Analysis of loss of chromosome 10q, DMBT1 homozygous deletions, and PTEN mutations in oligodendrogliomas
|
|
- Junior Matthews
- 5 years ago
- Views:
Transcription
1 J Neurosurg 97: , 2002 Analysis of loss of chromosome 10q, DMBT1 homozygous deletions, and PTEN mutations in oligodendrogliomas MARC SANSON, M.D., PH.D., PASCAL LEURAUD, M.SC., LUCINDA AGUIRRE-CRUZ, M.D., JIÉ HE, M.D., YANNICK MARIE, M.SC., STÉPHANIE CARTALAT-CAREL, M.D., KARIMA MOKHTARI, M.D., HUGUES DUFFAU, M.D., JEAN-YVES DELATTRE, M.D., AND KHÊ HOANG-XUAN, M.D. INSERM U495, Laboratoire de Biologie des Interactions Neurones-Glie; Fédération de Neurologie Mazarin; Laboratoire de Neuropathologie R Escourolle; and Service de Neurochirurgie; Groupe Hospitalier Pitié-Salpêtrière and Université Pierre et Marie Curie, Paris, France D Object. Chromosomal deletions of 10q and candidate genes such as PTEN and DMBT1 have been thoroughly investigated in glioblastomas but few data specifically address oligodendrogliomas. Methods. In this study, 39 pure oligodendrogliomas were investigated for loss of heterozygosity (LOH) on 10q, PTEN mutations, and DMBT1 homozygous deletions. The LOH on 10q was found in 19 (48%) of 39 oligodendrogliomas and was closely related to anaplasia (p = 0.02), shorter time to progression (p = ), and poorer survival (p = 0.035). The DMBT1 homozygous deletions were found in 10 (26%) of 39 oligodendrogliomas but only one PTEN mutation was detected. The LOH on 10q is a strong predictor of survival and could be a valuable prognostic marker in oligodendrogliomas. Conclusions. Frequent inactivation of DMBT1 contrasting with rare mutations of PTEN may indicate that DMBT1 is preferentially involved in oligodendrogliomas. Nevertheless, the absence of a correlation with survival makes the role of DMBT1 in tumorigenesis still questionable and warrants further investigation. KEY WORDS oligodendroglioma chromosome 10 tumor suppressor gene loss of heterozygosity prognostic marker EPENDING on their morphological features and their presumed origin, gliomas are divided into astrocytomas, oligodendrogliomas, and mixed gliomas or oligoastrocytomas. Oligodendrogliomas, divided into WHO Grades II and III, represent up to 25 to 33% of gliomas. 4,5 They are of major interest because their prognosis is better and their chemosensitivity is higher than in astrocytomas. 2 Studies of the molecular alterations involved in oligodendroglioma have often focused on particular alterations, mainly loss of chromosomes 1p/19q, 1,11,20,22 and other genetic changes, such as loss of chromosome 10q or inactivation of the tumor suppressor genes PTEN/MMAC (10q23) and DMBT1 (10q25-26), which are common in malignant astrocytomas and could play a role in their tumorigenesis, have not been analyzed. 7,8,12,18,19,25,26 A few recent publications 6,9,14,21 in which it has been suggested that these genetic changes could also occur in oligodendrogliomas prompted us to undertake a systematic analysis of chromosome 10 and of the PTEN/MMAC and DMBT1 genes in a series of oligodendrogliomas. Materials and Methods Histological Classification A set of 39 oligodendrogliomas (eight WHO Grade II and 31 Abbreviations used in this paper: GBM = glioblastoma multiforme; LOH = loss of heterozygosity; PCR = polymerase chain reaction; WHO = World Health Organization. WHO Grade III) that were resected at the Pitié-Salpêtrière Hospital in Paris were selected based on the availability of paired blood and frozen tissue for molecular analysis. These tumors were reviewed, classified morphologically, and scored according to the WHO guidelines (K.M.). 10 Microsatellite Analysis for LOH on Chromosome 10q Blood and tumor DNA, which were isolated according to standard procedures, were screened for LOH on chromosome 10q by using the following polymorphic markers: D10S537, D10S219, D10- S1744 (near PTEN), D10S541, D10S579, D10S1755, D10S1671, D10S597, D10S1693, D10S209, D10S587 (near DMBT1), D10- S1723, D10S212, D10S537, D10S541, D10S597, D10S1693, and D10S212 spanning the region located between 10q21.22 and 10qter. One of the primers was labeled with the Hex, Fam, or Ned fluorochromes (Perkin-Elmer, Norwalk, CT). The samples were run on an automatic sequencer and analyzed with the Gene Scan program (Abi-prism, Perkin-Elmer). Screening of the PTEN/MMAC1 Gene Mutations The PTEN/MMAC1 mutations were screened using the denaturing gradient gel electrophoresis method in the entire coding sequence of the nine exons and their corresponding splice junctions with previously described primers. 26 The DNA showing altered denaturing gradient gel electrophoresis profiles was sequenced bidirectionally by using the Perkin-Elmer kit and sequencer. When a DNA variant was found, the corresponding blood DNA was sequenced to differentiate somatic events from constitutional variants (polymorphism or germline mutation). Search for Homozygous Deletion of the DMBT1 Locus Tumor DNA was screened for DMBT1 homozygous deletions by using a competitive multiplex PCR procedure modified from Mol- 1397
2 M. Sanson, et al. FIG. 1. Diagrams showing deletion mapping of LOH on 10q in 39 oligodendrogliomas: eight WHO Grade II (OII) and 31 WHO Grade III (OIII). A white square indicates retention of heterozygosity; a black square indicates the LOH. Uninformative or untested cases are indicated by a vertical line. Partial deletions were found in one Grade II and nine Grade III oligodendrogliomas, as shown by this figure. lenhauer, et al. 18 Briefly, three different fragments (g14, 241 bp; 74k, 293 bp; 60k, 257 bp) located on intron 16, exon 1, and exon 31 of the DMBT1 locus, respectively, were coamplified with a c12 (190-bp) fragment located on 8q11. The primers were: 5 GGTTGACAC- AAAACCAACCC and 3 GGTGTGAGTGCTTGATTGCA for the g14 fragment; 5 AGATGCTTTCCCCCTTGG and 3 CTTTTG- CTAACAGTCGATGGC for the 74k fragment; 5 TAATGCCTG- GTCATCTGGTG and 3 GAAATTCCTATTGCCCCTCC for the 60k fragment; and 5 AGTTGGGGCCATGTGACTAG and 3 TTC- CCAGCTGAGCAACAAC for the c12 fragment. The conditions for the coamplification were: 94 C (3 minutes), followed by 34 cycles at 94 C (30 seconds), 60 C (30 seconds), 72 C (1 minute), and one step at 72 C for 10 minutes, for the g14 and 60k fragments; 74k amplification differed by the temperature used for annealing (58 C instead of 60 C). The PCR ethidium bromide fluorescence signal response was quantified by scanning. We considered that the DMBT1 locus was deleted when all three PCR fragments showed homozygous deletions. Statistical Analysis The prognostic value of the variables was classified according to progression-free survival and overall survival, which were calculated from surgery until relapse or death. Survival curves were derived from Kaplan Meier estimates. Two variables, LOH on chromosome 10 and DMBT1 homozygous deletions, were investigated. Two-sided probability values less than 0.05 were considered significant. Results The LOH data are reported in Fig. 1; LOH on 10q (for at least one marker) was found in 18 (58%) of 31 WHO Grade III oligodendrogliomas and in one (12%) of eight WHO Grade II tumors (p = 0.02 according to the chi-square test). As shown by the deletion mapping, chromosome 10q was completely lost in nine cases and partially lost in 10 cases, involving the candidate PTEN/MMAC and DMBT1 loci in most of the cases. Screening of the PTEN/MMAC with denaturing gradient gel electrophoresis resulted in two abnormal profiles. The first one, found in intron 5 (IVS5 40insT), was also present in the corresponding blood DNA and was therefore considered to be a polymorphism. The second (c.384g T) corresponded to a missense mutation (Lys128Asn) on exon 5. As shown in Fig. 2, DMBT1 homozygous deletions were found in 10 (26%) of 39 oligodendrogliomas (three of eight WHO Grade II, seven of 31 WHO Grade III). Clinical follow up was available for 38 of 39 patients. The median age at surgery was 42 years (range years), 39 years for the subgroup with no LOH on 10q, and 49 years for the subgroup with LOH on 10q; the median Karnofsky Performance Scale score was 90 (range ) for the whole group, and for both the subgroup without LOH on 10q and the one with LOH on 10q. Five patients with Grade II tumors were treated with surgery alone. In addition to surgery, seven patients (three with Grade II and four with Grade III lesions) were treated with radiation therapy, two patients with Grade III tumors received chemotherapy, and 24 patients with Grade III lesions were treated with radiation therapy and chemotherapy. The LOH on 10q was significantly associated with reduced progression-free intervals (p = ; log rank test) and with reduced overall survival (p = 0.035; Fig. 3). If only the WHO Grade III group was considered, LOH on 10q was still associated with a shorter progression-free survival 1398
3 Loss of chromosome 10q in oligodendrogliomas FIG. 2. Gene map in which the exon intron structure of the DMBT1 gene and the location of 74k, g14, and 60k are indicated. Homozygous deletion ( ) of DMBT1 is detected by multiplex PCR with c12. Absence of amplification of one of the DMBT1 fragments is indicated by a minus sign, whereas a plus sign indicates that the DMBT1 fragment is normally amplified by PCR. time (p 0.05; Fig. 4), but the relationship of tumor grade to overall survival did not reach a significant level (p = 0.17). In contrast, DMBT1 homozygous deletion was related neither to progression-free survival nor to overall survival. Discussion In this study we show that chromosome 10q deletions are common in anaplastic oligodendrogliomas (or WHO Grade III) and indicate a poor outcome. In addition, DMBT1 could represent a target gene in oligodendrogliomas, whereas the role of the PTEN/MMAC gene appears to be marginal. The fact that LOH on 10q was present in 58% of WHO Grade III oligodendrogliomas, a higher rate than previously reported, 13,21 and in only 12% of WHO Grade II oligodendrogliomas indicates that this alteration is related to anaplasia. This finding is consistent with the astrocytoma model in which LOH on 10q is closely related to the acquisition of a highly malignant phenotype, particularly the GBM subtype. For instance, in our series of GBMs, 25 (83%) of 30 tumors exhibited LOH on chromosome 10q (unpublished data). In this setting, it is not surprising that LOH on 10q was significantly associated with reduced progression-free and overall survival in the entire group of oligodendrogliomas (composed of WHO Grades II and III), as previously stated. 21 More important is the observation that, within the single histological subgroup of WHO Grade III oligodendrogliomas, LOH on chromosome 10q also indicated a shorter progression-free survival. Thus, if our data are confirmed, detection of LOH on chromosome 10q by genotyping could become a useful prognostic marker for oligodendrogliomas (especially Grade III lesions), indicating an unfavorable course and justifying a more vigorous initial therapeutic approach. This information could complete the search for 1p/ 19q deletions that are, in contrast, favorable predictors of survival. 3,22 Although the deleted regions encompassed the candidate PTEN/MMAC locus on 10q23 in 16 (84%) of 19 of our tumors with LOH on 10q, only one mutation of PTEN/ MMAC (6%) was detected. This result agrees with previous reports in which PTEN/MMAC mutations were detected in FIG. 3. Upper: Graph showing survival time in pure oligodendroglioma (WHO Grades II and III) according to the presence or absence of LOH on 10q (p 0.05). Lower: Graph showing time to disease progression in pure oligodendroglioma (Grades II and III) according to the presence or absence of LOH on 10q (p 0.001). 1399
4 M. Sanson, et al. Conclusions The results of this study indicate that the search for LOH on 10q could yield a valuable prognostic marker in anaplastic oligodendrogliomas, usefully completing 1p and 19q genotyping. Our data also indicate that DMBT1 is frequently inactivated in oligodendrogliomas, whereas PTEN mutation is rare. Nevertheless, the absence of a correlation with survival makes the role of DMBT1 in tumorigenesis still questionable. Taken together, our data indicate the involvement of at least one additional tumor suppressor gene on 10q and need further investigation. Acknowledgments We are indebted to the patients who agreed to participate in this study, and to Drs. X. P. Zhou and J. P. Lagarde for technical advice. FIG. 4. Graph showing time to disease progression in anaplastic oligodendroglioma according to the presence or absence of LOH on 10q (p 0.05). 3 to 10% of oligodendrogliomas. 6,9,21 Alteration of this tumor suppressor gene is therefore an unusual event in oligodendrogliomas and is unlikely to play a substantial role in this tumor type. More probably, the chromosome 10q contains another tumor suppressor gene involved in the tumorigenesis of oligodendrogliomas. Previous LOH studies performed on low- and high-grade gliomas, including oligodendrogliomas, have pointed to another region located on 10q25-26, 13,15 which contains the candidate gene DMBT1. Homozygous deletions of DMBT1 have been reported in diverse malignant brain tumors (medulloblastomas and GBMs), 18,23 as well as in other cancers (gastrointestinal and lung). The DMBT1 locus contains multiple specific repeats that may be susceptible to genomic instability, a feature that could explain the frequency of homozygous deletions. 17 In a recent study a low 3% rate of DMBT1 homozygous deletions was found in oligodendrogliomas 21 but our data indicate a much higher figure of 26%. On the other hand, in our experience, homozygous deletion was found in only 7% of GBMs (two of 30, unpublished observations). Interestingly, deletion of DMBT1 was independent of tumor grade and clinical course, suggesting that this alteration is an early event in oligodendroglioma progression. This finding is consistent with the results of Maier, et al., 15 who found 36% of hemizygous deletions at 10q25-qtel, a region that includes the DMBT1 locus, in low-grade astrocytomas and oligodendrogliomas. Thus, DMBT1 could be preferentially involved in oligodendrogliomas. The tumor suppressor function of this gene remains unsettled, 24 however, even if it has been suggested recently that DMBT1 could be involved in an antitumor immune response by stimulating macrophages in the local environment. 16 An alternative explanation is therefore that it is not DMBT1 but a neighboring gene that is involved in tumorigenesis in oligodendrogliomas. References 1. Bello MJ, Leone PE, Vaquero J, et al: Allelic loss at 1p and 19q frequently occurs in association and may represent early oncogenic events in oligodendroglial tumors. Int J Cancer 64: , Cairncross G, Macdonald D, Ludwin S, et al: Chemotherapy for anaplastic oligodendroglioma. National Cancer Institute of Canada Clinical Trials Group. J Clin Oncol 12: , Cairncross JG, Ueki K, Zlatescu MC, et al: Specific genetic predictors of chemotherapeutic response and survival in patients with anaplastic oligodendrogliomas. J Natl Cancer Inst 90: , Coons SW, Johnson PC, Scheithauer BW, et al: Improving diagnostic accuracy and interobserver concordance in the classification and grading of primary gliomas. Cancer 79: , Daumas-Duport C, Varlet P, Tucker ML, et al: Oligodendrogliomas: Part 1: Patterns of growth, histological diagnosis, clinical and imaging correlations: a study of 153 cases. J Neurooncol 34: 37 59, Duerr EM, Rollbrocker B, Hayashi Y, et al: PTEN mutations in gliomas and glioneural tumors. Oncogene 16: , Fujimoto M, Fults DW, Thomas GA, et al: Loss of heterozygosity on chromosome 10 in human glioblastoma multiforme. Genomics 4: , Fujisawa H, Kurrer M, Reis RM, et al: Acquisition of the glioblastoma phenotype during astrocytoma progression is associated with loss of heterozygosity on 10q25-qter. Am J Pathol 155: , Jeuken JW, Nelen MR, Vermeer H, et al: PTEN mutation analysis in two genetic subtypes of high-grade oligodendroglial tumors. PTEN is only occasionally mutated in one of the two genetic subtypes. Cancer Genet Cytogenet 119:42 47, Kleihues P, Cavenee WK: Pathology and Genetics of Tumours of the Nervous System. Lyon: IARC Press, Kraus JA, Koopmann J, Kaskel P, et al: Shared allelic losses on chromosomes 1p and 19q suggest a common origin of oligodendroglioma and oligoastrocytoma. J Neuropathol Exp Neurol 54: 91 95, Li J, Yen C, Liaw D, et al: PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast and prostate cancer. Science 275: , Lin H, Bondy ML, Langford LA, et al: Allelic deletion analyses of MMAC/PTEN and DMBT1 loci in gliomas: relationship to prognostic significance. Clin Cancer Res 4: , Maier D, Comparone D, Taylor E, et al: New deletion in lowgrade oligodendroglioma at the glioblastoma suppressor locus on chromosome 10q Oncogene 15: , Maier D, Zhang Z, Taylor E, et al: Somatic deletion mapping on chromosome 10 and sequence analysis of PTEN/MMAC1 point to the 10q25 26 region as the primary target in low-grade and high-grade gliomas. Oncogene 16: ,
5 Loss of chromosome 10q in oligodendrogliomas 16. Mollenhauer J, Herbertz S, Holmskov U, et al: DMBT1 encodes a protein involved in the immune defense and in epithelial differentiation and is highly unstable in cancer. Cancer Res 60: , Mollenhauer J, Holmskov U, Wiemann S, et al: The genomic structure of the DMBT1 gene: evidence for a region with susceptibility to genomic instability. Oncogene 18: , Mollenhauer J, Wiemann S, Scheurlen W, et al: DMBT1, a new member of the SRCR superfamily, on chromosome 10q is deleted in malignant brain tumors. Nat Genet 17:32 39, Rasheed BK, Stenzel TT, McLendon RE, et al: PTEN gene mutations are seen in high-grade but not in low-grade gliomas. Cancer Res 57: , Reifenberger J, Reifenberger G, Liu L, et al: Molecular genetic analysis of oligodendroglial tumors shows preferential allelic deletions on 19q and 1p. Am J Pathol 145: , Sasaki H, Zlatescu MC, Betensky RA, et al: PTEN is a target of chromosome 10q loss in anaplastic oligodendrogliomas and PTEN alterations are associated with poor prognosis. Am J Pathol 159: , Smith JS, Alderete B, Minn Y, et al: Localization of common deletion regions on 1p and 19q in human gliomas and their association with histological subtype. Oncogene 18: , Somerville RP, Shoshan Y, Eng C, et al: Molecular analysis of two putative tumor suppressor genes, PTEN and DMBT, which have been implicated in glioblastoma multiforme disease progression. Oncogene 17: , Steck PA, Lin H, Langford LA, et al: Functional and molecular analyses of 10q deletions in human gliomas. Genes Chromosomes Cancer 24: , Steck PA, Pershouse MA, Jasser SA, et al: Identification of a candidate tumor suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat Genet 15: , Zhou XP, Li YJ, Hoang-Xuan K, et al: Mutational analysis of the PTEN gene in gliomas: molecular and pathological correlations. Int J Cancer 84: , 1999 Manuscript received March 25, Accepted in final form August 7, This work was supported by the Association pour la Recherche contre le Cancer (ARC 5892), the Ligue Nationale contre le Cancer (75/01-RS/42), and the Délégation à la Recherche clinique (CRIC 99042). Pascal Leuraud and Jié He received research grants from the Association pour la Recherche contre le Cancer and the Association pour la Recherche sur les Tumeurs cérébrales, respectively. Address reprint requests to: Marc Sanson, M.D., Clinique Neurologique, Hôpital de la Salpêtrière, 47 Boulevard de l Hôpital, Paris, France. m.sanson@psl.ap-hop-paris.fr. 1401
Mutations of PTEN Gene in Gliomas Correlate to Tumor Differentiation and Short-term Survival Rate
Mutations of PTEN Gene in Gliomas Correlate to Tumor Differentiation and Short-term Survival Rate YILING YANG 1, NAIYUAN SHAO 1, GUANGHUA LUO 2, LU LI 1, LU ZHENG 2, PETER NILSSON-EHLE 3 and NING XU 3
More informationRecent reports have shown that many oligodendroglial
Allelic Losses in Oligodendroglial and Oligodendroglioma-like Neoplasms Analysis Using Microsatellite Repeats and Polymerase Chain Reaction Mahlon D. Johnson, MD, PhD; Cindy L. Vnencak-Jones, PhD; Steven
More informationCorporate Medical Policy
Corporate Medical Policy Analysis of MGMT Promoter Methylation in Malignant Gliomas File Name: Origination: Last CAP Review: Next CAP Review: Last Review: analysis_of_mgmt_promoter_methylation_in_malignant_gliomas
More informationOligodendroglioma: Toward Molecular Definitions in Diagnostic Neuro-Oncology
Journal of Neuropathology and Experimental Neurology Vol. 62, No. 2 Copyright 2003 by the American Association of Neuropathologists February, 2003 pp. 111 126 Oligodendroglioma: Toward Molecular Definitions
More informationMorphological features and genetic alterations
Morphological features and genetic alterations Tutor : Audrey Rousseau Caget Lise: Université d Angers Iorio Vittoria: Seconda Università degli studi di Napoli Manaila Roxana: Iuliu Hatieganu University
More informationPTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis
American Journal of Pathology, Vol. 159, No. 1, July 2001 Copyright American Society for Investigative Pathology PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations
More informationSredišnja medicinska knjižnica
Središnja medicinska knjižnica Pećina-Šlaus, N., Beroš, V., Houra, K., Čupić, H. (2006) Loss of heterozygosity of the APC gene found in a single case of oligoastrocytoma. Journal of neurooncology, 78 (2).
More informationPTEN Mutation, EGFR Amplification, and Outcome in Patients With Anaplastic Astrocytoma and Glioblastoma Multiforme
PTEN Mutation, EGFR Amplification, and Outcome in Patients With Anaplastic Astrocytoma and Glioblastoma Multiforme Justin S. Smith, Issei Tachibana, Sandra M. Passe, Brenda K. Huntley, Thomas J. Borell,
More informationORIGINAL ARTICLE. Loss of PTEN Expression as a Prognostic Marker for Tongue Cancer
ORIGINAL ARTICLE Loss of PTEN Expression as a Prognostic Marker for Tongue Cancer Janet I. Lee, MD; Jean-Charles Soria, MD; Khaled A. Hassan, MD; Adel K. El-Naggar, MD, PhD; Ximing Tang, MD, PhD; Diane
More information5-hydroxymethylcytosine loss is associated with poor prognosis for
5-hydroxymethylcytosine loss is associated with poor prognosis for patients with WHO grade II diffuse astrocytomas Feng Zhang 1,*, Yifan Liu 2, Zhiwen Zhang 1, Jie Li 1, Yi Wan 3, Liying Zhang 1, Yangmei
More informationSystemic Treatment. Third International Neuro-Oncology Course. 23 May 2014
Low-Grade Astrocytoma of the CNS: Systemic Treatment Third International Neuro-Oncology Course São Paulo, Brazil 23 May 2014 John de Groot, MD Associate Professor, Neuro-Oncology UT MD Anderson Cancer
More informationPROPOSED/DRAFT Local Coverage Determination (LCD): MolDX: Chromosome 1p/19q deletion analysis (DL36483)
moldx: Chromosome 1p/19q deletion analysis (DL36483) Page 1 of 8 PROPOSED/DRAFT Local Coverage Determination (LCD): MolDX: Chromosome 1p/19q deletion analysis (DL36483) Close Section Navigation
More informationNature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
More informationMUTATION ANALYSIS OF DMBT1 IN GLIOBLASTOMA, MEDULLOBLASTOMA AND OLIGODENDROGLIAL TUMORS
Int. J. Cancer: 105, 76 81 (2003) 2003 Wiley-Liss, Inc. Publication of the International Union Against Cancer MUTATION ANALYSIS OF DMBT1 IN GLIOBLASTOMA, MEDULLOBLASTOMA AND OLIGODENDROGLIAL TUMORS Jesse
More informationMolDX: Chromosome 1p/19q deletion analysis
MolDX: Chromosome 1p/19q deletion analysis CGS Administrators, LLC Jump to Section... Please Note: This is a Proposed LCD. Proposed LCDs are works in progress and not necessarily a reflection of the current
More informationRadioterapia no Tratamento dos Gliomas de Baixo Grau
Radioterapia no Tratamento dos Gliomas de Baixo Grau Dr. Luis Souhami University Montreal - Canada Low Grade Gliomas Relatively rare Heterogeneous, slow growing tumors WHO Classification Grade I Pilocytic
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationGenetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma
Genetic variability of genes involved in DNA repair influence treatment outcome in osteosarcoma M.J. Wang, Y. Zhu, X.J. Guo and Z.Z. Tian Department of Orthopaedics, Xinxiang Central Hospital, Xinxiang,
More informationDivision of Anatomic Pathology, Department of Laboratory Medicine and Pathology, Mayo Clinic College of Medicine, Rochester, Minn.
Brain Pathology ISSN 1015-6305 RESEARCH ARTICLE Anaplastic Oligodendroglial Tumors: Refining the Correlation among Histopathology, 1p 19q Deletion and Clinical Outcome in Intergroup Radiation Therapy Oncology
More informationgliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
More informationMeningiomas: Loss of Heterozygosity on Chromosome 10 and Marker-Specific Correlations with Grade, Recurrence, and Survival
Vol. 9, 4443 4451, October 1, 2003 Clinical Cancer Research 4443 Meningiomas: Loss of Heterozygosity on Chromosome 10 and Marker-Specific Correlations with Grade, Recurrence, and Survival Dana Mihaila,
More informationMRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
More informationGenomic analysis of childhood High grade glial (HGG) brain tumors
Genomic analysis of childhood High grade glial (HGG) brain tumors Linda D Cooley Children s Mercy, Kansas City The Children s Mercy Hospital, 2017 Genomic analysis of childhood High grade glial (HGG) brain
More informationDiffusion Restriction Precedes Contrast Enhancement in Glioblastoma Multiforme
Diffusion Restriction Precedes Contrast Enhancement in Glioblastoma Multiforme Adil Bata 1, Jai Shankar 2 1 Faculty of Medicine, Class of 2017 2 Department of Diagnostic Radiology, Division of Neuroradiology,
More information2017 Diagnostic Slide Session Case 3
2017 Diagnostic Slide Session Case 3 Andrew Gao, MD Lili-Naz Hazrati, MD, PhD Cynthia Hawkins, MD, PhD Hospital for Sick Children and University of Toronto, Toronto, Canada Disclosures: none Clinical History
More information1 di 9 09/04/ Home
1 di 9 09/04/2011 12.03 Home 2 di 9 09/04/2011 12.03 TOPIC OF THE ISSUE: ORIGINAL ARTICLE Year : 2011 Volume : 59 Issue : 2 Page : 254--261 Loss of heterozygosity on chromosome 10q in glioblastomas, and
More informationOriginal Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk in a Chinese Han population
Int J Clin Exp Med 2014;7(12):5832-5836 www.ijcem.com /ISSN:1940-5901/IJCEM0002117 Original Article The programmed death-1 gene polymorphism (PD-1.5 C/T) is associated with non-small cell lung cancer risk
More informationLETTER INTENT
2016-2017 LETTER INTENT Using CRISPR Induced Deletions on Chromosome 1p and 19q of human tissue models to Determine the Effectiveness of Temozolomide Chemotherapy Treatment on Grade II Oligodendroglioma
More informationTechnical Advance. Multiplex ligation-dependent probe amplification
Technical Advance Journal of Molecular Diagnostics, Vol. 8, No. 4, September 2006 Copyright American Society for Investigative Pathology and the Association for Molecular Pathology DOI: 10.2353/jmoldx.2006.060012
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationIDH1 R132H/ATRX Immunohistochemical validation
IDH1 R132H/ATRX Immunohistochemical validation CIQC/DSM 2016 12 June 2016 0835-0905 Stephen Yip, M.D., Ph.D., FRCPC University of British Columbia Disclosure Statement I have nothing to disclose I will
More informationMOLECULAR DIAGNOSTICS OF GLIOMAS
MOLECULAR DIAGNOSTICS OF GLIOMAS Arie Perry, M.D. Director, Neuropathology Division DIFFUSE GLIOMAS Cell types Astrocytomas (A) Oligodendrogliomas (O) Mixed oligoastrocytoma (MOA) Three WHO grades: II,
More informationGliomas in the 2016 WHO Classification of CNS Tumors
Gliomas in the 2016 WHO Classification of CNS Tumors Hindi N Al-Hindi, MD, FCAP Consultant Neuropathologist and Head Section of Anatomic Pathology Department of Pathology and Laboratory Medicine King Faisal
More informationEpidemiology and outcome research of glioma patients in Southern Switzerland: A population based analysis
Epidemiology and outcome research of glioma patients in Southern Switzerland: A population based analysis G. Pesce 1, A. Bordoni, F. Montanaro, R. Renella 3, A. Richetti 1, D. Boscherini 3, S. Mauri 4,
More informationIntegrating omics data sets and biological knowledge: Multiple Factor Analysis as a powerful strategy
Integrating omics data sets and biological knowledge: Multiple Factor Analysis as a powerful strategy Marie de Tayrac 1, Sébastien Lê 2, Marc Aubry 1, François Husson 2, and Jean Mosser 1 1 CNRS UMR 6061
More informationIVF Michigan, Rochester Hills, Michigan, and Reproductive Genetics Institute, Chicago, Illinois
FERTILITY AND STERILITY VOL. 80, NO. 4, OCTOBER 2003 Copyright 2003 American Society for Reproductive Medicine Published by Elsevier Inc. Printed on acid-free paper in U.S.A. CASE REPORTS Preimplantation
More informationComputational Systems Biology: Biology X
Bud Mishra Room 1002, 715 Broadway, Courant Institute, NYU, New York, USA L#4:(October-0-4-2010) Cancer and Signals 1 2 1 2 Evidence in Favor Somatic mutations, Aneuploidy, Copy-number changes and LOH
More informationZurich Open Repository and Archive. Genetic pathways to glioblastoma: a population-based study
University of Zurich Zurich Open Repository and Archive Winterthurerstr. 190 CH-8057 Zurich http://www.zora.uzh.ch Year: 2004 Genetic pathways to glioblastoma: a population-based study Ohgaki, H; Dessen,
More information성균관대학교삼성창원병원신경외과학교실신경종양학 김영준. KNS-MT-03 (April 15, 2015)
성균관대학교삼성창원병원신경외과학교실신경종양학 김영준 INTRODUCTIONS Low grade gliomas (LGG) - heterogeneous group of tumors with astrocytic, oligodendroglial, ependymal, or mixed cellular histology - In adults diffuse, infiltrating
More informationCOLD-PCR HRM: A HIGHLY SENSITIVE DETECTION METHOD FOR IDH1 MUTATION
COLD-PCR HRM: A HIGHLY SENSITIVE DETECTION METHOD FOR IDH MUTATION Blandine Boisselier, Yannick Marie, Marianne Labussière, Pietro Ciccarino, Virginie Desestret, Xiaowei Wang, Laurent Capelle, Jean-Yves
More informationGenetic differences between neurocytoma and dysembryoplastic neuroepithelial tumor and oligodendroglial tumors
J Neurosurg 97:1350 1355, 2002 Genetic differences between neurocytoma and dysembryoplastic neuroepithelial tumor and oligodendroglial tumors HIRONORI FUJISAWA, M.D., KOHEI MARUKAWA, M.D., MITSUHIRO HASEGAWA,
More informationClinical significance of genetic analysis in glioblastoma treatment
Clinical significance of genetic analysis in glioblastoma treatment Department of Neurosurgery, Graduate School of Medical Sciences, Kyushu University, Fukuoka, Japan Koji Yoshimoto Can we get prognostic
More informationStudying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy
Kavya Puchhalapalli CALS Honors Project Report Spring 2017 Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy Abstract Malignant brain tumors including medulloblastomas and primitive neuroectodermal
More informationAnatomic locations in high grade glioma
Romanian Neurosurgery (2015) XXIX 3: 271-277 271 Anatomic locations in high grade glioma A. Oslobanu 1, St.I. Florian 2 University of Medicine and Pharmacy, Iuliu Hatieganu Cluj-Napoca 1 Assistant Professor
More informationTELOMERASE ACTIVITY IN MALAYSIAN PATIENTS WITH CENTRAL NERVOUS SYSTEM TUMORS
TELOMERASE ACTIVITY IN MALAYSIAN PATIENTS WITH CENTRAL NERVOUS SYSTEM TUMORS Mohd Nizam Isa 1, Sarina Sulong 1, Mohamad Ros Sidek 1, P Jain George 2 and Jafri Malin Abdullah 2 1 Human Genome Center, Health
More informationAssociation between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer
Association between ERCC1 and ERCC2 gene polymorphisms and susceptibility to pancreatic cancer M.G. He, K. Zheng, D. Tan and Z.X. Wang Department of Hepatobiliary Surgery, Nuclear Industry 215 Hospital
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationMolecular and genetic analysis of stromal fibroblasts in prostate cancer
Final report ESMO Translational Research Fellowship 2010-2011 Molecular and genetic analysis of stromal fibroblasts in prostate cancer Michalis Karamouzis Host Institute Department of Biological Chemistry,
More informationExamining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to.
Stratified Medicine Examining large groups of cancer patients to identify ways of predicting which therapies cancers might respond to. Looking in detail at cancer cells and their genetic make up. Permit
More informationMolecular Diagnosis. Nucleic acid based testing in Oncology
Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,
More informationNucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis
Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor
More informationPI3-Kinase Signaling. Rational Incorporation of Novel Agents into Multimodality Therapy. PI3-kinase. PI3-kinase 5/2/2010
Rational Incorporation of Novel Agents into Multimodality Therapy I3-Kinase Signaling EGF IRS1 I3K EGFR I2 I3 TEN Rictor GßL AKT RAS40 Survival Raptor GßL Daphne Haas-Kogan UCSF Annual Course April 30-May
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationTumor suppressor genes D R. S H O S S E I N I - A S L
Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to
More informationMANAGEMENT N OF PRIMARY BRAIN TUMOURS IN THE ELDERLY
MANAGEMENT N OF PRIMARY BRAIN TUMOURS IN THE ELDERLY Meningioma, Glioma, Lymphoma Cornu Ph, Keime-Guibert F, Hoang-Xuan K, Pierga JY, Delattre JY Neuro-oncology Group of Pitie-Salpetriere hospital-paris-france
More informationAccording to traditional opinion, oligodendrogliomas
Immunohistochemical Analysis of p18ink4c and p14arf Protein Expression in 117 Oligodendrogliomas Correlation With Tumor Grade and Clinical Outcome Andrey Korshunov, MD, DSc; Andrey Golanov, MD, DSc Objective.
More informationGlioblastomas with oligodendroglial component common origin of the different histological parts and genetic subclassification
Analytical Cellular Pathology / Cellular Oncology 33 (2010) 37 54 37 DOI 10.3233/ACP-CLO-2010-0530 IOS Press Glioblastomas with oligodendroglial component common origin of the different histological parts
More informationMolecular diagnostics of gliomas: state of the art
Acta Neuropathol (2010) 120:567 584 DOI 10.1007/s00401-010-0736-4 REVIEW Molecular diagnostics of gliomas: state of the art Markus J. Riemenschneider Judith W. M. Jeuken Pieter Wesseling Guido Reifenberger
More informationPROCARBAZINE, lomustine, and vincristine (PCV) is
RAPID PUBLICATION Procarbazine, Lomustine, and Vincristine () Chemotherapy for Anaplastic Astrocytoma: A Retrospective Review of Radiation Therapy Oncology Group Protocols Comparing Survival With Carmustine
More informationOriginal Article Reduced expression of mir-506 in glioma is associated with advanced tumor progression and unfavorable prognosis
Int J Clin Exp Pathol 2016;9(1):181-185 www.ijcep.com /ISSN:1936-2625/IJCEP0017823 Original Article Reduced expression of mir-506 in glioma is associated with advanced tumor progression and unfavorable
More informationCarmustine implants and Temozolomide for the treatment of newly diagnosed high grade glioma
National Institute for Health and Clinical Excellence Health Technology Appraisal Carmustine implants and Temozolomide for the treatment of newly diagnosed high grade glioma Personal statement Conventional
More informationnuclear science and technology
EUROPEAN COMMISSION nuclear science and technology Identification and isolation of susceptibility genes involved in radiation-induced cancer in humans (SUS GENES IN RAD CAR) Contract N o FIGH-CT1999-00002
More informationZurich Open Repository and Archive. Procarbazine and CCNU as initial treatment in gliomatosis cerebri
University of Zurich Zurich Open Repository and Archive Winterthurerstr. 190 CH-8057 Zurich http://www.zora.uzh.ch Year: 2008 Procarbazine and CCNU as initial treatment in gliomatosis cerebri Glas, M;
More informationHistological Type. Morphological and Molecular Typing of breast Cancer. Nottingham Tenovus Primary Breast Cancer Study. Survival (%) Ian Ellis
Morphological and Molecular Typing of breast Cancer Ian Ellis Molecular Medical Sciences, University of Nottingham Department of Histopathology, Nottingham University Hospitals NHS Trust Histological Type
More informationNeuro-Oncology Advance Access published April 4, 2012
Neuro-Oncology Advance Access published April 4, 2012 Neuro-Oncology doi:10.1093/neuonc/nos070 NEURO-ONCOLOGY Response assessment in recurrent glioblastoma treated with irinotecan-bevacizumab: comparative
More informationOligodendrogliomas: Reproducibility and Prognostic Value of Histologic Diagnosis and Grading
Journal of Neuropathology and Experimental Neurology Vol., No. Copyright 1 by the American Association of Neuropathologists March, 1 pp. 4 s: Reproducibility and Prognostic Value of Histologic Diagnosis
More informationConsultations in Molecular Diagnostics
Consultations in Molecular Diagnostics Molecular Diagnosis of Metastasizing Oligodendroglioma A Case Report Journal of Molecular Diagnostics, Vol. 6, No. 1, February 2004 Copyright American Society for
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationHigh Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas
DOI:http://dx.doi.org/10.7314/APJCP.2014.15.24.10621 RESEARCH ARTICLE High Expression of Forkhead Box Protein C2 is Related to Poor Prognosis in Human Gliomas Yao-Wu Wang 1, Chun-Li Yin 2, Hong-Yi Zhang
More informationKarl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
Expanding on WHO guideline compliant molecular testing of central nervous system tumors by low density whole genome sequencing. Karl Kashofer, Phd Institut für Pathologie Medizinische Universität Graz
More informationMRC-Holland MLPA. Related SALSA MLPA probemixes P190 CHEK2: Breast cancer susceptibility, genes included: CHEK2, ATM, PTEN, TP53.
SALSA MLPA probemix P056-C1 TP53 Lot C1-0215 & lot C1-0214. As compared to version B1 (lot B1-1011) most of the reference and flanking probes have been replaced and several have been added. Furthermore,
More informationLoss of PTEN Expression in Breast Cancers
The Korean Journal of Pathology 2005; 39: 236-41 Loss of PTEN Expression in Breast Cancers Sun Hee Chang Shi Nae Lee 1 Min Sun Cho 1 Heasoo Koo 1 Woon Sup Han 1 Seock-Ah Im 2 Byung-In Moon 3 Hyun Suk Suh
More informationChromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011
Chromothripsis: A New Mechanism For Tumorigenesis? i Fellow s Conference Cheryl Carlson 6/10/2011 Massive Genomic Rearrangement Acquired in a Single Catastrophic Event during Cancer Development Cell 144,
More informationEfficacy of Treatment for Glioblastoma Multiforme in Elderly Patients (65+): A Retrospective Analysis
Efficacy of Treatment for Glioblastoma Multiforme in Elderly Patients (65+): A Retrospective Analysis Igal Kushnir MD 1 * and Tzahala Tzuk-Shina MD 2 1 Oncology Insitute, Tel Aviv Sourasky Medical Center,
More informationPolymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women
www.bioinformation.net Volume 13(5) Hypothesis Polymorphism of the PAI-1gene (4G/5G) may be linked with Polycystic Ovary Syndrome and associated pregnancy disorders in South Indian Women Maniraja Jesintha
More informationA clinical perspective on neuropathology and molecular genetics in brain tumors
A clinical perspective on neuropathology and molecular genetics in brain tumors M.J. van den Bent Erasmus MC Cancer Institute Rotterdam, the Netherlands Disclosures Member speakersbureau: MSD Consultancy:
More informationPathologic Characteristics and Treatment Outcome of Patients with Malignant Brain Tumors: A Single Institutional Experience from Iran
Middle East Special Report Middle East Journal of Cancer; April 2014; 5(2): 91-96 Pathologic Characteristics and Treatment Outcome of Patients with Malignant Brain Tumors: A Single Institutional Experience
More informationSEROUS TUMORS. Dr. Jaime Prat. Hospital de la Santa Creu i Sant Pau. Universitat Autònoma de Barcelona
SEROUS TUMORS Dr. Jaime Prat Hospital de la Santa Creu i Sant Pau Universitat Autònoma de Barcelona Serous Borderline Tumors (SBTs) Somatic genetics Clonality studies have attempted to dilucidate whether
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationCombined analysis of TERT, EGFR, and IDH status defines distinct prognostic glioblastoma classes
Combined analysis of TERT, EGFR, and IDH status defines distinct prognostic glioblastoma classes Marianne Labussière, PharmD, PhD Blandine Boisselier, MSc Karima Mokhtari, MD Anna-Luisa Di Stefano, MD
More informationClinical and Radiological Prognostic Factors of Anaplastic Oligodendroglioma Treated by Combined Therapy
Neurol Med Chir (Tokyo) 45, 232 239, 2005 Clinical and Radiological Prognostic Factors of Anaplastic Oligodendroglioma Treated by Combined Therapy Seok-Gu KANG, JongHyunKIM, DoHyunNAM, andkwanpark Department
More informationPRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES
PRINCESS MARGARET CANCER CENTRE CLINICAL PRACTICE GUIDELINES CENTRAL NERVOUS SYSTEM ANAPLASTIC GLIOMAS CNS Site Group Anaplastic Gliomas Author: Dr. Norm Laperriere Date: February 20, 2018 1. INTRODUCTION
More informationMolecular Oncology, oncology parameters see each test
Molecular Oncology, oncology parameters see each test DPD deficiency Dihydropyrimidine dehydrogenase deficiency (DPD deficiency) is an autosomal recessive metabolic disorder in which there is absent or
More informationKey Words. Oligodendroglioma Oligoastrocytoma 1p 19q MGMT Temozolomide
The Oncologist The Oncologist CME Program is located online at http://cme.theoncologist.com/. To take the CME activity related to this article, you must be a registered user. Neuro-Oncology Oligodendrogliomas:
More informationIntegrating molecular markers into the World Health Organization classification of CNS tumors: a survey of the neuro-oncology community
Integrating molecular markers into the World Health Organization classification of CNS tumors: a survey of the neuro-oncology community The Harvard community has made this article openly available. Please
More informationMultistep nature of cancer development. Cancer genes
Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic
More informationGENETIC MARKERS IN LYMPHOMA a practical overview. P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute
GENETIC MARKERS IN LYMPHOMA a practical overview P. Heimann Dpt of Medical Genetics Erasme Hospital - Bordet Institute B and T cell monoclonalities Rearrangement of immunoglobin and TCR genes may help
More informationHaematology Probes for Multiple Myeloma
Haematology Probes for Multiple Myeloma MULTIPLE MYELOMA Multiple myeloma (MM) is a plasma cell neoplasm, characterised by the accumulation of clonal plasma cells in the bone marrow and by very complex
More informationOligodendroglioma: imaging findings, radio-pathological correlation and evolution
Oligodendroglioma: imaging findings, radio-pathological correlation and evolution Poster No.: C-2104 Congress: ECR 2013 Type: Authors: Keywords: DOI: Scientific Exhibit A. Hernandez Castro, M. D. Monedero
More informationCharacterisation of structural variation in breast. cancer genomes using paired-end sequencing on. the Illumina Genome Analyser
Characterisation of structural variation in breast cancer genomes using paired-end sequencing on the Illumina Genome Analyser Phil Stephens Cancer Genome Project Why is it important to study cancer? Why
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationChemotherapy plus Radiotherapy versus Radiotherapy Alone for Patients with Anaplastic Oligodendroglioma: Long Term Results of RTOG 9402
Chemotherapy plus Radiotherapy versus Radiotherapy Alone for Patients with Anaplastic Oligodendroglioma: Long Term Results of RTOG 9402 Gregory Cairncross, Meihua Wang, Edward Shaw, Berndt Scheithauer
More informationHematopathology Service Memorial Sloan Kettering Cancer Center, New York
SH2017-0334 t(14;18) Negative Follicular Lymphoma with 1p36 abnormality associated with In Situ Follicular Neoplasia with t(14;18) translocation Pallavi Khattar MD, Jennifer Maerki MD, Alexander Chan MD,
More informationCitation for published version (APA): Lutke Holzik, M. F. (2007). Genetic predisposition to testicular cancer s.n.
University of Groningen Genetic predisposition to testicular cancer Lutke Holzik, Martijn Frederik IMPORTANT NOTE: You are advised to consult the publisher's version (publisher's PDF) if you wish to cite
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Bredel M, Scholtens DM, Yadav AK, et al. NFKBIA deletion in
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More information609G: Concepts of Cancer Genetics and Treatments (3 credits)
Master of Chemical and Life Sciences Program College of Computer, Mathematical, and Natural Sciences 609G: Concepts of Cancer Genetics and Treatments (3 credits) Text books: Principles of Cancer Genetics,
More informationSALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length.
SALSA MLPA probemix P175-A3 Tumour Gain Lot A3-0714: As compared to the previous version A2 (lot A2-0411), nine probes have a small change in length. This SALSA probemix is for basic research only! This
More informationSurvival following surgery and prognostic factors for recently diagnosed malignant glioma: data from the Glioma Outcomes Project
J Neurosurg 99:467 473, 2003 Survival following surgery and prognostic factors for recently diagnosed malignant glioma: data from the Glioma Outcomes Project EDWARD R. LAWS, M.D., IAN F. PARNEY, M.D.,
More information