static encephalopathy of childhood with neurodegeneration in adulthood

Transcription

1 De novo mutations in the autophagy gene encoding WDR45 cause static encephalopathy of childhood with neurodegeneration in adulthood Hirotomo Saitsu, Taki Nishimura, Kazuhiro Muramatsu, Hirofumi Kodera, Satoko Kumada, Kenji Sugai, Emi Kasai-Yoshida, Noriko Sawaura, Hiroya Nishida, Ai Hoshino, Fukiko Ryujin, Seiichiro Yoshioka, Kiyomi Nishiyama, Yukiko Kondo, Yoshinori Tsurusaki, Mitsuko Nakashima, Noriko Miyake, Hirokazu Arakawa, Mitsuhiro Kato, Noboru Mizushima & Naomichi Matsumoto Supplementary Note Clinical information of subjects Subject 1 A 33-year old woman, who began to walk at 3 years but never acquired speech, developed epileptic seizures at 4 years, which were controlled by carbamazepine. Her neurological status was stable until adolescence, and at 25 years of age, she understood simple words, ate by herself with a spoon, and walked unsupported. Aggressive behaviors such as biting, shouting and stereotyped hand wringing were seen. She was hypotonic, and neither pyramidal nor extrapyramidal signs were evident. However, akinesia and rigidity progressed from the age of 26. She showed cognitive decline and became increasingly withdrawn. Foot dystonia and swallowing disturbance developed from 28 years of age. Mental and motor deterioration progressed and she became bedridden from the age of 30. At 32 years of age, she showed generalized rigidity with

2 flexion contractures and was mute with no purposeful movements. She required tube feeding. Her initial brain magnetic resonance images (MRI) study at 25 years of age showed hypointensity in the globus pallidus (GP) and substantia nigra (SN) on T2-weighted images suggesting iron accumulation, hyperintensity of the SN with a central band of T1 hypointensity on T1-weighted images, and moderate cerebral and mild cerebellar atrophy. There was no T2 hypointensity in the GP with a central anteromedial region of T2 hyperintensity, called the eye-of-the-tiger sign, which was considered characteristic of pantothenate kinase-associated neurodegeneration (PKAN). These MRI findings were characteristic of SENDA. Follow-up MRI studies at age 32 at 1.5-Tesla and 33 at 3.0-Tesla, also showed hypointensity in the GP and SN on T2-weighted images, hyperintensity of the SN with a central band of T1 hypointensity on T1-weighted images, and marked progression in cerebral atrophy with relatively mild cerebellar atrophy (Fig. 2a,f,i at age of 33 years). She was diagnosed with SENDA with clinical and brain MRI findings at 32 years. Ophthalmologic examinations revealed thinning of the retinal nerve fiber layer. Pigmentary retinopathy was not evident. Lactate in the CSF and her urinary organic acid profile were normal. Tau protein in the CSF was elevated. Nerve conduction studies revealed no abnormalities. Mutations in PANK2, PLA2G6, and MAPT were negative. Chromosomal analysis showed a normal karyotype. A video report of this subject will be published very soon 1. Subject 2 A 28-year old woman, who began to walk at 2 years 7 months with wide-based gait, acquired only one word, Hai ( yes in Japanese), in speech. She developed febrile seizures at the age of 6 months with EEG abnormality. She showed some stereotype

3 movements during early childhood such as hand flapping. At 17 years of age, complex partial seizures developed, which were controlled by antiepileptic drugs. Her neurological status developed very slowly until adolescence. She understood simple words, ate by herself with a spoon, and walked unsupported. Aggressive behaviors, such as shouting during the night, were occasionally seen. Neither pyramidal nor extrapyramidal signs were evident. However, freezing gait, akinesia and rigidity progressed from the age of 25 years. Dystonia and swallowing disturbance developed, and mental and motor deterioration progressed. She became wheelchair-dependent from the age of 27. At 28 years of age, she showed generalized rigidity with flexion contractures and no purposeful movements. Her initial MRI study at 25 years of age showed hypointensity in the GP and SN on T2-weighted images suggesting iron accumulation, hyperintensity of the SN with a central band of T1 hypointensity on T1-weighted images, and moderate cerebral and mild cerebellar atrophy (Fig. 2b,g,j). The eye-of-the-tiger sign was not evident. These MRI findings were characteristic of SENDA. Follow-up MRI study at age 27 showed no significant change. She was diagnosed with SENDA with clinical and brain MRI findings at that time. Ophthalmologic examinations revealed bilateral atrophy of the retinal nerve. Pigmentary retinopathy was not evident. At 2 years of age muscle biopsy was performed, revealing no pathological finding. Mutations in PANK2 and PLA2G6 were negative. Subject 3 A 40-year old woman, who began to walk at age of 2 years and 2 months, but never acquired speech, had several febrile seizures during early childhood, but no epilepsy.

4 Her delayed psychomotor status was static until the third decade of life, but frequent falling, progressive gait disturbance, bradykinesia and cognitive decline gradually developed at around 30 years of age. She could not walk unsupported at 32 and became bedridden a year later. Psychiatric symptoms were not seen. At 33 years of age she was mute and showed no purposeful movements. All activities of daily life needed full support, but she could eat and responded with a laugh to some words. She was complicated with constipation as an autonomic symptom. Dystonia, swallowing disturbance and mental deterioration progressed, and she had no response to any commands and no voluntary movements. She required tube feeding at 38 and a tracheostomy at 39. Her initial MRI study at 33 years of age showed hypointensity in the GP and SN on T2-weighted images suggesting iron accumulation, hyperintensity of the SN with a central band of hypointensity, and mild cerebral and cerebellar atrophy. The eye-of-the-tiger sign was not evident. These MRI findings were characteristic of SENDA. Follow-up MRI study at age 39 at 3.0-Tesla, also showed hypointensity in the GP and SN on T2-weighted images, hyperintensity of the SN with a central band of T1 hypointensity on T1-weighted images, and marked progression in cerebral atrophy with relatively mild cerebellar atrophy (Fig. 2c,h). She was diagnosed with SENDA with clinical and brain MRI findings at that time. Pigmentary retinopathy was not evident. Her blood amino acid profile was normal. Nerve conduction studies revealed no abnormalities. Auditory brainstem response (ABR) shows no reaction, even at 100 db. Electrophysiological studies, such as somatosensory evoked potential (SEP), revealed marked prolongation of the peak latencies. Mutations in PANK2 were negative. A detailed description of brain imaging findings have been previously reported 2.

5 Subject 4 A 51-year old woman, who began to walk at 18 months with spastic hemiparesis. She could speak few words and her developmental quotient was 33 at the age of 7 years. Her neurological status was stable until 19 years of age, when motor function and dystonia began to regress gradually. Akinesia and rigidity progressed from the age of 24 years, and she was bedridden 1 year later. Psychiatric symptoms were not observed. Extrapyramidal signs were evident. Swallowing disturbance and flaccid paralysis developed at around 30 years. Moreover, she showed cognitive decline and became increasingly withdrawn. Mental and motor deterioration progressed. She is currently mute, requires tube feeding and has no purposeful movements. All activities of daily life need full support. Her initial MRI study at 27 years of age showed hypointensity in the GP and SN on T2-weighted images suggesting iron accumulation, hyperintensity of the SN with a central band of T1 hypointensity on T1-weighted imanges, and mild cerebral and cerebellar atrophy. The eye-of-the-tiger sign was not evident. These MRI findings were characteristic of SENDA. Follow-up study at age 46 also showed hypointensity in the GP and SN on T2-weighted images, hyperintensity of the SN with a central band of T1 hypointensity on T1-weighted images, and marked progression in cerebral atrophy with relatively mild cerebellar atrophy (Fig. 2d). She was diagnosed with SENDA with clinical and brain MRI findings at 50 years. Nerve conduction studies revealed no abnormalities. Chromosomal analysis showed a normal karyotype. Subject 5 A 33-year old woman, who began to walk at 18 months and acquired a few words, had stable neurological status during childhood, and at 20 years of age she could speak

6 several words, walk unsupported and run, though without stability. However, she had trunk sway, freezing of her gait and walking difficulty at the age of 21 years. Psychiatric symptoms, such as anxiety disorder, were observed. Rigidity and tremor progressed from age 23 years. In addition, she showed cognitive decline and lost the ability to speak. Mental and motor deterioration progressed and she became bedridden from the age of 29 years. She is currently mute, requires tube feeding and has no purposeful movements. All activities of daily life need full support, but she can laugh in response to some words. She had a febrile seizure at 9 months and developed epileptic seizures at 2 years of age, which were controlled by antiepileptic drugs. No further seizures have occurred, despite her medication being stopped at the age of 20 years. Her initial MRI study at 33 years of age showed hypointensity in the GP and SN on T2-weighted images suggesting iron accumulation, hyperintensity of the SN with a central band of T1 hypointensity on T1-weighted images, and remarkable cerebral atrophy with relatively mild cerebellar atrophy (Fig. 2e). The eye-of-the-tiger sign was not evident. She was diagnosed with SENDA with clinical and brain MRI findings at that time. Pigmentary retinopathy was not evident. Chromosomal analysis revealed mos 46,XX,t(17;19)(q12;q13.3)[5] / 46,XX[25]. References 1. Kasai-Yoshida, E. et al. First video report of static encephalopathy of childhood with neurodegeneration in adulthood. Mov Disord (in press). 2. Kimura, Y. et al. MRI, MR spectroscopy, and diffusion tensor imaging findings in patient with static encephalopathy of childhood with neurodegeneration in adulthood (SENDA). Brain Dev online publication, doi:

7 /j.braindev (11 August 2012)

8 Supplementary Figure 1. WDR45 mutations and their transcripts in lymphoblastoid cell lines (LCLs) derived from five subjects. (a-e) Sequence of the PCR products amplified with genomic DNA (upper) and cdna derived from LCLs of five subjects. (a, b) The c.439+1g>t mutation in subject 1 and the c.516g>c mutation in subject 2 caused insertions of 24-bp sequences of intron 7 and 22-bp sequences of intron 8, respectively. Heterozygous mutations were observed in the genomic DNA in all subjects (a-e). However, only the mutant alleles were expressed in LCLs of subjects 1, 2, 4 and 5 (a, b, d, e), while, both the wild-type allele and the mutant allele were expressed in subject 3 (c).

9 Supplementary Figure 2. Quantification of the amount of LC3-II and autophagic flux in LCLs derived from the subjects families. Cells were treated with 20 μm chloroquine in the absence (a,b) or presence (c,d) of 250 nm Torin1 for 2 h. Cell lysates were analyzed by SDS-PAGE and immunoblotting using anti-lc3 and anti-hsp90 antibodies. The band intensity was quantified using Multi Gauge software version 3.0 (Fujifilm, Tokyo, Japan). Relative levels of LC3-II were normalized with that of Hsp90. The percentage was calculated as the ratio to the mean of the unaffected individuals under non-treated condition (a-d). (e) The ratio of LC3-II levels in the presence of chloroquine

10 (CQ) to the absence of CQ under Torin1-treated condition based on the data in (c,d). Data presented as mean ± S.E. (* P < 0.05, unpaired t-test).

11 Supplementary Table 1. Summary of the exome sequencing performance Family members Sample Status # of alignment reads a Mean coverage %_bases_above5 %_bases_above10 Filter passed variants b Rare variants c Subject 1 Affected 91,876, Father Unaffected 74,087, Mother Unaffected 69,836, Sister Unaffected 74,846, Subject 2 Affected 97,136, Father Unaffected 94,549, Mother Unaffected 101,363, Brother Unaffected 99,781, a PCR duplicates were removed. b Variants that passed GATK hand filtering, were absent in dbsnp135 data, and were not located in segmental duplications. c Protein-altering and splicing-affecting variants (including synonymous variants located within 2-bp from an exon-intron border), which were absent in 88 control exomes.

12 Supplementary Table 2. Candidate variants corresponding to de novo events or autosomal recessive model Subject Chr Position Gene Ref Alt Reads (% of mutant allele) Mutation Amino acid Inheritance a Sanger confirmation ,966,991 ZNF292 T C 110/241 (46) c.3644t>c p.ile1215thr Paternal Confirmed ,967,608 ZNF292 C G 117/244 (48) c.4261c>g p.leu1421val Maternal Confirmed ,523,839 LRRK1 C T 80/157 (51) c.368c>t p.pro123leu de novo Confirmed 1 X 48,934,088 WDR45 C A 13/26 (50) c.439+1g>t de novo Confirmed 2 X WDR45 C G 38/69 (55) c.516g>c p.val172val de novo Confirmed a We utilized data from unaffected brother and sister to examine whether candidate de novo or recessive mutations were consistent with segregation within each family.

13 Supplementary Table 3. Summary of X-inactivation analysis Subject 1 Subject 2 Subject 3 Subject 4 Subject 5 HUMARA NI Marked skewing (98:2) Random (78: 22) Skewing (85:15) Marked skewing (97:3) FRAXA NI Marked skewing (99.99:0.01) NI NI NI NI, Non-informative as alleles were homozygous

14 Supplementary Table 4. PCR conditions and primer sequences WDR45 mutation analysis Exons Product Size (bp) Forward primer (5 >3 ) Reverse primer (5 >3 ) Ex GAGGAGGAAATCAGGTGAGGCAGAA GAGGCCAGGAATCCGAGAAATCTG Ex AAGTAGGTTGAGGTCCCTGGGAAGC TTCTTTCCTCATCTCTGCCCCTCTG Ex8-12 a 1274 TCCTCATCCAGCTCTGTCCATTCTG GCTCAGCTCTGCAGTTCTGCCACT a Internal sequencing primers: Ex8-12seq-F, TCTGCGCTTCCAGTGATAAG; Ex8-12seq-R, GTGGGGAGGGGGTACTCA. The PCR reaction is comprised of 40 cycles in the following conditions: 98 C for 10 sec, 64 C for 20 sec, and 68 C for 1 min. RNA analysis Amplicons Product Size (bp) Forward primer (5 >3 ) Reverse primer (5 >3 ) Ex GAGAAGCTGGTGCTGGAGTTCACCT ATTGATCGTGAATGGAGCAGACGAG Ex CTCCATTCACGATCAATGCACATCA TTATCACTGGAAGCGCAGAGGAAGG Ex GGTCGCAATACTTCCAAGAACGTCA GCTCAGCTCTGCAGTTCTGCCACT The PCR reaction is comprised of 35 cycles in the following conditions: 98 C for 10 sec, 64 C for 20 sec, and 68 C for 30 sec. X inactivation analysis Assays Product Size (bp) Forward primer (5 >3 ) FAM-labeled Reverse primer (5 >3 ) HUMARA a 291 CCAGAATCTGTTCCAGAGCGTGC CTCTACGATGGGCTTGGGGAGAAC FRAXA b 223 AGCCCCGCACTTCCACCACCAGCTCCTCCA GCTCAGCTCCGTTTCGGTTTCACTTCCGGT a The PCR reaction is comprised of 35 cycles in the following conditions: 94 C for 20 sec, 65 C for 20 sec, and 72 C for 20 sec. b The PCR reaction is comprised of 40 cycles in the following conditions: 94 C for 10 sec, 54 C for 10 sec, and 72 C for 10 sec.