sim 1, Rick Twee-Hee Ong 1,2,3, Chen Suo 1, Wan-Ting Tay 4, Jianjun Liu 3, Daniel Peng-Keat Ng 5,

More information

A total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in

A total of 2,822 Mexican dyslipidemic cases and controls were recruited at INCMNSZ in Supplemental Material The N342S MYLIP polymorphism is associated with high total cholesterol and increased LDL-receptor degradation in humans by Daphna Weissglas-Volkov et al. Supplementary Methods Mexican

More information

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK

DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence

More information

Rare Variant Burden Tests. Biostatistics 666

Rare Variant Burden Tests. Biostatistics 666 Rare Variant Burden Tests Biostatistics 666 Last Lecture Analysis of Short Read Sequence Data Low pass sequencing approaches Modeling haplotype sharing between individuals allows accurate variant calls

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Table of Contents Supplementary Materials and Methods... 1 1 Patients and control subjects for SNP genotyping... 2 1.1 Neuroblastoma patients in discovery case series... 2 1.2 Control subjects... 3 2 Whole-genome

More information

Discovery of the first genome-wide significant. risk loci for ADHD

Discovery of the first genome-wide significant. risk loci for ADHD Supplementary Information Discovery of the first genome-wide significant risk loci for ADHD Table of Contents Supplementary Methods and Results... 4 Detailed description of individual Samples... 4 ipsych,

More information

Alzheimer s Disease Genetics Consortium ADGC. Alzheimer s Disease Sequencing Project ADSP

Alzheimer s Disease Genetics Consortium ADGC. Alzheimer s Disease Sequencing Project ADSP Alzheimer s Disease Genetics Consortium ADGC Alzheimer s Disease Sequencing Project ADSP National Institute on Aging Genetics of Alzheimer s Disease Storage site NIAGADS Partners: National Alzheimer Coordinating

More information

Summary. Introduction. Atypical and Duplicated Samples. Atypical Samples. Noah A. Rosenberg

Summary. Introduction. Atypical and Duplicated Samples. Atypical Samples. Noah A. Rosenberg doi: 10.1111/j.1469-1809.2006.00285.x Standardized Subsets of the HGDP-CEPH Human Genome Diversity Cell Line Panel, Accounting for Atypical and Duplicated Samples and Pairs of Close Relatives Noah A. Rosenberg

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

Request for Applications Post-Traumatic Stress Disorder GWAS

Request for Applications Post-Traumatic Stress Disorder GWAS Request for Applications Post-Traumatic Stress Disorder GWAS PROGRAM OVERVIEW Cohen Veterans Bioscience & The Stanley Center for Psychiatric Research at the Broad Institute Collaboration are supporting

More information

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction

Abstract. Optimization strategy of Copy Number Variant calling using Multiplicom solutions APPLICATION NOTE. Introduction Optimization strategy of Copy Number Variant calling using Multiplicom solutions Michael Vyverman, PhD; Laura Standaert, PhD and Wouter Bossuyt, PhD Abstract Copy number variations (CNVs) represent a significant

More information

Introduction to Genetics and Genomics

Introduction to Genetics and Genomics 2016 Introduction to enetics and enomics 3. ssociation Studies ggibson.gt@gmail.com http://www.cig.gatech.edu Outline eneral overview of association studies Sample results hree steps to WS: primary scan,

More information

Genomic structural variation

Genomic structural variation Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural

More information

Identification of regions with common copy-number variations using SNP array

Identification of regions with common copy-number variations using SNP array Identification of regions with common copy-number variations using SNP array Agus Salim Epidemiology and Public Health National University of Singapore Copy Number Variation (CNV) Copy number alteration

More information

LTA Analysis of HapMap Genotype Data

LTA Analysis of HapMap Genotype Data LTA Analysis of HapMap Genotype Data Introduction. This supplement to Global variation in copy number in the human genome, by Redon et al., describes the details of the LTA analysis used to screen HapMap

More information

On Missing Data and Genotyping Errors in Association Studies

On Missing Data and Genotyping Errors in Association Studies On Missing Data and Genotyping Errors in Association Studies Department of Biostatistics Johns Hopkins Bloomberg School of Public Health May 16, 2008 Specific Aims of our R01 1 Develop and evaluate new

More information

Reviewers' comments: Reviewer #1 (Remarks to the Author):

Reviewers' comments: Reviewer #1 (Remarks to the Author): Reviewers' comments: Reviewer #1 (Remarks to the Author): Major claims of the paper A well-designed and well-executed large-scale GWAS is presented for male patternbaldness, identifying 71 associated loci,

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Populations ascertainment and characterization Our genotyping strategy included 3 stages of SNP selection, with individuals from 3 populations (Europeans, Indian Asians and Mexicans).

More information

Genetic analysis of social-class mobility in five longitudinal studies

Genetic analysis of social-class mobility in five longitudinal studies Genetic analysis of social-class mobility in five longitudinal studies Daniel W. Belsky a,b,1,2, Benjamin W. Domingue c,1, Robbee Wedow d, Louise Arseneault e, Jason D. Boardman d, Avshalom Caspi e,f,g,h,

More information

Genomics 101 (2013) Contents lists available at SciVerse ScienceDirect. Genomics. journal homepage:

Genomics 101 (2013) Contents lists available at SciVerse ScienceDirect. Genomics. journal homepage: Genomics 101 (2013) 134 138 Contents lists available at SciVerse ScienceDirect Genomics journal homepage: www.elsevier.com/locate/ygeno Gene-based copy number variation study reveals a microdeletion at

More information

Combined Linkage and Association in Mx. Hermine Maes Kate Morley Dorret Boomsma Nick Martin Meike Bartels

Combined Linkage and Association in Mx. Hermine Maes Kate Morley Dorret Boomsma Nick Martin Meike Bartels Combined Linkage and Association in Mx Hermine Maes Kate Morley Dorret Boomsma Nick Martin Meike Bartels Boulder 2009 Outline Intro to Genetic Epidemiology Progression to Linkage via Path Models Linkage

More information

Nature Methods: doi: /nmeth.3115

Nature Methods: doi: /nmeth.3115 Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by

More information

Statistical Genetics : Gene Mappin g through Linkag e and Associatio n

Statistical Genetics : Gene Mappin g through Linkag e and Associatio n Statistical Genetics : Gene Mappin g through Linkag e and Associatio n Benjamin M Neale Manuel AR Ferreira Sarah E Medlan d Danielle Posthuma About the editors List of contributors Preface Acknowledgements

More information

Statistical Tests for X Chromosome Association Study. with Simulations. Jian Wang July 10, 2012

Statistical Tests for X Chromosome Association Study. with Simulations. Jian Wang July 10, 2012 Statistical Tests for X Chromosome Association Study with Simulations Jian Wang July 10, 2012 Statistical Tests Zheng G, et al. 2007. Testing association for markers on the X chromosome. Genetic Epidemiology

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary materials: Table of Contents (Shi et al., Common variants on chromosomes 6p22.1 are associated with schizophrenia) A. Full Methods S2 1. Recruitment and assessment of subjects S2 2. Selection

More information

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits?

5/2/18. After this class students should be able to: Stephanie Moon, Ph.D. - GWAS. How do we distinguish Mendelian from non-mendelian traits? corebio II - genetics: WED 25 April 2018. 2018 Stephanie Moon, Ph.D. - GWAS After this class students should be able to: 1. Compare and contrast methods used to discover the genetic basis of traits or

More information

Whole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis

Whole-genome detection of disease-associated deletions or excess homozygosity in a case control study of rheumatoid arthritis HMG Advance Access published December 21, 2012 Human Molecular Genetics, 2012 1 13 doi:10.1093/hmg/dds512 Whole-genome detection of disease-associated deletions or excess homozygosity in a case control

More information

Quantitative genetics: traits controlled by alleles at many loci

Quantitative genetics: traits controlled by alleles at many loci Quantitative genetics: traits controlled by alleles at many loci Human phenotypic adaptations and diseases commonly involve the effects of many genes, each will small effect Quantitative genetics allows

More information

MULTIFACTORIAL DISEASES. MG L-10 July 7 th 2014

MULTIFACTORIAL DISEASES. MG L-10 July 7 th 2014 MULTIFACTORIAL DISEASES MG L-10 July 7 th 2014 Genetic Diseases Unifactorial Chromosomal Multifactorial AD Numerical AR Structural X-linked Microdeletions Mitochondrial Spectrum of Alterations in DNA Sequence

More information

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016

Introduction to genetic variation. He Zhang Bioinformatics Core Facility 6/22/2016 Introduction to genetic variation He Zhang Bioinformatics Core Facility 6/22/2016 Outline Basic concepts of genetic variation Genetic variation in human populations Variation and genetic disorders Databases

More information

Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles

Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles Supplementary Figure 1 Dosage correlation between imputed and genotyped alleles Imputed dosages (0 to 2) of 2-digit alleles (red) and 4-digit alleles (green) of (A) HLA-A, HLA-B, (C) HLA-C, (D) HLA-DQA1,

More information

A rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France

A rare variant in MYH6 confers high risk of sick sinus syndrome. Hilma Hólm ESC Congress 2011 Paris, France A rare variant in MYH6 confers high risk of sick sinus syndrome Hilma Hólm ESC Congress 2011 Paris, France Disclosures I am an employee of decode genetics, Reykjavik, Iceland. Sick sinus syndrome SSS is

More information

Genome-wide approaches to identifying the etiologies of complex diseases: applications in colorectal cancer and congenital heart disease

Genome-wide approaches to identifying the etiologies of complex diseases: applications in colorectal cancer and congenital heart disease Genome-wide approaches to identifying the etiologies of complex diseases: applications in colorectal cancer and congenital heart disease by Stephanie Loie Stenzel A dissertation submitted in partial fulfillment

More information

Research Article Power Estimation for Gene-Longevity Association Analysis Using Concordant Twins

Research Article Power Estimation for Gene-Longevity Association Analysis Using Concordant Twins Genetics Research International, Article ID 154204, 8 pages http://dx.doi.org/10.1155/2014/154204 Research Article Power Estimation for Gene-Longevity Association Analysis Using Concordant Twins Qihua

More information

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University

Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University Role of Chemical lexposure in Generating Spontaneous Copy Number Variants (CNVs) Jennifer Freeman Assistant Professor of Toxicology School of Health Sciences Purdue University CNV Discovery Reference Genetic

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;&

!##$%#&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo +,-./&01,23&34,53& :&;.<&2-.=;:3&;.;2>6-6&-.&;& !!! "#$%&'($)*!+&,-$!.)/+$!+$!01,-$1'$!!"##"$%#"&!'&$'()$(%&'*& Terapia Pediatrica e Farmacologia dello Sviluppo 0$2-3!44566!! +,-./&01,23&34,53&63783.9-.:&;.6-6&-.&;& 582/-:3.3?;/-,.;2&@;5-2>&63:?3:;/-.:&#>A3&B&!-;C3/36&!.&))3'&!(2$&#)$7$23!+$(2$8-$#1'&!+$!177&'&#91!!

More information

The Inheritance of Complex Traits

The Inheritance of Complex Traits The Inheritance of Complex Traits Differences Among Siblings Is due to both Genetic and Environmental Factors VIDEO: Designer Babies Traits Controlled by Two or More Genes Many phenotypes are influenced

More information

NIH Public Access Author Manuscript Nat Genet. Author manuscript; available in PMC 2012 September 01.

NIH Public Access Author Manuscript Nat Genet. Author manuscript; available in PMC 2012 September 01. NIH Public Access Author Manuscript Published in final edited form as: Nat Genet. ; 44(3): 247 250. doi:10.1038/ng.1108. Estimating the proportion of variation in susceptibility to schizophrenia captured

More information

TITLE: A Genome-wide Breast Cancer Scan in African Americans. CONTRACTING ORGANIZATION: University of Southern California, Los Angeles, CA 90033

TITLE: A Genome-wide Breast Cancer Scan in African Americans. CONTRACTING ORGANIZATION: University of Southern California, Los Angeles, CA 90033 Award Number: W81XWH-08-1-0383 TITLE: A Genome-wide Breast Cancer Scan in African Americans PRINCIPAL INVESTIGATOR: Christopher A. Haiman CONTRACTING ORGANIZATION: University of Southern California, Los

More information

Introduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder

Introduction to linkage and family based designs to study the genetic epidemiology of complex traits. Harold Snieder Introduction to linkage and family based designs to study the genetic epidemiology of complex traits Harold Snieder Overview of presentation Designs: population vs. family based Mendelian vs. complex diseases/traits

More information

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative

Association mapping (qualitative) Association scan, quantitative. Office hours Wednesday 3-4pm 304A Stanley Hall. Association scan, qualitative Association mapping (qualitative) Office hours Wednesday 3-4pm 304A Stanley Hall Fig. 11.26 Association scan, qualitative Association scan, quantitative osteoarthritis controls χ 2 test C s G s 141 47

More information

Investigating rare diseases with Agilent NGS solutions

Investigating rare diseases with Agilent NGS solutions Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe

More information

American Psychiatric Nurses Association

American Psychiatric Nurses Association Francis J. McMahon International Society of Psychiatric Genetics Johns Hopkins University School of Medicine Dept. of Psychiatry Human Genetics Branch, National Institute of Mental Health* * views expressed

More information

Interaction of Genes and the Environment

Interaction of Genes and the Environment Some Traits Are Controlled by Two or More Genes! Phenotypes can be discontinuous or continuous Interaction of Genes and the Environment Chapter 5! Discontinuous variation Phenotypes that fall into two

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Lotta LA, Stewart ID, Sharp SJ, et al. Association of genetically enhanced lipoprotein lipase mediated lipolysis and low-density lipoprotein cholesterol lowering alleles with

More information

Shared genetic influences between dimensional ASD and ADHD symptoms during child and adolescent development

Shared genetic influences between dimensional ASD and ADHD symptoms during child and adolescent development Stergiakouli et al. Molecular Autism (2017) 8:18 DOI 10.1186/s13229-017-0131-2 RESEARCH Shared genetic influences between dimensional ASD and ADHD symptoms during child and adolescent development Evie

More information

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection

Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin

More information

Supplemental Methods: GWA for MDD. MDD-etiology-supplement.doc 5/21/ :33 PM. Table of Contents

Supplemental Methods: GWA for MDD. MDD-etiology-supplement.doc 5/21/ :33 PM. Table of Contents Supplemental Methods: GWA for MDD Authors Document: Date: Sullivan, et al. MDD-etiology-supplement.doc 5/21/2010 12:33 PM Table of Contents Genomewide Linkage Studies of MDD or Neuroticism...2 Supplemental

More information

CHROMOSOMAL MICROARRAY (CGH+SNP)

CHROMOSOMAL MICROARRAY (CGH+SNP) Chromosome imbalances are a significant cause of developmental delay, mental retardation, autism spectrum disorders, dysmorphic features and/or birth defects. The imbalance of genetic material may be due

More information

ASSOCIATION OF KCNJ1 VARIATION WITH CHANGE IN FASTING GLUCOSE AND NEW ONSET DIABETES DURING HCTZ TREATMENT

ASSOCIATION OF KCNJ1 VARIATION WITH CHANGE IN FASTING GLUCOSE AND NEW ONSET DIABETES DURING HCTZ TREATMENT ONLINE SUPPLEMENT ASSOCIATION OF KCNJ1 VARIATION WITH CHANGE IN FASTING GLUCOSE AND NEW ONSET DIABETES DURING HCTZ TREATMENT Jason H Karnes, PharmD 1, Caitrin W McDonough, PhD 1, Yan Gong, PhD 1, Teresa

More information

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing

Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing GA N 668353 H2020 Research and Innovation Deliverable 2.1 List of relevant genetic variants for pre-emptive PGx testing WP N and Title: WP2 - Towards shared European Guidelines for PGx Lead beneficiary:

More information

THE GOOD, THE BAD, & THE UGLY: WHAT WE KNOW TODAY ABOUT LCA WITH DISTAL OUTCOMES. Bethany C. Bray, Ph.D.

THE GOOD, THE BAD, & THE UGLY: WHAT WE KNOW TODAY ABOUT LCA WITH DISTAL OUTCOMES. Bethany C. Bray, Ph.D. THE GOOD, THE BAD, & THE UGLY: WHAT WE KNOW TODAY ABOUT LCA WITH DISTAL OUTCOMES Bethany C. Bray, Ph.D. bcbray@psu.edu WHAT ARE WE HERE TO TALK ABOUT TODAY? Behavioral scientists increasingly are using

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Multidimensional scaling (MDS) analysis of TEENAGE, HELIC- MANOLIS villages and HELIC-Pomak villages carried out with a subset of Kentavros individuals. The

More information

# For the GWAS stage, B-cell NHL cases which small numbers (N<20) were excluded from analysis.

# For the GWAS stage, B-cell NHL cases which small numbers (N<20) were excluded from analysis. Supplementary Table 1a. Subtype Breakdown of all analyzed samples Stage GWAS Singapore Validation 1 Guangzhou Validation 2 Guangzhou Validation 3 Beijing Total No. of B-Cell Cases 253 # 168^ 294^ 713^

More information