(polymerase chain reaction,pcr)

Transcription

1 Journal of Microbes and Infection September 2008 Vol 3 No ( HBV) (HCV) DNA RNA (PCR) HBV HCV DNA Klenow ( DNA) ( RNA) BLAST HBV HCV / ml 15 % / ml PCR ; ; Establishment of a random PCR method for detecting unknown virus SHI Bi2sheng 3 ZHANG Xiao2nan 3 GU Shi2min TIAN Di YUAN Zheng2hong HU Yun2wen ( Shanghai Public Health Clinical Center Affiliated to Fudan University Shanghai China) 3 : Contributed equally to this work. Abstract Objective To establish a molecular biology method for detecting sequences of unknown viruses.methods The hepatitis B and hepatitis C viruses were used as hypothetically unrecognized DNA RNA viruses respectively to test the efficacy of this random PCR2 based method. Virus2containing serum was first filtered through a m disk filter followed by DNase I treatment to eliminate the host genomic DNA. After the 26mer 5end anchored random primer was annealed to the extracted nucleic acids either by Klenow polymerase extension (DNA as template) or by reverse transcription ( RNA as template) the virus genomes were randomly amplified with the 20mer anchor primer. Purified PCR products were cloned sequenced and subjected to BLAST search for further analysis. Results HBV and HCV genomes were amplified by random PCR and their fragments could be detected in the picked clones. The detective rate was about 15 % at copies/ ml viral load. Positive clones could still be obtained with as few as copies/ ml viral load. Conclusion This culture2 independent random PCR2based method can be used to investigate unknown viruses and will be useful for the early diagnosis of emerging infectious disease. Key words Unknown virus ; Molecular diagnosis ; Random polymerase chain reaction cdna ( severe acute respiratory syndrome SARS) analysis RDA) [428 ] cdna ; RDA [9 ] ; [10 ] [1 2 ] [3 ] : ( : KSF0058) ; ( :2007Y45) : ; : E2mail : com ( representational difference DNA RNA (polymerase chain reaction PCR)

2 Journal of Microbes and Infection September 2008 Vol 3 No ( hepatitis B virus ) HBV > 500 bp HBV) (hepatitis C virus HCV) HCV p GEM2T ( Promega p GEM2T Easy PCR ( ) TOP10F PCR ) / ml 2 l PCR m 25 l PCR : (Millipore ) 918 l 2 Taq PCR Master Mix 1215 l ( TianGen 100 l 200 l ) K2S (20 mol/ L) 017 l 2 l 200 u DNase ( Sigma ) 37 2 h PCR DNase DNA PCR 1 % PCR 31 DNA Klenow ( National (Qiagen QIAamp DNA Blood Mini Center for Biotechnology Information NCBI) Kit) HBV DNA BLAST Klenow : 10 mmol/ L HBV HBV dntp 1 l 5 NEB 5 l K2r2S ( bp) (20mol/ L 1) 1 l Klenow (New England Biolabs ) 215 u 94 2 min HBV DNA 2015 l 37 1 h min 41 RNA Trizol ( Invitrogen ) HCV RNA ( ) 20 l DEPC RNA SuperScript TM ( Invitrogen ) cdna : 011 mmol/ L DTT 4 l RNA HPRI 40 u ( TaKaRa ) 10 mmol/ L dntp 2 l K2r2S(20mol/ L) 2 l 5 FS 8 l DNase 10 u ( TaKaRa ) min min SuperScript 100 u HPRI 40 u :25 10 min 42 1 h min 51 PCR Klenow DNA cdna 3 l K2S 11 PCR DNA ( 1) PCR 50 l (HBV) ( K2r2S ) : 3815 l 10 Ex2Taq DNA Klenow 5 l K2S(20mol/ L) 115 l 10 mmol/ L dntp 115 l DNA Ex2Taq 015 l (215 u) 3 l :94 ( K2S ) PCR 5 min 94 1 min 65 3 min 40 Mr 68 5 min 61 PCR 115 % ( Mr) Marker PCR (TianGen Primer name Anchored random primer K2r2S Anchored primer K2S HBV primer (sense) HBV primer (antisense) 1 Tab 11 Primers used Primer sequence GACCATCTAGCGACCTCCAC NNNNNN GACCATCTAGCGACCTCCAC GTGCCTTGGGTGGCTTTA AGTGCGAATCCACACTCC Sequence location / /

3 Journal of Microbes and Infection September 2008 Vol 3 No. 3 RNA (HCV) DNA (cdna) PCR bp (1) clones from No11 to No122 1 HBV HCV Fig 1. Agarose gel electrophoresis analysis of random PCR amplification of HBV and HCV after gel extraction M: Marker ; 1 : HBV ; 2 : HCV ; 3 : negative control 2 PCR HBV Fig 2. Detection of HBV fragment2positive clones by random PCR Electrophoresis of PCR amplification of inserted HBV fragments in 22 picked clones ( total 128 clones) was shown1 The bands indicate inserted HBV fragment1 A : PCR amplification of certain fragments of HBV genome in the picked clones using K2S primer1 B :PCR amplification of certain fragments of HBV genome in the picked clones using HBV2specific primer1 Lanes from left to right : Marker positive control negative control and the picked 21 p GEM2T2Easy 3 PCR HCV K2S (2A) Fig 3. Detection of HCV fragment2positive clones bp by random PCR 128 HBV Electrophoresis of PCR amplification of inserted HCV fragments in 22 (2B) HBV PCR HBV ( HBV ) HBV HBV DNase 13 > 10 % BLAST DNase HBV 31 PCR 22 K2S PCR BLAST 2 HCV 20 % HBV ( / ml) (3) picked clones was shown1 PCR amplification of inserted fragments of HCV genome in 22 picked clones by using K2S primer showed that all the picked clones were inserted HCV fragments 1Lanes from left to right : Marker positive control negative control and the picked clones from No11 to No / ml / ml / ml

4 Journal of Microbes and Infection September 2008 Vol 3 No / ml 4 HBV / ml 48 HBV 1 HBV PCR [ ] cdna RDA PCR PCR Allander [3 ] ( human bocavirus HBoV) [11 ] Goebel [12 ] PCR DNA PCR BLAST cdna RDA PCR DNA RNA [17 ] / ml HBV Stang [13 ] 90 % ;Gaynor [14 ] 11 Ecker DJ Sampath R Blyn LB et al1 Rapid identification and strain2typing of respiratory pathogens for epidemic surveillance1 Proc Natl Acad Sci USA : PCR 21 Briese T Palacios G Kokoris M et al1 Diagnostic system for rapid and sensitive differential detection of pathogens1 Emerg Infect Dis : ( 146 )

5 Journal of Microbes and Infection September 2008 Vol 3 No. 3 E 2HCV A B HBsAg C F EIA [2 ] 2 EIA : : : : Shang GSeed CR Wang F et al1 Residual risk of transfusion2 transmitted viral infections in Shenzhen China 2001 through Transfusion : Centers for Disease Control and Prevention1 Recommendations for prevention and control of hepatitis C virus ( HCV) infection and HCV2related chronic disease1 MMWR Recomm Rep (RR219) : Alter MJ Kuhnert WL Finelli L et al1 Guidelines for laboratory testing and result reporting of antibody to hepatitis C virus1 MMWR Recomm Rep (RR23) :113 ( : ) (137 ) 31 Allander T Tammi MT Eriksson M et al1 Cloning of a human parvovirus by molecular screening of respiratory tract samples1 Proc Natl Acad Sci USA : Choo Q L Kuo G Weiner A J et al1 Isolation of a cdna clone derived from a blood2borne non2a non2b viral hepatitis genome1 Science : Linnen J Wages J Zhang2Keck ZY et al1 Molecular cloning and disease association of hepatitis G virus : a transfusion2 transmissible agent1 Science : Simons JN Leary TP Dawson GJ et al1 Isolation of novel virus2like sequences associated with human hepatitis1 Nature Med : Nishizawa T Okamoto H Konishi K et al1 A novel DNA virus ( TTV) associated with elevated transaminase levels in posttransfusion hepatitis of unknown etiology1 Biochem Biophys Res Commun : Nichol ST Spiropoulou CF Morzunov S et al1 Genetic identification of a hantavirus associated with an outbreak of acute respiratory illness1 Science : Allander T Emerson SU Engle RE et al1 A virus discovery method incorporating DNase treatment and its application to the identification of two bovine parvovirus species1 Proc Natl Acad Sci USA : Breitbart M Rohwer F1 Method for discovering novel DNA viral in blood using particle selection and shotgun sequencing1 Biotechniques : Allander T Andreasson K Gupta S et al1 Identification of a third human polyomavirus1 J Virol : Goebel SJ Taylor J Barr BC et al1 Isolation of avian paramyxovirus 1 from a patient with a lethal case of pneumonia1 J Virol : Stang A Korn K Wildner O et al1 Characterization of virus isolates by particle2associated nucleic acid PCR1 J Clin Microbiol : Gaynor AM Nissen MD Whiley DM et al1 Identification of a novel polyomavirus from patients with acute respiratory tract infections1 PLoS Pathog :e Wang D Urisman A Liu YT et al1 Viral discovery and sequence recovery using DNA microarrays1 PLoS Biol : Palacios G Quan PL Jabado OJ et al1 Panmicrobial oligonucleotide array for diagnosis of infectious diseases1 Emerg Infect Dis : Ambrose HE Clewley J P1 Virus discovery by sequence2 independent genome amplification1 Rev Med Virol : ( : )