ADRENOCORTICAL carcinoma is a rare, highly malignant
|
|
- Cynthia Cummings
- 6 years ago
- Views:
Transcription
1 X/97/$03.00/0 Vol. 82, No. 9 Journal of Clinical Endocrinology and Metabolism Printed in U.S.A. Copyright 1997 by The Endocrine Society Deletion of the Adrenocorticotropin Receptor Gene in Human Adrenocortical Tumors: Implications for Tumorigenesis* MARTIN REINCKE, PATRICIA MORA, FELIX BEUSCHLEIN, WIEBKE ARLT, GEORGE P. CHROUSOS, AND BRUNO ALLOLIO Department of Internal Medicine, University of Wurzburg, Wurzburg, Germany; and the Developmental Endocrinology Branch, National Institute of Child Health and Human Development, National Institutes of Health (G.P.C.), Bethesda, Maryland ABSTRACT Constitutive activating mutations of G protein-coupled receptors, such as that of TSH, have been implicated in the tumorigenesis of human endocrine neoplasms, such as thyroid adenomas. In a previous study we reported that constitutive activating point mutations of the ACTH receptor (ACTH-R) gene, a member of the G protein-coupled receptor superfamily, were not present in hormone-secreting and nonsecretory adrenocortical neoplasms. In this study, we investigated whether allelic loss of the ACTH-R gene is present in sporadic adrenal tumors. We identified a PstI polymorphism in the promoter region 3 kilobases upstream of the coding region of the ACTH-R gene. The rate of heterozygosity for this polymorphism in 99 unrelated Caucasian individuals was 53.5%. Using this polymorphism, we analyzed loss of heterozygosity (LOH) of the ACTH-R gene in 20 informative cases with benign and malignant adrenocortical tumors. Of 16 patients ADRENOCORTICAL carcinoma is a rare, highly malignant tumor with an incidence of 1.7/million. In contrast, benign adrenocortical lesions are very frequent (prevalence, 1/100). Most of these tumors are detected incidentally by ultrasound or computed tomography (so-called incidentalomas) (1). Histopathological differentiation of benign from malignant adrenocortical lesions is crucial for treatment and follow-up. However, histopathological classification of adrenocortical carcinomas can be difficult if metastases or infiltration of surrounding tissues are absent, especially in small, well differentiated carcinomas (2, 3). The human ACTH receptor (ACTH-R) is a member of the G protein-coupled seven-transmembrane domain superfamily of receptors and belongs, together with several MSH receptors, to the melanocortin receptor family (4, 5). The ACTH-R gene was recently cloned (4) and mapped on chromosome 18p11.2 (6, 7). In a previous study, we reported that no constitutive activating point mutations of the ACTH-R gene were present in adrenocortical neoplasms, in contrast to earlier findings of activating mutations of the TSH receptor Received February 26, Revision received May 13, Accepted May 21, Address all correspondence and requests for reprints to: PD Dr. Martin Reincke, Schwerpunkt Endokrinologie, Medizinische Universitätsklinik Würzburg, Josef-Schneider-Strasse 2, Wurzburg, Germany. * This work was supported by a grant from the Deutsche Forschungsgemeinschaft (Re 752/5 1). with benign lesions, LOH was present in 1 oncocytic nonfunctional adenoma, but not in 15 hyperfunctioning adenomas. Of 4 informative patients with adrenocortical carcinomas, LOH was present in 2 cases. Both patients had advanced tumor stages and showed a more rapid course than carcinoma patients without LOH. Analysis of the flanking region of the ACTH-R using the polymorphic microsatelite marker D18S37 and D18S40 showed that this deletion was confined to the ACTH-R gene. Northern blot experiments demonstrated reduced expression of ACTH-R messenger ribonucleic acid in the tumors with LOH of the ACTH-R gene, suggesting functional significance of this finding at the transcriptional level. We conclude that LOH of the ACTH-R gene is possibly involved in adrenal tumorigenesis, contributing to cellular dedifferentiation in adenomas and carcinomas. (J Clin Endocrinol Metab 82: , 1997) in thyroid adenomas (8). These data and evidence from in vitro experiments (9) suggested that ACTH was a differentiating factor of the adrenal cortex, with a low potential of stimulating cell proliferation and tumorigenesis. Thus, inactivation of the ACTH-R signal transduction cascade could result in loss of differentiation and enhanced clonal expansion of adrenal tumors. We recently identified a PstI polymorphism located approximately 3 kilobases (kb) upstream of the ACTH-R-coding region (10). Using this polymorphism, we investigated whether allelic loss of the ACTH receptor gene occurs in adrenocortical neoplasms. We herein report that deletion of the ACTH-R gene at 18p11.2 is present in a subset of adrenocortical neoplasms characterized by loss of differentiation and/or aggressive growth. Subjects and Methods Normal subjects and patients Blood was collected from 99 unrelated Caucasian individuals (57 females and 42 males) after giving written informed consent and stored at 80 C until DNA extraction. Forty-one patients with a variety of adrenal diseases were studied. Twenty of these (49%) were heterozygous for the PstI polymorphism of the ACTH-R gene. The clinical data for these patients are shown in Tables 1 and 2. The clinical and pathological diagnosis was made according to established criteria (2, 3, 11, 12). Blood and neoplastic adrenal tissue was collected with the approval of the ethical committee of the University Hospital of Wurzburg. Normal adult adrenals (n 4) were obtained after organs were removed from brain-dead patients for trans- 3054
2 DEPLETION OF ACTH-R GENE IN ADRENOCORTICAL TUMORS 3055 TABLE 1. Clinical data of the 16 adenoma patients informative for the PstI polymorphism in the ACTH receptor gene Patient no. Age (yr) Sex Clinical presentation Max. tumor size (cm) Histology 1 46 M APA 1.0 Adenoma 2 50 M APA 1.1 Adenoma 3 48 F APA 1.6 Adenoma 4 43 F APA 1.7 Spongiocytic adenoma 5 64 F APA 1.8 Adenoma 6 42 F APA 2.0 Adenoma 7 41 F APA 2.0 Adenoma 8 67 M APA 2.0 Adenoma 9 53 F APA 2.1 Adenoma M APA 3.0 Adenoma M APA 3.2 Adenoma F APA 4.0 Compact cell adenoma F CPA 3.0 Adenoma F CPA 4.0 Adenoma F CPA 6.5 Adenoma Incidentaloma, 7.0 Oncocytic adenoma F nonfunctional F, Female; M, male; APA, aldosterone-producing adenoma; CPA, cortisol-producing adenoma. TABLE 2. Clinical data of the patients with adrenal carcinomas informative for the PstI polymorphism in the ACTH receptor gene Patient no. Age (yr) Sex Clinical presentation Max. tumor size (cm) Tumor stage Disease-free survival LOH of ACTH-R M Virilization 9 T2N0M0 15 months a 2 22 F Virilization 12 T2N0M0 15 months a 3 46 M Cushing s syndrome 8 T4N1M1 b 0 month c 4 79 F Conn s syndrome 9 T4N0M0 d 3 months e F, Female; M, male. a Follow-up with radiological imaging and endocrine evaluation every 3 months. b Tumor invasion of the vena cava, pulmonary and liver metastases. c Deceased after 5 months. d Tumor invasion of the vena cava. e Local tumor recurrence after 3 months, thereafter lost to follow-up. LOH of ACTH-R FIG. 1. Restriction map of the ACTH-R gene. 1, Nontranslated exon approximately 10 kb upstream of the ACTH-R coding region (19); 2, ACTH-R-coding region. plantation. After removing adjacent fat tissue, the tissues were snapfrozen and immediately stored at 80 C until analyzed. Southern blot The PstI polymorphism used in this study is located upstream of the ACTH-R gene (Fig. 1). It was detected when DNA was double digested with PstI and MspI/HpaII to study the methylation pattern of the ACTH-R gene in adrenocortical tumors. Digestion with other restriction enzymes and hybridization with different ACTH-R complementary DNA (cdna) fragments showed that the polymorphism is located 3.1 kb upstream of the ACTH receptor-coding region, within the ACTH-R promoter (data not shown). Leukocytic or tumor DNA was extracted by means of proteinase K digestion and phenol/chloroform extraction. After digestion with PstI according to the instructions of the manufacturer (Boehringer Mannheim, Mannheim, Germany), the DNA was electrophoresed through a 0.8% agarose gel and blotted onto a nylon membrane (Amersham, Braunschweig, Germany). Hybridization was performed using an [ - 32 P]CTP (Amersham)-labeled (Random Primed Labeling Kit, Boehringer Mannheim) full-length human ACTH-R cdna (a 1061-bp fragment of the human ACTH-R generated by PCR using human genomic DNA as template and 5 -GAT TTA ACT TAG ATC TCC AGC AAG T-3 and 5 -CGT TGC CAA GTG CCA GAA TAG TGT-3 as upstream and downstream primers, respectively (4). Heterozygous individuals showed two bands of 4.5 and 4 kb. Using the polymorphic microsatelite markers D18S37 and D18S40 (13, 14) on the short arm of chromosome 18 close to the ACTH-R gene (14), we delineated the extent of the deletion of the ACTH-R gene. One of the primers was end labeled with [ - 32 P]ATP, and PCR of leukocytic and tumor DNA was performed as described previously (13). PCR and direct sequencing of the ACTH-R gene In all patients informative for the PstI polymorphism, the ACTH-R gene-coding region was amplified using the PCR and directly sequenced by the dideoxy nucleotide chain termination method, using modified T7-DNA polymerase (Sequenase, U.S. Biochemical Corp., Cleveland, OH) in the presence of [ - 35 S]deoxy-ATP, as described previously (8). Northern blot Total or polyadenylated ribonucleic acid (RNA) was isolated from tissue using the guanitidin isocyanate method (Stratagene, Heidelberg, Germany). The RNA integrity was checked by ethidium bromide stain, and degraded RNA samples were excluded. The RNA was directly dot blotted on a nylon membrane. Hybridization was performed using the same probe as that for a Southern blot (15). For standardization, the blots were hybridized with a mouse -actin cdna probe. The steady state
3 3056 REINCKE ET AL. JCE&M 1997 Vol 82 No 9 messenger RNA (mrna) concentrations are expressed as a percentage of that in normal adrenals ( 100%). Autoradiographic images were digitalized with a video camera and a Macintosh PowerMac 7100 computer-based image analysis system (Stemmer, Puchheim, Germany) using the IMAGE program (NIMH, NIH, Bethesda, MD). Results Rate of heterozygosity in normal subjects Fifty-three of the 99 normal subjects (53.5%) were heterozygous for the PstI polymorphism (Fig. 2). Loss of heterozygosity (LOH) in adrenocortical adenomas Of 16 patients with adrenocortical adenomas informative for the PstI polymorphism (15 functional and 1 nonfunctional adenoma), only the patient with a large nonfunctional adenoma demonstrated LOH of the ACTH-R gene in the tumor tissue (Table 1 and Fig. 3). This tumor was incidentally detected by computed tomography and measured 7 cm in maximum diameter. The patient was clinically asymptomatic and had normal serum potassium levels, normal PRA, and normal suppression of serum cortisol by 2 mg dexamethasone. Surgery was suggested because of its size to exclude adrenocortical carcinoma, and the patient underwent adrenalectomy with uneventful recovery. Histopathology showed an oncocytic (0 cell) adrenal adenoma composed of large tumor cells with abundant eosinophilic cytoplasm. The patient has remained in remission, and follow-up studies have been negative for tumor recurrence. LOH in adrenocortical carcinomas Two of four patients with adrenocortical carcinomas had LOH of the ACTH-R gene. Clinical presentation, tumor stage, and disease-free survival of these patients are shown in Table 2. Compared to patients with adrenocortical carcinomas without LOH, patients with LOH of the ACTH-R gene had advanced tumor stages, early recurrence, and/or a more rapid course. Polymorphic microsatelite markers D18S37 and D18S40 All patients were informative for at least one of the microsatelite markers, D18S37 and D18S40. Neither the 3 tumors with LOH of the ACTH-R gene locus nor the 17 tumors without LOH of the ACTH-R gene locus showed LOH using FIG. 2.PstI polymorphism of the ACTH-R gene in six normal subjects. Heterozygote individuals (lanes 1, 4, and 5) are informative for LOH analysis. the D18537 or D18540 markers, demonstrating that the deletion was confined to the ACTH-R gene locus. PCR amplification and sequencing of the ACTH-R gene Using PCR, we amplified the coding region of the ACTH-R gene of DNA from all tumor tissues. Direct sequencing of the PCR products revealed no point mutations or small deletions in the entire ACTH receptor sequence. ACTH-R mrna expression Expression of ACTH-R mrna was analyzed by Northern and dot blot experiments in 17 of the 20 tumor tissues available for RNA extraction. Compared to normal adrenals (100 12%) and adrenocortical tumors without LOH of the ACTH-R gene (102 20%), tumors with LOH showed greatly reduced ACTH-R mrna steady state concentrations (21 4%; Figs. 4 and 5). Discussion camp is a key second messenger involved in hormone hypersecretion and/or increased cell proliferation in a variety of endocrine tissues. Oncogenic transformation by constitutive activation of key regulatory proteins of camp, such as G protein-coupled receptors and GTP-binding proteins, have been implicated in the pathogenesis of such diseases as acromegaly and toxic thyroid adenomas (16, 17). Adrenocortical tumorigenesis differs from pituitary and thyroid tumorigenesis, as activation of the camp/protein kinase A pathway seems to be of little importance in the development of adrenocortical neoplasms. ACTH is the main hormone regulating steroid hormone secretion; however, it fails to cause adrenocortical hypertrophy in the absence of innervation by the splanchnic nerve. ACTH in physiological concentrations does not stimulate cell proliferation of adrenocortical cells in vitro, and even pharmacological doses of ACTH induce only moderate cell growth (9). In keeping with these findings, activating mutations of neither the ACTH receptor nor the -chain of the G s have been identified in benign or malignant adrenocortical tumors (8, 16). On the contrary, activating mutations of the G i2, one of the adenylyl cyclase inhibitory G proteins, were found in very few adrenocortical tumors, but not in a variety of other endocrine and nonendocrine tumors (16, 18). These data suggest that in the adrenal cortex the ACTH/G s /protein kinase A signaling pathway is preferentially important for steroid hormone secretion and, hence, for maintenance of a highly differentiated cellular phenotype, but is of relatively little importance for cellular proliferation. Mutational loss of the ACTH-R gene by deletion, therefore, could result in loss of differentiation, a characteristic feature of human tumorigenesis that is associated with clonal expansion of a malignant cell clone. We herein demonstrate for the first time that allelic loss of a gene for a G protein-coupled receptor, that of the ACTH-R, is present in a subset of adrenocortical tumors, suggesting implications for the pathogenesis of these tumors. Three of 20 tumors in our series showed LOH for a PstI polymorphism in the promoter of the ACTH-R gene, suggesting a deletion within the promoter and/or the ACTH-R gene itself. The
4 DEPLETION OF ACTH-R GENE IN ADRENOCORTICAL TUMORS 3057 FIG. 3. LOH of the ACTH-R gene. Leukocytic (L) and tumor (Tu) DNA were digested, electrophorised, and hybridized, as described in Subjects and Methods. Center and right, Two tumors with LOH at the PstI restriction site. Left, Adrenal adenoma without LOH. FIG. 4. ACTH-R mrna expression in adrenocortical tumors assessed by dot blot. Polyadenylated mrna was hybridized with a 32 P-labeled full-length ACTH-R cdna (top) and a mouse b-actin cdna (bottom). Row 1, Two normal adrenals; row 2, two tumors with LOH at the PstI polymorphism; row 3, tumors without LOH (aldosterone-producing adenomas). specificity of the ACTH-R deletion is supported by the data generated using the microsatelite markers D18S37 and D18S40, located 9.4 and 3.2 centimorgans upstream of the ACTH-R (13, 19), respectively, which did not reveal LOH at these loci. The functional significance of our findings at the transcriptional level is supported by reduced steady state concentrations of ACTH-R mrna found in these tumors compared to those in normal adrenals and adrenocortical tumors without LOH of the ACTH-R gene. One of 16 benign lesions in this study demonstrated LOH of the ACTH-R gene locus. This tumor differed from the other 15 adenomas in size, steroid activity, and histopathology. It was clinically and bio- chemically nonfunctional, in contrast to adenomas without LOH of the ACTH-R, which were all hyperfunctioning aldosterone- or cortisol-producing adenomas. Histopathology demonstrated an oncocytic adenoma. Oncocytic adrenal cortical neoplasms are a rare variant of adrenocortical tumors characterized by large tumor cells with abundant finely granular eosinophilic cytoplasm filled with mitochondria (20, 21). Oncocytic changes can also be found in adrenocortical carcinomas (22), and close postoperative follow-up is required in patients with oncocytic tumors because of their potentially malignant behavior (20). Two of four adrenocortical carcinomas showed LOH of the ACTH-R gene. The patients with carcinomas with LOH had advanced tumor stages, aggressive tumor growth, early recurrence after adrenalectomy, and an unfavorable outcome. This indicates that deletions of the ACTH-R gene in adrenocortical carcinomas are associated with clonal expansion of undifferentiated and/or highly malignant tumor clones. LOH and microsatellite instability are important characteristics of many tumor types. These DNA deletions affect chromosomal areas of known or supposed tumor suppressor genes. Functional inactivation of the other allele of a tumor suppressor gene occurs generally by missense point mutations eliminating all wild-type tumor suppressor activity and enhancing clonal expansion of a malignant cell clone. LOH of the ACTH-R gene at 18p11.2 suggests that the ACTH-R may act as a tumor suppressor gene in adrenocortical tumorigenesis. The clinical features of tumors with LOH in our series (loss of steroidogenesis in the oncocytoma, aggressive growth in adrenal carcinomas) is in accordance with this idea. We were not able to detect inactivating point mutations in the remaining ACTH-R allele. However, this does not necessarily exclude inactivation of the other allele, as mutations outside of the coding region, such as in the ACTH-R promoter, may have been missed by our approach. Evidence for functional inactivation of the ACTH-R by means other than mutations comes from the mouse adrenocortical tumor cell line Y1. In this cell line, ACTH and compounds such as the long-acting camp analog 8-bromo-cAMP stimulate steroidogenesis but inhibit cell proliferation (23). Schimmer et al. (24) reported two mutant subclones, Y6 and OS3, that do not express functional ACTH receptors, in contrast to the ACTH-sensitive parental cell line Y1. The ACTH-R gene transcription in these subclones is completely silenced by mechanisms not involving deletions or altered methylation of the ACTH-R gene. These data show that inactivation of the
5 3058 REINCKE ET AL. JCE&M 1997 Vol 82 No 9 FIG. 5. ACTH-R mrna expression (mean SEM) in normal adrenals, tumors without LOH of the ACTH-R gene, and tumors with LOH. ACTH receptor can also be caused by as yet unidentified transcription factors and cis-acting DNA promoter elements. Alternatively, deletion of one ACTH-R allele could be sufficient for oncogenic transformation, as has been suggested for other tumor suppressor genes. For example, mutations of the p53 tumor suppressor gene located at chromosome 17p affect only one allele in certain tumor types, such as basal cell carcinoma (25) and adrenocortical tumors (26). This can be explained by a dominant negative effect or a gain of function of the mutant p53 protein. In summary, LOH of the ACTH-R gene and low expression of ACTH-R mrna are present in a subset of adrenocortical tumors that were either nonfunctional or highly malignant. These data suggest that deletion of a G-coupled receptor may give tumors a growth advantage. Under physiological circumstances, the ACTH-R-cAMP-protein kinase A signaling cascade maintains a differentiated adrenocortical cell phenotype, whereas proliferation of adrenocortical cells is stimulated mainly by peptides and receptors other than ACTH and its receptor. Partial deletion of the ACTH-R gene could, therefore, result in loss of differentiation and stimulation of a growth path. References 1. Ross NS, Aron DC Hormonal evaluation of the patient with an incidentally discovered adrenal mass. N Engl J Med. 323: Hough AJ, Hollifield JW, Page DL, et al Prognosis factors in adrenocortical tumors. Am J Clin Pathol. 72: Weiss LM Comparative histologic study of 43 metastasing and nonmetastasing adrenocortical tumors. Am J Pathol. 8: Mountjoy KG, Robbins LS, Mortrud MT, Cone RD The cloning of a family of genes that encode the melanocortin receptors. Science. 275: Siegrist W, Eberle AN Melanocortins and their implication in melanoma. Trends Endocrinol Metab. 6: Gantz I, Tashiro T, Barcroft C, et al Localization of the genes encoding the melanocortin-2 (ACTH hormone) and melanocortin-3 receptors to chromosome 18p11.2 and 20.q by fluorecent in situ hybridization. Genomics. 18: Vamvakopoulos NC, Durkin S, Nierman W, Chrousos GP Mapping the human adrenocorticotropin receptor gene to the small arm of chromosome 18 (18p pter). Genomics. 18: Latronico AC, Reincke M, Mendonca BB, et al No evidence for oncogenic mutations in the adrenocorticotropin receptor gene in human adrenocortical neoplasms. J Clin Endocrinol Metab. 80: Estivariz FE, Iturriza F, Mclean C, Hope J, Lowry PJ Stimulation of adrenal mitogenesis by N-terminal proopiomelanocortin. Nature. 297: Reincke M, Mora P, Beuschlein B, Lehmann R, Karl M, Allolio B No evidence for oncogenic mutations in the adrenocorticotropin receptor gene in human adrenocortical neoplasms. Exp Clin Endocrinol. 103(Suppl 1): Baxter JD, Tyrrel JB The adrenal cortex. In: Felig P, Baxter JD, Broadus AE, Frohman LA, eds. Endocrinology and metabolism, 2nd ed. New York: McGraw-Hill; Orth DN, Kovacs WJ, DeBold CR The adrenal cortex. In: Wilson JD, Foster DW, eds. Williams textbook of endocrinology, 8th ed. Philadelphia: Saunders; Berrettini WH, Ferraro TN, Goldin LR, et al Chromosome 18 DNA markers and manic-depressive illness: evidence for a susceptibility gene. Proc Natl Acad Sci USA. 91: Detera-Wadleigh SD, Yoon SW, Berrettini WH, et al ACTH receptor/ melanocortin receptor-2 maps within a reported susceptibility for bipolar illness on chromosome 18. Am J Med Genet. 60: Reincke M, Beuschlein F, Menig G, et al. ACTH receptor mrna expression in adrenocortical tumors: comparison with P450 steroidogenic enzyme expression. Clin Endocrinol (Oxf). 46: Lyons J, Landis CA, Harsh G, et al Two G protein oncogenes in human endocrine tumors. Science. 249: Parma J, Duprez L, Van Sande J, et al Somatic mutations in the thyrotropin receptor gene cause hyperfunctioning thyroid adenomas. Nature. 365: Reincke M, Karl M, Travis W, Chrousos GP No evidence for oncogenic mutations in guanine nucleotide binding proteins of human adrenocortical neoplasms. J Clin Endocrinol Metab. 77: Naville D, Barjhoux L, Jaillard C, Lebrethon MC, Saez JM, Begeot M Characterization of the transcription start site of the ACTH receptor gene: presence of an intronic sequence in the 5 -flanking region. Mol Cell Endocrinol. 106: Erlandson RA, Reuter VE Oncocytic adrenal cortical adenoma. Ultrastruct Pathol. 15: Mitchell A, Scheithauer BW, Sasano H, Hubbard EW, Ebersold MJ Symptomatic intradural adrenal adenoma of the spinal nerve root: report of two cases. Neurosurgery. 32: Mackay B, el-naggar A, Ordonez NG Ultrastructure of adrenal cortical carcinoma. Ultrastruct. Pathol. 18: Schimmer BP, Tsao J, Knapp M Isolation of mutant adrenocortical tumor cells resistant to cyclic nucleotides. Mol Cell Endocrinol. 8: Schimmer BP, Kwan WK, Tsao J, Qiu R Adrenocorticotropin-resistant mutants of the Y1 adrenal cell line fail to express the ACTH receptor. J Cell Physiol. 163: Van der Riet P, Karp D, Farmer E, et al Progression of basal cell carcinoma through loss of chromosome 9q and inactivation of a single p53 allel. Cancer Res. 54: Lin SR, Lee YJ, Tsai JH Mutations of the p53 gene in human functional neoplasms. J Clin Endocrinol Metab. 78:
Clonal evolution of human cancers
Clonal evolution of human cancers -Pathology-based microdissection and genetic analysis precisely demonstrates molecular evolution of neoplastic clones- Hiroaki Fujii, MD Ageo Medical Laboratories, Yashio
More informationACTH-receptor expression, regulation and role in adrenocortical tumor formation
European Journal of Endocrinology (2001) 144 199±206 ISSN 0804-4643 REVIEW ACTH-receptor expression, regulation and role in adrenocortical tumor formation Felix Beuschlein, Martin Fassnacht 1, Albrecht
More informationTumor suppressor genes D R. S H O S S E I N I - A S L
Tumor suppressor genes 1 D R. S H O S S E I N I - A S L What is a Tumor Suppressor Gene? 2 A tumor suppressor gene is a type of cancer gene that is created by loss-of function mutations. In contrast to
More informationMultistep nature of cancer development. Cancer genes
Multistep nature of cancer development Phenotypic progression loss of control over cell growth/death (neoplasm) invasiveness (carcinoma) distal spread (metastatic tumor) Genetic progression multiple genetic
More informationCANCER. Inherited Cancer Syndromes. Affects 25% of US population. Kills 19% of US population (2nd largest killer after heart disease)
CANCER Affects 25% of US population Kills 19% of US population (2nd largest killer after heart disease) NOT one disease but 200-300 different defects Etiologic Factors In Cancer: Relative contributions
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationBIOL2005 WORKSHEET 2008
BIOL2005 WORKSHEET 2008 Answer all 6 questions in the space provided using additional sheets where necessary. Hand your completed answers in to the Biology office by 3 p.m. Friday 8th February. 1. Your
More informationDifferentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell
Differentiation-induced Changes of Mediterranean Fever Gene (MEFV) Expression in HL-60 Cell Wenxin Li Department of Biological Sciences Fordham University Abstract MEFV is a human gene that codes for an
More informationDr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital. NSW Health Pathology University of Sydney
Dr Catherine Woolnough, Hospital Scientist, Chemical Pathology, Royal Prince Alfred Hospital NSW Health Pathology University of Sydney Thyroid Cancer TC incidence rates in NSW Several subtypes - Papillary
More informationDimitrios Linos, M.D., Ph.D. Professor of Surgery National & Kapodistrian University of Athens
Dimitrios Linos, M.D., Ph.D. Professor of Surgery National & Kapodistrian University of Athens What is an adrenal incidentaloma? An adrenal incidentaloma is defined as an adrenal tumor initially diagnosed
More informationnumber Done by Corrected by Doctor Maha Shomaf
number 19 Done by Waseem Abo-Obeida Corrected by Abdullah Zreiqat Doctor Maha Shomaf Carcinogenesis: the molecular basis of cancer. Non-lethal genetic damage lies at the heart of carcinogenesis and leads
More informationIntroduction to Genetics
Introduction to Genetics Table of contents Chromosome DNA Protein synthesis Mutation Genetic disorder Relationship between genes and cancer Genetic testing Technical concern 2 All living organisms consist
More informationNeoplasia 2018 lecture 11. Dr H Awad FRCPath
Neoplasia 2018 lecture 11 Dr H Awad FRCPath Clinical aspects of neoplasia Tumors affect patients by: 1. their location 2. hormonal secretions 3. paraneoplastic syndromes 4. cachexia Tumor location Even
More informationMRC-Holland MLPA. Description version 06; 23 December 2016
SALSA MLPA probemix P417-B2 BAP1 Lot B2-1216. As compared to version B1 (lot B1-0215), two reference probes have been added and two target probes have a minor change in length. The BAP1 (BRCA1 associated
More informationThe Biology and Genetics of Cells and Organisms The Biology of Cancer
The Biology and Genetics of Cells and Organisms The Biology of Cancer Mendel and Genetics How many distinct genes are present in the genomes of mammals? - 21,000 for human. - Genetic information is carried
More informationNeurotrophic factor GDNF and camp suppress glucocorticoid-inducible PNMT expression in a mouse pheochromocytoma model.
161 Neurotrophic factor GDNF and camp suppress glucocorticoid-inducible PNMT expression in a mouse pheochromocytoma model. Marian J. Evinger a, James F. Powers b and Arthur S. Tischler b a. Department
More informationGENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1
GENERAL CHARACTERISTICS OF THE ENDOCRINE SYSTEM FIGURE 17.1 1. The endocrine system consists of glands that secrete chemical signals, called hormones, into the blood. In addition, other organs and cells
More informationMultiple Fibroadenomas Harboring Carcinoma in Situ in a Woman with a Familty History of Breast/ Ovarian Cancer
Multiple Fibroadenomas Harboring Carcinoma in Situ in a Woman with a Familty History of Breast/ Ovarian Cancer A Kuijper SS Preisler-Adams FD Rahusen JJP Gille E van der Wall PJ van Diest J Clin Pathol
More informationSALSA MLPA KIT P060-B2 SMA
SALSA MLPA KIT P6-B2 SMA Lot 111, 511: As compared to the previous version B1 (lot 11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). Please note that, in contrast to the
More informationComputer Science, Biology, and Biomedical Informatics (CoSBBI) Outline. Molecular Biology of Cancer AND. Goals/Expectations. David Boone 7/1/2015
Goals/Expectations Computer Science, Biology, and Biomedical (CoSBBI) We want to excite you about the world of computer science, biology, and biomedical informatics. Experience what it is like to be a
More informationDevelopment of Carcinoma Pathways
The Construction of Genetic Pathway to Colorectal Cancer Moriah Wright, MD Clinical Fellow in Colorectal Surgery Creighton University School of Medicine Management of Colon and Diseases February 23, 2019
More informationReceptors Functions and Signal Transduction- L4- L5
Receptors Functions and Signal Transduction- L4- L5 Faisal I. Mohammed, MD, PhD University of Jordan 1 PKC Phosphorylates many substrates, can activate kinase pathway, gene regulation PLC- signaling pathway
More informationEndocrine System. Chapter 7
Endocrine System Chapter 7 15 Endocrine Endocrine System: System Cont. collection of structures (glands,cells) which secrete hormones directly into the Chapter 7 circulation to affect metabolism, reproduction,
More informationExpression profile of tumor suppressor gene RASSF1 in lacrimal gland carcinoma
Expression profile of tumor suppressor gene RASSF1 in lacrimal gland carcinoma C.H. Zeng, B. Guo, J. Chen, W.M. He and Q.L. Luo Ophthalmology Department of West China Hospital, Sichuan University, Sichuan,
More informationADRENAL INCIDENTALOMA. Jamii St. Julien
ADRENAL INCIDENTALOMA Jamii St. Julien Outline Definition Differential Evaluation Treatment Follow up Questions Case Definition The phenomenon of detecting an otherwise unsuspected adrenal mass on radiologic
More informationoncogenes-and- tumour-suppressor-genes)
Special topics in tumor biochemistry oncogenes-and- tumour-suppressor-genes) Speaker: Prof. Jiunn-Jye Chuu E-Mail: jjchuu@mail.stust.edu.tw Genetic Basis of Cancer Cancer-causing mutations Disease of aging
More informationAdrenocortical Oncocytoma
The Korean Journal of Pathology 2007; 41: 329-33 Adrenocortical Oncocytoma - A Case Report - Hun-Soo Kim Dae-Young Kang 1 Department of Pathology, Wonkwang University School of Medicine, Iksan; 1 Department
More informationTherapeutic Objectives. Cushing s Disease Surgical Results. Cushing s Disease Surgical Results: Macroadenomas 10/24/2015
Therapeutic Objectives Update on the Management of Lewis S. Blevins, Jr., M.D. Correct the syndrome by lowering daily cortisol secretion to normal Eradicate any tumor that might threaten the health of
More informationIndications for Surgical Removal of Adrenal Glands
The adrenal glands are orange-colored endocrine glands which are located on the top of both kidneys. The adrenal glands are triangular shaped and measure about one-half inch in height and 3 inches in length.
More informationMolecular Diagnosis. Nucleic acid based testing in Oncology
Molecular Diagnosis Nucleic acid based testing in Oncology Objectives Describe uses of NAT in Oncology Diagnosis, Prediction, monitoring. Genetics Screening, presymptomatic testing, diagnostic testing,
More informationNucleic Acid Testing - Oncology. Molecular Diagnosis. Gain/Loss of Nucleic Acid. Objectives. MYCN and Neuroblastoma. Molecular Diagnosis
Nucleic Acid Testing - Oncology Molecular Diagnosis Nucleic acid based testing in Oncology Gross alterations in DNA content of tumors (ploidy) Gain/Loss of nucleic acids Markers of Clonality Oncogene/Tumor
More information2015 AP Biology Unit #4 Quiz 1 Cell Communication, Cancer and The Cell Cycle Week of November
Name: Class: Date: 2015 AP Biology Unit #4 Quiz 1 Cell Communication, Cancer and The Cell Cycle Week of 16-20 November Multiple Choice Identify the choice that best completes the statement or answers the
More informationCell Communication. Cell Communication. Communication between cells requires: ligand: the signaling molecule
Cell Communication Cell Communication Communication between cells requires: ligand: the signaling molecule receptor protein: the molecule to which the ligand binds (may be on the plasma membrane or within
More informationThe diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M.
UvA-DARE (Digital Academic Repository) The diagnostic and prognostic value of genetic aberrations in resectable distal bile duct cancer Rijken, A.M. Link to publication Citation for published version (APA):
More informationORIGINAL ARTICLE. Pathologic Features of Prognostic Significance for Adrenocortical Carcinoma After Curative Resection. with adrenocortical carcinoma
ORIGINAL ARTICLE Pathologic Features of Prognostic Significance for Adrenocortical Carcinoma After Curative Resection Lawrence E. Harrison, MD; Paul B. Gaudin, MD; Murray F. Brennan, MD Objective: To identify
More informationGenerating Mouse Models of Pancreatic Cancer
Generating Mouse Models of Pancreatic Cancer Aom Isbell http://www2.massgeneral.org/cancerresourceroom/types/gi/index.asp Spring/Summer 1, 2012 Alexandros Tzatsos, MD PhD Bardeesy Lab: Goals and Objectives
More informationSupplementary Appendix
Supplementary Appendix This appendix has been provided by the authors to give readers additional information about their work. Supplement to: Sherman SI, Wirth LJ, Droz J-P, et al. Motesanib diphosphate
More informationGastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR
Gastric Carcinoma with Lymphoid Stroma: Association with Epstein Virus Genome demonstrated by PCR Pages with reference to book, From 305 To 307 Irshad N. Soomro,Samina Noorali,Syed Abdul Aziz,Suhail Muzaffar,Shahid
More informationBio 111 Study Guide Chapter 17 From Gene to Protein
Bio 111 Study Guide Chapter 17 From Gene to Protein BEFORE CLASS: Reading: Read the introduction on p. 333, skip the beginning of Concept 17.1 from p. 334 to the bottom of the first column on p. 336, and
More informationRole of Paired Box9 (PAX9) (rs ) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis
EC Dental Science Special Issue - 2017 Role of Paired Box9 (PAX9) (rs2073245) and Muscle Segment Homeobox1 (MSX1) (581C>T) Gene Polymorphisms in Tooth Agenesis Research Article Dr. Sonam Sethi 1, Dr. Anmol
More informationCourse Title Form Hours subject
Course Title Form Hours subject Types, and structure of chromosomes L 1 Histology Karyotyping and staining of human chromosomes L 2 Histology Chromosomal anomalies L 2 Histology Sex chromosomes L 1 Histology
More informationDr Rodney Itaki Lecturer Anatomical Pathology Discipline. University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology
Neoplasia Dr Rodney Itaki Lecturer Anatomical Pathology Discipline University of Papua New Guinea School of Medicine & Health Sciences Division of Pathology General Considerations Overview: Neoplasia uncontrolled,
More informationSrc-INACTIVE / Src-INACTIVE
Biology 169 -- Exam 1 February 2003 Answer each question, noting carefully the instructions for each. Repeat- Read the instructions for each question before answering!!! Be as specific as possible in each
More informationInsulin Resistance. Biol 405 Molecular Medicine
Insulin Resistance Biol 405 Molecular Medicine Insulin resistance: a subnormal biological response to insulin. Defects of either insulin secretion or insulin action can cause diabetes mellitus. Insulin-dependent
More informationSupplementary Document
Supplementary Document 1. Supplementary Table legends 2. Supplementary Figure legends 3. Supplementary Tables 4. Supplementary Figures 5. Supplementary References 1. Supplementary Table legends Suppl.
More information11 -Hydroxysteroid dehydrogenase, expression, corticotroph adenomas 68 70
Subject Index Activin activity decrease, gonadotroph 78 pituitary tumorigenesis, role 99 Adenoma, see also specific cell types angiogenesis, see Angiogenesis clonality, see Clonality, pituitary tumors
More informationChapter 11 How Genes Are Controlled
Chapter 11 How Genes Are Controlled PowerPoint Lectures for Biology: Concepts & Connections, Sixth Edition Campbell, Reece, Taylor, Simon, and Dickey Copyright 2009 Pearson Education, Inc. Lecture by Mary
More informationGeneral Principles of Endocrine Physiology
General Principles of Endocrine Physiology By Dr. Isabel S.S. Hwang Department of Physiology Faculty of Medicine University of Hong Kong The major human endocrine glands Endocrine glands and hormones
More informationDOES THE BRCAX GENE EXIST? FUTURE OUTLOOK
CHAPTER 6 DOES THE BRCAX GENE EXIST? FUTURE OUTLOOK Genetic research aimed at the identification of new breast cancer susceptibility genes is at an interesting crossroad. On the one hand, the existence
More informationMRC-Holland MLPA. Description version 19;
SALSA MLPA probemix P6-B2 SMA Lot B2-712, B2-312, B2-111, B2-511: As compared to the previous version B1 (lot B1-11), the 88 and 96 nt DNA Denaturation control fragments have been replaced (QDX2). SPINAL
More informationSALSA MLPA probemix P315-B1 EGFR
SALSA MLPA probemix P315-B1 EGFR Lot B1-0215 and B1-0112. As compared to the previous A1 version (lot 0208), two mutation-specific probes for the EGFR mutations L858R and T709M as well as one additional
More informationmirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
More informationSupplemental Data: Detailed Characteristics of Patients with MKRN3. Patient 1 was born after an uneventful pregnancy. She presented in our
1 2 Supplemental Data: Detailed Characteristics of Patients with MKRN3 Mutations 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Patient 1 was born after an uneventful pregnancy. She presented
More informationTHE HIGHS AND LOWS OF ADRENAL GLAND PATHOLOGY
THE HIGHS AND LOWS OF ADRENAL GLAND PATHOLOGY Symptoms of Adrenal Gland Disorders 2 Depends on whether it is making too much or too little hormone And on what you Google! Symptoms include obesity, skin
More informationMalignant lymphomas are neoplasms that arise from B
Overview of the Role of Molecular Methods in the Diagnosis of Malignant Lymphomas L. Jeffrey Medeiros, MD; Jeanne Carr, PhD Objective. To review the role of molecular genetics in the diagnosis of malignant
More informationSupplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the
Supplementary Figure 1. Spitzoid Melanoma with PPFIBP1-MET fusion. (a) Histopathology (4x) shows a domed papule with melanocytes extending into the deep dermis. (b) The melanocytes demonstrate abundant
More informationof TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed.
Supplementary Note The potential association and implications of HBV integration at known and putative cancer genes of TERT, MLL4, CCNE1, SENP5, and ROCK1 on tumor development were discussed. Human telomerase
More informationBiochemistry of Cancer and Tumor Markers
Biochemistry of Cancer and Tumor Markers The term cancer applies to a group of diseases in which cells grow abnormally and form a malignant tumor. It is a long term multistage genetic process. The first
More informationEndocrine Notes Mrs. Laux AP Biology I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones
I. Endocrine System consists of endocrine glands (ductless), cells, tissues secrete hormones regulates metabolism, fluid balance, growth, reproduction A. Hormones 1. chemical signals-cell to cell communication
More informationCase Based Urology Learning Program
Case Based Urology Learning Program Resident s Corner: UROLOGY Case Number 4 CBULP 2010 004 Case Based Urology Learning Program Editor: Associate Editors: Manager: Case Contributors: Steven C. Campbell,
More informationMonday, 7 th of July 2008 ( ) University of Buea MED30. (GENERAL ENDOCRINOLOGY) Exam ( )
.. Monday, 7 th of July 2008 (8 30-11. 30 ) Faculty of Health Sciences University of Buea MED30 304 Programme in Medicine (GENERAL ENDOCRINOLOGY) Exam (2007-2008).. Multiple Choice Identify the letter
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationCell Signaling part 2
15 Cell Signaling part 2 Functions of Cell Surface Receptors Other cell surface receptors are directly linked to intracellular enzymes. The largest family of these is the receptor protein tyrosine kinases,
More informationSupporting Information
Supporting Information Franco et al. 10.1073/pnas.1015557108 SI Materials and Methods Drug Administration. PD352901 was dissolved in 0.5% (wt/vol) hydroxyl-propyl-methylcellulose, 0.2% (vol/vol) Tween
More informationEvaluation of Thyroid Nodules
Evaluation of Thyroid Nodules Stephan Kowalyk, MD January 25 28, 2018 1 Primary goal Exclude malignancy Incidental thyroid nodules If found on CT, MRI, PET scan, carotid Doppler ULTRASOUND!! January 25
More information2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November
Class: Date: 2015 AP Biology Unit #4 Test Cell Communication, Cancer, Heredity and The Cell Cycle Week of 30 November Multiple Choice 1 point each Identify the choice that best completes the statement
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More informationChapter 2 Gene and Promoter Structures of the Dopamine Receptors
Chapter 2 Gene and Promoter Structures of the Dopamine Receptors Ursula M. D Souza Abstract The dopamine receptors have been classified into two groups, the D 1 - like and D 2 -like dopamine receptors,
More informationStudying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy
Kavya Puchhalapalli CALS Honors Project Report Spring 2017 Studying The Role Of DNA Mismatch Repair In Brain Cancer Malignancy Abstract Malignant brain tumors including medulloblastomas and primitive neuroectodermal
More informationTITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer
AD Award Number: W81XWH-04-1-0325 TITLE: A Mouse Model to Investigate the Role of DBC2 in Breast Cancer PRINCIPAL INVESTIGATOR: Valerie Boka CONTRACTING ORGANIZATION: University of Texas Health Science
More informationGeneral Biology 1004 Chapter 11 Lecture Handout, Summer 2005 Dr. Frisby
Slide 1 CHAPTER 11 Gene Regulation PowerPoint Lecture Slides for Essential Biology, Second Edition & Essential Biology with Physiology Presentation prepared by Chris C. Romero Neil Campbell, Jane Reece,
More informationCellular Signaling Pathways. Signaling Overview
Cellular Signaling Pathways Signaling Overview Signaling steps Synthesis and release of signaling molecules (ligands) by the signaling cell. Transport of the signal to the target cell Detection of the
More informationPersonalized Medicine: Lung Biopsy and Tumor
Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Elizabeth H. Moore, MD Personalized Medicine: Lung Biopsy and Tumor Mutation Testing Genomic testing has resulted in a paradigm shift in the
More informationMolecular and genetic analysis of stromal fibroblasts in prostate cancer
Final report ESMO Translational Research Fellowship 2010-2011 Molecular and genetic analysis of stromal fibroblasts in prostate cancer Michalis Karamouzis Host Institute Department of Biological Chemistry,
More informationACTH 1-24 inhibits proliferation of adrenocortical tumors in vivo
European Journal of Endocrinology (2005) 153 435 444 ISSN 0804-4643 EXPERIMENTAL STUDY ACTH 1-24 inhibits proliferation of adrenocortical tumors in vivo Oliver Zwermann, Dominik M Schulte 1, Martin Reincke
More informationThe Management of adrenal incidentaloma
The Management of adrenal incidentaloma Dimitrios Linos, MD Director of Surgery, Hygeia Hospital, Athens, Greece Consultant in Surgery, Massachusetts General Hospital, Boston, USA 8 th Postgraduate Course
More informationNormal thyroid tissue
Thyroid Pathology Overview Normal thyroid tissue Normal thyroid tissue with follicles filled with colloid. Thyroid cells form follicles, spheres of epithelial cells (always single layered in health, usually
More informationGenome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet
Genome 371, Autumn 2018 Quiz Section 9: Genetics of Cancer Worksheet All cancer is due to genetic mutations. However, in cancer that clusters in families (familial cancer) at least one of these mutations
More informationProposal form for the evaluation of a genetic test for NHS Service Gene Dossier
Proposal form for the evaluation of a genetic test for NHS Service Gene Dossier Test Disease Population Triad Disease name Genetic Causes of Hypothyroidism 1. Loss of function mutations in TSHR cause thyroid
More informationRAS Genes. The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes.
۱ RAS Genes The ras superfamily of genes encodes small GTP binding proteins that are responsible for the regulation of many cellular processes. Oncogenic ras genes in human cells include H ras, N ras,
More informationBIO360 Fall 2013 Quiz 1
BIO360 Fall 2013 Quiz 1 1. Examine the diagram below. There are two homologous copies of chromosome one and the allele of YFG carried on the light gray chromosome has undergone a loss-of-function mutation.
More informationAgro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17
Agro/Ansc/Bio/Gene/Hort 305 Fall, 2017 MEDICAL GENETICS AND CANCER Chpt 24, Genetics by Brooker (lecture outline) #17 INTRODUCTION - Our genes underlie every aspect of human health, both in function and
More informationAnatomic Molecular Pathology: An Emerging Field
Anatomic Molecular Pathology: An Emerging Field Antonia R. Sepulveda M.D., Ph.D. University of Pennsylvania asepu@mail.med.upenn.edu 2008 ASIP Annual Meeting Anatomic pathology (U.S.) is a medical specialty
More informationT4-BINDING globulin (TBG) is a 54-kDa glycoprotein
0021-972X/98/$03.00/0 Vol. 83, No. 10 Journal of Clinical Endocrinology and Metabolism Printed in U.S.A. Copyright 1998 by The Endocrine Society Complete Thyroxine-Binding Globulin (TBG) Deficiency Produced
More informationCancer genetics
Cancer genetics General information about tumorogenesis. Cancer induced by viruses. The role of somatic mutations in cancer production. Oncogenes and Tumor Suppressor Genes (TSG). Hereditary cancer. 1
More informationCell Communication. Local and Long Distance Signaling
Cell Communication Cell to cell communication is essential for multicellular organisms Some universal mechanisms of cellular regulation providing more evidence for the evolutionary relatedness of all life
More informationIntroduction to Cancer Biology
Introduction to Cancer Biology Robin Hesketh Multiple choice questions (choose the one correct answer from the five choices) Which ONE of the following is a tumour suppressor? a. AKT b. APC c. BCL2 d.
More informationc Tuj1(-) apoptotic live 1 DIV 2 DIV 1 DIV 2 DIV Tuj1(+) Tuj1/GFP/DAPI Tuj1 DAPI GFP
Supplementary Figure 1 Establishment of the gain- and loss-of-function experiments and cell survival assays. a Relative expression of mature mir-484 30 20 10 0 **** **** NCP mir- 484P NCP mir- 484P b Relative
More informationSupporting Online Material for
www.sciencemag.org/cgi/content/full/1171320/dc1 Supporting Online Material for A Frazzled/DCC-Dependent Transcriptional Switch Regulates Midline Axon Guidance Long Yang, David S. Garbe, Greg J. Bashaw*
More informationHST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007
MIT OpenCourseWare http://ocw.mit.edu HST.161 Molecular Biology and Genetics in Modern Medicine Fall 2007 For information about citing these materials or our Terms of Use, visit: http://ocw.mit.edu/terms.
More informationApproach to Adrenal Incidentaloma. Alice Y.Y. Cheng, MD, FRCP
Approach to Adrenal Incidentaloma Alice Y.Y. Cheng, MD, FRCP Copyright 2017 by Sea Courses Inc. All rights reserved. No part of this document may be reproduced, copied, stored, or transmitted in any form
More informationIl Carcinoma Surrenalico
Il Carcinoma Surrenalico Massimo Terzolo Medicina Interna I AOU San Luigi Orbassano (TO) Italy AGENDA DIAGNOSIS CLINICAL PRESENTATION IMPACT ON PROGNOSIS TREATMENT DIAGNOSIS 23-yr-old lady October 2010,
More informationProblem Set 5 KEY
2006 7.012 Problem Set 5 KEY ** Due before 5 PM on THURSDAY, November 9, 2006. ** Turn answers in to the box outside of 68-120. PLEASE WRITE YOUR ANSWERS ON THIS PRINTOUT. 1. You are studying the development
More informationMolecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression
Molecular Cell Biology - Problem Drill 19: Cell Signaling Pathways and Gene Expression Question No. 1 of 10 1. Which statement about cell signaling is correct? Question #1 (A) Cell signaling involves receiving
More informationTITLE: The Role of hcdc4 as a Tumor Suppressor Gene in Genomic Instability Underlying Prostate Cancer
AD Award Number: TITLE: The Role of hcdc4 as a Tumor Suppressor Gene in Genomic Instability Underlying Prostate Cancer PRINCIPAL INVESTIGATOR: Audrey van Drogen, Ph.D. CONTRACTING ORGANIZATION: Sidney
More informationIntroduction. Cancer Biology. Tumor-suppressor genes. Proto-oncogenes. DNA stability genes. Mechanisms of carcinogenesis.
Cancer Biology Chapter 18 Eric J. Hall., Amato Giaccia, Radiobiology for the Radiologist Introduction Tissue homeostasis depends on the regulated cell division and self-elimination (programmed cell death)
More informationLecture 15. Signal Transduction Pathways - Introduction
Lecture 15 Signal Transduction Pathways - Introduction So far.. Regulation of mrna synthesis Regulation of rrna synthesis Regulation of trna & 5S rrna synthesis Regulation of gene expression by signals
More informationThe lymphoma-associated NPM-ALK oncogene elicits a p16ink4a/prb-dependent tumor-suppressive pathway. Blood Jun 16;117(24):
DNA Sequencing Publications Standard Sequencing 1 Carro MS et al. DEK Expression is controlled by E2F and deregulated in diverse tumor types. Cell Cycle. 2006 Jun;5(11) 2 Lassandro L et al. The DNA sequence
More informationCancer. The fundamental defect is. unregulated cell division. Properties of Cancerous Cells. Causes of Cancer. Altered growth and proliferation
Cancer The fundamental defect is unregulated cell division. Properties of Cancerous Cells Altered growth and proliferation Loss of growth factor dependence Loss of contact inhibition Immortalization Alterated
More information