SUPPLEMENTARY INFORMATION

Size: px

Start display at page:

Download "SUPPLEMENTARY INFORMATION"

Roderick Hunter
5 years ago
Views:

1 Supplementary Methods Primary screen in Drosophila cells. Five microliters of dsrna (40 ng/µl) was added to each well of 384-well plates, after which DL1 cells in 10 microliters of SD medium was added to each well and incubated with the dsrna at 28 C for 60 min. Twenty microliters of SD medium containing 20% FBS were then added to each well after the incubation. Cells were treated with dsrna for 2 days at 28 C and then inoculated with an amount of FVG-R virus corresponding to a multiplicity of infection (moi) of 10 for MDCK cells, and transferred to 33 C. At 1 day postinfection, Renilla luciferase activity was measured using a commercial assay system (Promega, Madison). Two independent tests of the entire library were performed (Supplementary Fig. S8) and the correlation of luciferase z scores (standard deviations from the mean) between the two replicates for all wells is shown in Supplementary Fig. S9. Secondary analysis in Drosophila cells. 176 genes were selected for secondary analysis by requiring that their dsrnas inhibit FVG-R-directed luciferase expression in both replicates, with the inhibition exceeding 2.5 standard deviations from the mean in at least one replicate. For each of these genes, an alternate dsrna amplicon lacking predicted off-target effects was selected based on the Harvard Drosophila RNAi Screening Center database ( The corresponding DNA fragments were PCR amplified from Drosophila genomic DNA using Ex Taq polymerase (Takara Bio 1

2 USA, Madison) and amplicon-specific primer pairs extended at their 5' ends with the T7 promoter sequence GAATTAATACGACTCACTATAGGGAGA. The resulting DNAs were in vitro transcribed with MEGAscript T7 kits (Ambion, Foster City) to produce gene-specific dsrnas, which were tested for effects on FVG-R-directed Renilla luciferase expression in multiple independent 384-well plate experiments under the same conditions used for the primary dsrna library analysis. One-sided Student t-tests were applied to the replicated secondary screen data (log fold changes in Renilla luciferase values relative to controls) to identify genes that significantly affected luciferase values. To correct for multiple hypothesis testing, the gene-specific p-values were adjusted by the Benjamini-Hochberg false-discovery-rate method 1, 2, and were considered significant at a false discovery rate of < 5% (q < 0.05). Repeated secondary testing of the alternate amplicons under these conditions confirmed 110 genes whose dsrna inhibited luciferase expression from infecting FVG-R (Supplementary Tables S2 and S3). Equivalent secondary tests were performed for 123 genes whose dsrnas increased FVG-R-directed luciferase expression in both primary screen replicates, with an increase of >3 standard deviations from the mean in one or both replicates. Of these, only 2 genes passed the criterion of q < 0.05 for confirming the stimulatory effects of their dsrnas on FVG-R luciferase expression (Supplementary Table S4). These include a putative member of the peptidyl-prolyl cis-trans isomerases, a class of chaperones modulated by immunosuppressors and implicated in replication of HIV and hepatitis C virus 3, 4, and a protein with similarity to coronavirus RNA-dependent RNA polymerase 5. Even under the significantly more relaxed criterion of p < 0.05, only 11 genes passed (Supplementary 2

3 Table S4). This lower validation rate implies that this class of primary screen candidates contained a higher rate of off-target effects or other false positives than the candidates with reduced FVG-R luciferase expression. In parallel to the secondary analysis of effects on influenza virus derivative FVG-R, the effects of all tested dsrnas on cell viability were determined by CellTiter-Glo ATP assays (Promega, Madison), as shown in Supplementary Tables S3 and S4. Of the dsrnas with confirmed effects on influenza virus replication, three (against genes CG5844, CG8392, and Rab10; Supplementary Table S3) reduced cell viability below the threshold of z-score -3 that was used to identify genes for further study in a prior genome-wide analysis of Drosophila cell viability 6. To provide a further independent test for significant reduction in viability, we applied Efron's local (i.e., gene-specific) false discovery rate procedure utilizing the empirical null 7. At a false discovery rate of 5% (corresponding to a z-score cutoff of -2.7), this approach identified as outliers the same three genes plus a fourth, Tbp1 (Supplementary Table S3). Even increasing the stringency to a false discovery rate of 10% (z-score cutoff of -2.5) excluded only two more genes, RpS15A and RpS8. All six genes were eliminated from further consideration. Approximately one third of all genes confirmed to decrease or increase FVG-R-directed luciferase expression have not previously been associated with a phenotype in other published genome-wide analyses in Drosophila cells (Supplementary Tables S3 and S4). Knockdown of the remaining genes has been linked to effects on one or more functional 3

4 assays (see cross-references in Supplementary Tables S3 and S4), which may provide further insight into their functional involvement in influenza virus replication and/or gene expression. Effect of sirnas against selected genes on the replication of influenza virus in mammalian cells. To examine the effect of sirnas against ATP6V0D1 and COX6A1 on the replication of influenza virus in mammalian cells, sirna-treated 293 cells were infected with WSN or H5N1 Indonesia 7 at an moi of VSV and vaccinia viruses were used as controls. Progeny viruses were collected from the medium (WSN, Indonesia 7, and VSV) and cells (vaccinia virus) at 24 h (Indonesia 7, VSV or vaccinia virus) or 48 h (WSN) postinfection and titrated by use of a standard plaque assay (Fig. 3A). We also infected 293 cells, which had been treated with sirna against NXF1, with Indonesia 7, VSV, or vaccinia virus at an moi of 1. Progeny viruses were harvested at 12 h postinfection for virus titration (Fig. 3B). The absolute virus titers of progeny viruses produced from cells treated with non-targeting sirna (100% value) were (WSN), (Indonesia 7), (VSV), and (vaccinia virus) PFU/ml (Fig. 3A), and (Indonesia 7), (VSV), and (vaccinia virus) PFU/ml (Fig. 3B). As shown in Fig. 3, depleting ATP6V0D1, COX6A1 and NXF1 did not affect VSV or vaccinia virus replication, but decreased the influenza virus yields significantly. Thus, ATP6V0D1, COX6A1 and NXF1 are required for replication of influenza viruses but not VSV or vaccinia virus. 4

5 Supplementary Discussion The Drosophila RNAi screen allowed us to identify more than 100 host genes which are important for influenza A virus replication. Of them, we have shown that three candidate genes, ATP6V0D1, COX6A1, and NXF1, have roles in the influenza viral life cycle in mammalian cells. ATP6V0D1 is a cytoplasmically exposed accessory subunit of the integral membrane V0 complex of V-ATPases, which function independently in both acidification and fusion of cellular compartments 8. In receptor-mediated endocytosis, vacuolar acidification by V-ATPase is important for ligand-receptor dissociation and movement of ligands from endosomes to lysosomes. Remarkably, although endosomal acidification is important for entry by influenza virus, VSV, and vaccinia virus 9, 10, silencing ATP6V0D1 disables the replication of influenza virus, but not VSV or vaccinia virus (Fig. 3A). Accordingly, ATP6V0D1 depletion may interfere with influenza virus not simply by blocking acidification by V-ATPase complexes. Rather, it may play a more specific role in influenza virus replication, such as affecting the ability of influenza virus to selectively trigger endosomal acidification in the perinuclear region 11. The striking association of ATP6V0D1 depletion with influenza virus entry merits further study. NXF1 is an exporter of cellular spliced mrnas that rarely exports cellular nonspliced mrnas 12. However, several viruses exploit the NXF1-pathway for exporting nonspliced viral RNAs in a virus-specific manner 13. Recent results show that influenza virus nonstructural protein 1 (NS1) binds to NXF1 to inhibit the export of host mrna 14, although no role of NXF1 in viral mrna export was demonstrated. Moreover, although 5

6 export of progeny genomic vrnps is mediated by cellular export factor CRM1 through influenza virus nucleoprotein (NP) interaction with the viral NS2 protein 15, NP binding to viral RNA during replication is stimulated in vitro by NP interaction with splicing factor BAT1/UAP56 16, which is thought to form a bridge between spliced mrna and a mrna export complex consisting of NXF1, NXF1 cofactor NXT1, and RNA binding protein REF/Aly 12. Thus, the NXF1-mediated RNA export pathway may be exploited in multiple ways by influenza virus via interactions between viral and NXF1-related proteins. The results presented here indicate that NXF1 function(s) is dispensable for VSV, vaccinia virus, and adenovirus infection, but crucial for influenza virus trafficking, gene expression, or both. 6

7 Supplementary Figure legends Supplementary Figure 1. Expression of α2,6-sialic acid linkage on MDCK, but not D-Mel2, cells. Human influenza viruses initiate infection by binding to receptors, oligosaccharides possessing sialic acid linked to galactose by α2,6 linkages (SAα2,6Gal) 17. To examine the surface expression of SAα2,6Gal on Drosophila D-Mel2 cells, cells were fixed with 1% formaldehyde (in PBS) for 1 h. For detection of sialyloligosaccharides reactive with SAα2,6Gal (sialic acid linked to galactose by an α2,6 linkage)-specific lectin, the fixed cells were incubated with FITC-labeled Sambucus nigra lectin (Vector Laboratories, Burlingame, CA) overnight at 4 C. After three washes with Tris-buffered saline (ph 7.6), the cells were observed by fluorescence microscopy. Although the expression of α2,6- sialyltransferase has been reported in the central nervous system cells of Drosophila 18, we detected SAα2,6Gal on the surface of MDCK (left), but not on Drosophila D-Mel2 (right), cells. Supplementary Figure 2. Properties of a recombinant influenza virus expressing VSV-G and a GFP reporter gene (FVG-G virus). GFP expression by D-Mel2 cells infected with FVG-G. Cells were infected or mock infected with FVG-G for 24 h and then observed by fluorescence microscopy. Supplementary Figure 3. Level of viral RNAs in FVG-R-infected DL-1 or MDCK cells. Real-time PCR was performed to measure levels of mrna, crna, and vrna transcripts 7

8 of influenza virus NP in DL-1 cells (A) and MDCK cells (B) infected with FVG-R as follows: of DL-1 cells and of MDCK cells were infected with FVG-R at an MOI of 1. Cells were collected at 3 and 18 h postinfection, after which total RNA was isolated for reverse transcription (RT). RT assay was performed with a High-Capacity cdna archive kit (Applied Biosystems, foster city, CA 94404). RT primers for the mrna, crna and vrna of influenza virus NP are: TTTTTTTTTTTTTTTTTTT, ATATCGTCTCGTATTAGTAGAAACAAGGGTATT, CTTGT TCGCACAGGAATGGA, respectively. Real-time PCR was then performed with the TaqMan 2 universal PCR master mix (Applied Biosystems), with primer set CTTGTTCGCACAGGAATGGA, CGGCCCCAGACCTCCTA and probe ACCCTGCATCA GTGAGCACATCCTGG labeled with FAM and TAMRA (IDT, Coralville, IA). RT and real-time PCR were done according to protocols provided by the supplier. Results showed that the level of negative-stand viral genomic RNA and its fulllength positive-strand replicative intermediate, crna, increased 25- to 40-fold between 3 and 18 h postinfection, demonstrating that influenza virus RNA replication also occurs in Drosophila cells, although with relatively low efficiency compared to that in mammalian cells. Supplementary Figure 4. Lack of detectable influenza virus spliced mrnas for NS2 and M2 in Drosophila cells. Two spliced viral mrnas encoding M2 and NS2 proteins, which are required for virion assembly and infectivity, are transcribed from M and NS vrna segments 7 and 8. Schematic representation of the NS gene (solid bar) and its translation products, NS1 8

9 (orange box) and NS2 (blue box) are shown (A). To determine if both unspliced and spliced mrnas are transcribed from M and NS vrnas in Drosophila cells, mrnas were extracted from virus-infected D-Mel2 or MDCK cells by use of RNeasy (Qiagen) at 24 hours postinfection with FVG-G. RT-PCR was conducted with ThermoScript (Invitrogen) and primers specific for the detection of both M1 and the spliced M2 mrnas (B), or primers specific for only NS1 and for spliced NS2 mrnas (C). We detected both unspliced M1 and spliced M2 mrnas (B) and unspliced NS1 and spliced NS2 (C) in MDCK cells. In contrast, the Drosophila cells failed to produce the two spliced viral mrnas (B and C) and their encoded proteins NS2 and M2 (data not shown). Supplementary Figure 5. Effect of sirnas against the candidate genes on cell viability in FVG-R-infected 293 cells. Cell viabilities were measured by CellTiter-Glo (Promega) under conditions similar to the Renilla luciferase experiments with sirna, against (A) ATP6V0D1, COX6A1 or (B) NXF1. All experiments were conducted three times in duplicate; results are shown as means ± SD. Supplementary Figure 6. Effect of sirnas against NXF1 on influenza virus and adenovirus. 293 cells were treated with the indicated sirnas twice at a 12 h interval, incubated 12 h more, infected with GFP-expressing derivatives of (A) influenza virus (FVG-R) or (B) adenovirus, incubated a further 12 h, and analyzed by flow cytometry for GFP fluorescence. Uninfected, untransfected cells (red lines) provided negative controls. (A) 9

10 FVG-R-infected cells pre-treated with a non-targeting control sirna (green line), an sirna against NXF1 (blue line), or an sirna against influenza virus NP (orange line). (B) Cells infected with a GFP-expressing adenovirus, pre-treated with a non-targeting control sirna (green line), an sirna against NXF1 (blue line), or an sirna against GFP (orange line). Results for the anti-nxf1 sirna of Supplementary Table S7 are shown; similar results were obtained with two independent sirnas against NXF1 (shown in Supplementary Table S6). Supplementary Figure 7. Effects of sirnas against the targeted mrnas. At 24 (NXF1) or 48 (other genes) h posttransfection, mrnas were extracted from 293 cells transfected with the indicated sirnas. RT-PCR was then conducted with the mrnas and gene-specific primers to (A) ATP6V0D1, (B) COX6A1, and (C) NXF1 with actin as negative control (D). Supplementary Figure 8. Histogram of z-scores for two independent tests of 13,071 Drosophila genes. Two independent tests of 13,071 Drosophila genes were performed as described in the text. Renilla luciferase activity was measured and standardized by calculating the z- score 19. Two z-scores for each sample were plotted in this histogram, with the X-axis showing the order of 13,071 sirnas and the Y-axis the z-score. The two red lines represent the cutoffs for selecting candidate genes for further study ( hits ). Supplementary Figure 9. Scatterplot of Renilla luciferase z scores from replicate

11 and replicate 2 of the primary genome-wide screen. The correlation coefficient of z-scores between the two replicates of primary screen was Red lines mark the boundaries used to select outlier genes for secondary analysis. 11

12 Supplementary References 1. Benjamini, Y. & Hochberg, Y. Controlling the false discovery rate: a pratical and powerful approach to multiple testing. Journal of the Royal Statistical Society. Series B 57, (1995). 2. Benjamini, Y. & Yekutieli, D. Quantitative trait Loci analysis using the false discovery rate. Genetics 171, (2005). 3. Edgar, K. A. et al. Synthetic lethality of retinoblastoma mutant cells in the Drosophila eye by mutation of a novel peptidyl prolyl isomerase gene. Genetics 170, (2005). 4. Towers, G. J. The control of viral infection by tripartite motif proteins and cyclophilin A. Retrovirology 4, 40 (2007). 5. Sam, M. et al. Aquarius, a novel gene isolated by gene trapping with an RNAdependent RNA polymerase motif. Dev Dyn 212, (1998). 6. Boutros, M. et al. Genome-wide RNAi analysis of growth and viability in Drosophila cells. Science 303, (2004). 7. Efron, B. Large-scale simultaneous hypothesis testing: the choice of a null hypothesis. Journal of the American Statistical Association 99, (2004). 8. Stevens, T. H. & Forgac, M. Structure, function and regulation of the vacuolar (H+)-ATPase. Annu Rev Cell Dev Biol 13, (1997). 9. Roberts, P. C., Kipperman, T. & Compans, R. W. Vesicular stomatitis virus G protein acquires ph-independent fusion activity during transport in a polarized endometrial cell line. J Virol 73, (1999). 10. Perez, L. & Carrasco, L. Involvement of the vacuolar H(+)-ATPase in animal virus entry. J Gen Virol 75 (Pt 10), (1994). 11. Lakadamyali, M., Rust, M. J., Babcock, H. P. & Zhuang, X. Visualizing infection of individual influenza viruses. Proc Natl Acad Sci U S A 100, (2003). 12. Reed, R. & Cheng, H. TREX, SR proteins and export of mrna. Curr Opin Cell Biol 17, (2005). 13. Cullen, B. R. Nuclear mrna export: insights from virology. Trends Biochem Sci 28, (2003). 14. Satterly, N. et al. Influenza virus targets the mrna export machinery and the nuclear pore complex. Proc Natl Acad Sci U S A 104, (2007). 15. Neumann, G., Hughes, M. T. & Kawaoka, Y. Influenza A virus NS2 protein mediates vrnp nuclear export through NES-independent interaction with hcrm1. Embo J 19, (2000). 16. Momose, F. et al. Cellular splicing factor RAF-2p48/NPI-5/BAT1/UAP56 interacts with the influenza virus nucleoprotein and enhances viral RNA synthesis. 12

13 J Virol 75, (2001). 17. Rogers, G. N. & Paulson, J. C. Receptor determinants of human and animal influenza virus isolates: differences in receptor specificity of the H3 hemagglutinin based on species of origin. Virology 127, (1983). 18. Koles, K., Irvine, K. D. & Panin, V. M. Functional characterization of Drosophila sialyltransferase. J Biol Chem 279, (2004). 19. Abdi, H. (ed.) Z-scores (Sage, Thausand Oaks, CA, 2007). 13

14 MDCK D-Mel2 SAα2,6Gal Supplementary Figure 1. Hao et al. 14

15 doi: /nature07151 Phase GFP Mock Infected with FVG-G Supplementary Figure 2. Hao et al. 15

16 A. molecules/cell mrna vrna crna uninfected 3hr 18hr B. molecules/cell mrna vrna crna uninfected 3hr 18hr Supplementary Figure 3. Hao et al. 16

17 A. NS vrna NS1 NS2 B. C. MDCK D-Mel2 MDCK D-Mel2 FVG-G: FVG-G: M1 NS1 M2 NS2 Supplementary Figure 4. Hao et al. 17

18 A. B. Supplementary Figure 5. Hao et al. 18

19 A B Supplementary Figure 6. Hao et al. 19

sirna (NXF1/TAP) D. 1 2 3 4 5 Actin Actin 1.

20 A. sirna (ATP6D0V1) B. Nontargeting Nontargeting Nontargeting sirna (COX6A1) C. sirna (NXF1/TAP) D Actin Actin 1. non-targeting sirna (48h) 2. sirna against ATP6D0V1 (48h) 3. sirna against COX6A1 (48h) 4. non-targeting sirna (24h) 5. sirna against NXF1/TAP (24h) Supplementary Figure 7. Hao et al. 20

21 Z-score Histogram of primary screen replicates 1 and 2 z-scores dsrna library (clone no.) Supplementary Figure 8. Hao et al. 21

22 Z score of primary screen replicate 2 Z-score of primary screen replicate 1 Supplementary Figure 9. Hao et al. 22