Validation of a Next-Generation Sequencing Cancer Panel for Use in the Clinical Laboratory

Transcription

1 Vlidtion of Next-Genertion Sequencing Cncer Pnel for Use in the Clinicl Lbortory Birgitte B. Simen, PhD; Lin Yin, PhD; Chiryu P. Goswmi, MS; Kthleen O. Dvis, MB(ASCP); Renu Bjj, PhD; Jerld Z. Gong, MD; Stephen C. Peiper, MD; Eric S. Johnson, PhD; Zi-Xun Wng, PhD Context. Next-genertion sequencing llows for highthroughput processing nd sensitive vrint detection in multiple genes from smll smples. For mny diseses, including cncer, comprehensive muttionl profile of trgeted list of genes cn be used to simultneously inform ptient cre, estblish eligibility for ongoing clinicl trils, nd further reserch. Objective. To vlidte pn-cncer, next-genertion sequencing ssy for use in the clinicl lbortory. Design. DNA ws extrcted from 68 clinicl specimens (formlin-fixed, prffin-embedded; fine-needle spirtes; peripherl blood; or bone mrrow) nd 5 norml controls. Sixty-four DNA smples (94%; 64 of 68) were successfully processed with the TruSeq Amplicon Cncer Pnel (Illumin Inc, Sn Diego, Cliforni) nd sequenced in 4 sequencing runs. The dt were nlyzed t 4 different filter settings for sequencing coverge nd vrint frequency cutoff. Results. Librries creted from 40 specimens could be successfully sequenced in single run nd still yield sufficient coverge for robust dt nlysis of individul smples. Sensitivity for muttion detection down to 5% ws demonstrted using dilutions of clinicl specimens nd control smples. The test ws highly repetble nd reproducible nd showed 100% concordnce with cliniclly vlidted Snger sequencing results. Comprison to n lternte next-genertion sequencing technology ws performed by lso processing 9 of the specimens with the AmpliSeq Cncer Hotspot Pnel (version 2; Life Technologies, Grnd Islnd, New York). Thirty of the 31 (97%) TruSeq-detected vrints covered by the designs of both pnels were confirmed. Conclusions. A sensitive, high-throughput, pn-cncer muttion pnel for sequencing of cncer hot-spot muttions in 42 genes ws vlidted for routine use in clinicl testing. (Arch Pthol Lb Med. 2015;139: ; doi: / rp oa) Current moleculr pproches for individulized nd precision dignosis of cncer typiclly interrogte one or few genes s compnion dignostics. The drmtic increse in insight into muttionl profiles of mlignncies nd the rpid development of ntgonists for ctivted oncogenes hve spwned more-ggressive genomic tctics to identify individul tumor genotypes for predicting responsiveness to moleculrly trgeted gents. While current methods employ rel-time polymerse chin rection (PCR) nd Snger sequencing, which re typiclly performed seprtely for ech exon of ech gene to be Accepted for publiction June 3, Published s n Erly Online Relese October 30, Supplementl digitl content is vilble for this rticle t www. rchivesofpthology.org in the April 2015 tble of contents. From the Genomic Pthology Lbortory, Thoms Jefferson University Hospitl (Dr Simen, Mr Goswmi, nd Ms Dvis), Phildelphi, Pennsylvni; nd the Deprtments of Pthology, Antomy, & Cell Biology (Drs Yin, Bjj, Gong, Peiper, Johnson, nd Wng); nd Surgery (Dr Wng), Thoms Jefferson University, Phildelphi. Drs Simen nd Yin, Mr Goswmi, nd Ms Dvis contributed eqully to this rticle. The uthors hve no relevnt finncil interest in the products or compnies described in this rticle. Reprints: Zi-Xun Wng, PhD, Deprtment of Surgery, Thoms Jefferson University, 117 South 11th Street, Pvilion Building, Suite 207, Phildelphi, PA (e-mil: zi-xun.wng@jefferson.edu). nlyzed within given smple, next-genertion sequencing, with its incresed sensitivity nd remrkble throughput, is rpidly entering the clinicl testing spce. Vlidtion for use in Clinicl Lbortories Improvement Amendments of 1988 (CLIA) pproved testing lbortory requires rigorous vlidtion nd ongoing performnce monitoring. Guidelines re now vilble from the College of Americn Pthologists, Americn College of Medicl Genetics, 1 nd comprehensive work group convened by the Centers for Disese Control. 2 These will likely continue to evolve s individul lbortories shre ides nd results from tiloring of commercilly vilble tests nd custom pnels. 3 8 Somtic muttions in cncer cn be chllenging to detect by Snger sequencing. Often, these muttions re found t low prevlence becuse they cn be differentilly present in distinct cell popultions or becuse the tumor mteril is mixed with norml tissue. Robust DNA librry preprtion nd high-sensitivity detection re importnt for successful detection of such moleculr chnges. We decided to bse our first, routine, next-genertion sequencing test offering on commercilly vilble kit tht hs been designed to cover firly comprehensive list of cncer-ssocited muttionl hot spots. The resulting pn-cncer pnel is well suited for clinicl pplictions to guide dvnced tretment nd to predict the clinicl course of different types of cncers. The immedite concern for clinicins is to obtin dt tht will guide 508 Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l

2 tretment with US Food nd Drug Administrtion pproved drugs currently used s the stndrd of cre ccording to Ntionl Comprehensive Cncer Network guidelines. These include somtic muttions in KRAS (codons 12, 13) nd BRAF (V600E) in colorectl cncer (CRC) tht predict poor prognosis nd nonresponse to nti-egfr ntibodies, for exmple, cetuximb or pnitumumb. 9,10 In melnom, BRAF V600E is predictive of positive response to the BRAF V600-specific inhibitor vemurfenib. 11 Somtic muttions in EGFR in exons 18, 19, nd 21 re predictive of clinicl response to the EGFR tyrosine kinse inhibitor drugs gefitinib nd erlotinib, nd the T790M point muttion in exon 20 hs been ssocited with resistnce to these drugs. 12 In the bsence of compnion dignostic result tht permits therpy with n pproved, trgeted gent, the emerging prdigm clls for profiling tumors for n extended pnel of muttions to identify lterntive driver muttions, including those predictive of sensitivity/clinicl responsiveness to novel moleculrly trgeted drugs. Clinicl tril informtion relted to mny of the 42 vlidted genes cn be found on (ccessed November 1, 2013) nd (ccessed November 1, 2013). For instnce, somtic muttions in NRAS codons 12, 13, nd 61 re used s biomrkers for dvnced solid tumors nd re ssocited with eligibility for severl ongoing clinicl trils, for exmple, phse II tril of pimsertib versus dcrbzine in the mngement of NRAS-mutted, loclly dvnced or metsttic, mlignnt, cutneous melnom (NCT ), nd phse II tril of MEK1/2 inhibitor in ptients with dvnced melnom nd muttions in NRAS or BRAF V600 (NCT ). 13 Another importnt use of the dt is to predict the expected clinicl course. For instnce, muttions in TP53 leding to ltered function or expression of p53 re typiclly predictive of poor clinicl course in mny cncer types. 14 After removing 6 genes from the dt nlysis becuse they ech included mplicons with inferior performnce in librry preprtion or sequencing, we estblished performnce criteri for muttionl nlysis of 42 genes with full or prtil coverge for 157 exons. Here, we describe the process nd the results from the vlidtion, showing robust coverge sttistics, high precision, sensitivity down to 5% vrint frequency, nd excellent concordnce with other clinicl nd experimentl dt produced in our CLIApproved nd College of Americn Pthologists ccredited testing lbortory. MATERIALS AND METHODS Smple Informtion Sixty-eight clinicl tumor specimens nd 5 norml controls were nlyzed in this study. Of the 68 clinicl specimens, 4 (6%) did not pss smple qulity control (3 filed rel-time PCR qulity control; 1 filed qulity control fter PCR clenup; see DNA Extrction nd Smple Qulity Control nd Librry Preprtion nd Qulity Control ). The 64 successful tumor specimens included melnom (n ¼ 1; 2%), brin (n ¼ 1; 2%), colon (n ¼ 19; 30%), lung (n ¼ 10; 16%), thyroid (n ¼ 23; 36%), nd leukemi (n ¼ 10; 16%). By smple type, the 64 specimens consisted of formlin-fixed, prffin-embedded tissue (FFPE; n ¼ 32; 50%), fine-needle spirtes (FNA; n ¼ 22; 34%), nd peripherl blood or bone mrrow (PM/BM; n ¼ 10; 16%) (Supplementl Tble S1; see supplementl mteril file t in the April 2015 tble of contents). The 5 norml controls were peripherl blood smples from 5 helthy individuls. Institutionl review bord pprovl ws not required for test vlidtion under CLIA using leftover clinicl specimens. Results for these specimens were only used for correltion nlysis. Study Design The 64 successful clinicl specimens nd 5 norml controls were processed with the TruSeq Amplicon Cncer Pnel (Illumin, Sn Diego, Cliforni) nd sequenced in 4 MiSeq (Illumin) instrument runs to test the ssy precision (reproducibility nd repetbility), sensitivity, nd concordnce with 2 lternte sequencing pltforms, tht is, with Ion Torrent Personl Genome Mchine (PGM; Life Technologies, Crlsbd, Cliforni) nd Snger sequencing. Assy sensitivity ws determined by sequencing serilly diluted DNA from clinicl specimen nd, seprtely, mixture of norml control smples. The clinicl specimen ws diluted to contin expected percentges of TP53 vrint present t nerly 100% in the originl smple. Four dilutions, trgeted t 5%, 3.7%, 2.5%, nd 1.2% vrint content, were ech processed in triplicte. For the norml control smple mixture, DNA from 2 helthy volunteers of white nd Asin origin were mixed to contin expected percentges of heterozygous single nucleotide polymorphisms (SNPs) present in the white smple. Three dilutions, trgeted to 10%, 5%, nd 2.5%, were ech processed in duplicte. Assy reproducibility (interrun precision) ws ssessed by sequencing 6 specimens (2 FFPE [33%], 2 FNA [33%], nd 2 PB/BM [33%]) in duplictes cross seprte runs. Assy repetbility (intrrun precision) ws ssessed by sequencing one clinicl specimen (FFPE) with rnge of vrint frequencies. This specimen ws indexed with different brcodes nd sequenced in qudruplicte within single run. Nine clinicl specimens (FFPE) were sequenced using the Ion Torrent Hotspot V2 pnel (Life Technologies) to provide comprison with n lternte sequencing pltform. Fifty-three of the 64 smples hd known relevnt clinicl vrint results done by in-house Snger sequencing, which were confirmed by the ssy cross seprte runs (Supplementl Tble S1). The relevnt clinicl vrints included BRAF V600E (colorectl nd thyroid), NRAS Q61 (thyroid), EGFR exons 18 to 21 (lung), nd KRAS G12 nd G13 (colorectl). In ddition, Snger-sequencing ssys were designed to cover TP53 exons 4 to 9 identified by the pn-cncer muttion pnel (our 42 gene version of the TruSeq Amplicon Cncer Pnel) to serve s confirmtory ssy. Counting ll specimens, dilutions, nd replictes described bove, 100 smples were sequenced in the 4 runs. Additionlly, 11 smples were included in run 2 nd 20 in run 3 but were not nlyzed in this vlidtion study becuse they were concurrent tests of decresed test volumes tht will not be further pursued t this time. Contmintion controls (blnks, wter controls) were included in the first 3 runs. A positive (SNP) control ws included in ll runs. This control employed seprte probe set nd ws intended for the TruSeq Amplicon Cncer Pnel nd MiSeq instrument vendor, Illumin, to perform troubleshooting in cse of librry preprtion filure. DNA Extrction nd Smple Qulity Control Blood nd bone mrrow smples were extrcted ccording to the mnufcturer s protocol with the QIAmp DNA Mini Kit (Qigen, Vlenci, Cliforni) vi utomted QIAcube (Qigen) extrction or mnul kit extrction. Two hundred microliters of PB/BM smples ws used, nd DNA ws eluted in totl volume of 100 ll. The FFPE tissue sections (10 lm thick) were microdissected to enrich for tumor cells. Prffin ws removed with xylene, nd the tissue ws wshed with 100% ethnol. The FFPE tissue DNA ws extrcted ccording to the mnufcturer s instructions using the QIAmp DNA FFPE kit (Qigen) nd ws eluted in 25 ll volume. Cell pellets from FNA smples were extrcted ccording to the mnufcturer s instructions using the QIAmp DNA Micro Kit (Qigen) nd were eluted in 25 ll volume. The extrcted DNA ws quntified using the Qubit dsdna BR ssy (Life Technologies), nd 250 ng of DNA ws used s templte for sequencinglibrry preprtion for ll tissue types. For FFPE nd FNA smples, the DNA qulity nd quntity were further ssessed using the Illumin FFPE QC Kit ccording to the mnufcturer s instructions, Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l 509

3 with smples with chnges in cycle threshold (DCt) vlue of 2 or less (versus control) considered cceptble for sequencing. Librry Preprtion nd Qulity Control Sequencing mplicon librries were prepred using the TruSeq Amplicon Cncer Pnel, ccording to the mnufcturer s instructions. The pnel contins probes to generte 212 mplicons from 48 cncer-relted genes: ABL1, AKT1, ALK, APC, ATM, BRAF, CDH1, CDKN2A, CSF1R, CTNNB1, EGFR, ERBB2, ERBB4, FBXW7, FGFR1, FGFR2, FGFR3, FLT3, GNA11, GNAQ, GNAS, HNF1A, HRAS, IDH1, JAK2, JAK3, KDR, KIT, KRAS, MET, MLH1, MPL, NOTCH1, NPM1, NRAS, PDGFRA, PIK3CA, PTEN, PTPN11, RB1, RET, SMAD4, SMARCB1, SMO, SRC, STK11, TP53, nd VHL. Briefly, probe set contining pirs of oligonucleotides specific to the trgeted regions ws hybridized to ech genomic DNA smple. Amplicons were generted by connection of bound oligonucleotides by extension nd ligtion using DNA polymerse nd ligse, followed by PCR mplifiction. The PCR primers were flnked by index sequences for smple multiplexing s well s common dpters for sequencing cluster genertion. After PCR clenup, librry qulity ws ssessed on 2100 Bionlyzer (Agilent Technologies, Snt Clr, Cliforni). Ech smple librry ws normlized ccording to the mnufcturer s instructions, nd equl volumes were pooled to generte the finl sequencing librry. MiSeq Sequencing nd Dt Anlysis Ech pooled librry ws sequenced on MiSeq instrument using pired-end sequencing design. Imge processing nd fstq file genertion from rw red dt were ccomplished with CASAVA version nd RTA version (Illumin). Alignment of pired-end rw reds to the humn hg19 genome ssembly ws performed with bnded Smith-Wtermn lignment lgorithm. The Somtic Vrint Cller lgorithm version (Illumin) ws used for identifiction of vrints from ligned reds, nd coverge nlysis ws performed in prllel with Bmtools 15 (open-source; bmtools; ccessed June 1, 2013). Vrints were nnotted by Illumin Vrint Studio version 1.0 (Illumin) nd were subsequently filtered nd reported using n in-house reporting Webbsed ppliction, ClinMut Reporter (Thoms Jefferson University Hospitls, Phildelphi, Pennsylvni). Four filter settings for vrint frequency cutoffs were tested in this vlidtion: 10%, 7.5%, 5%, or 2.5%, with minimum vrint coverge of 10 reds (ie, 10 reds tht contined the ctul vrint sequence). Vrints with globl minor llele frequency greter thn 1.0% were removed becuse they were considered common SNPs. Only coding vrints nd vrints in the 2 nucleotides immeditely preceding nd following exons were considered in this vlidtion study. The Integrtive Genomics Viewer 16 (Brod Institute, Cmbridge, Msschusetts) ws used to visulize vrints ginst the reference genome. PGM Sequencing nd Dt Anlysis Librries were prepred using the AmpliSeq Cncer Hotspot Pnel v2 ccording to the mnufcturer s instructions. Briefly, trgets were mplified using 207 primer pirs, then prtilly digested to fcilitte br-coded dpter ligtion. Following purifiction, librries were quntified using Qubit dsdna HS Assy Kit nd Qubit 2.0 fluorometer, diluted to concentrtion of 3 ng/ml, nd pooled in equl volumes. The librry pool ws clonlly mplified in n emulsion PCR rection using Ion Sphere Prticles on the OneTouch 2 instrument (Life Technologies) ccording to the mnufcturer s protocol. Templte-positive ion sphere prticles were enriched on the Ion OneTouch ES (Life Technologies) ccording to the mnufcturer s protocol. Following enrichment, sequencing primers nd polymerse were dded. The librries were loded onto n Ion 318 chip (Life Technologies) nd sequenced on n Ion Torrent PGM instrument ccording to the mnufcturer s protocol. Vrints were identified using the Torrent Somtic Vrint Cller (versions nd 3.6.6; Life Technologies) nd nnotted using Ion Reporter softwre (Life Technologies). Snger Sequencing Verifiction Twenty-six smples showed TP53 vrints in exons 4 to 9 t vrint frequency bove 5%. Twenty-one smples (81%) with sufficient remining smple mteril were exmined by Snger sequencing using the Big Dye Termintor v3-1 cycle sequencing kit (Life Technologies) nd 3130xL Genetic Anlyzer (Life Technologies) ccording to the mnufcturer s instructions. The primers used were ( ): TP53exon4F TGCCGTCTTCCAGTTGCTTT, TP53exon4R AGCAATCAGTGAGGAATCAGAGG, TP53exon5F TGGGGCTGGAGAGACGACA, TP53exon5R GGAGGTCAAA- TAAGCAGCAGGAG, TP53exon6F TTGCCACAGGTCTCCC- CAAG, TP53exon6R TGGGTAGTAGTATGGAAGAAATCGG, TP53exon7F GGGAGTAGATGGAGCCTGGTT, TP53exon7R GGAAAGAGGCAAGGAAAGGTGA, TP53exon8F CAGGACAA- GAAGCGGTGGAG, TP53exon8R ACAGTCAAGAAGAAAACGG- CA, TP53exon9F TTTGTACCGTCATAAAGTCAAACAA, nd TP53exon9R CCTTTGACCATGAAGGCAGGA. TP53 primers for exons 4, 6, nd 7 were combined for multiplex PCR, nd exons 5, 8, nd 9 were individully mplified. For detection of deletion vrints in APC nd CSF1R, the following primers were used: APCexon15-1F GGATGTAATCA- GACGACACAGGAT, APCexon15-1R GAACATAGTGTT- CAGGTGGACT, APCexon15-2F CAGGAGACCCCACTCATGTT, APCexon15-2R GCAGCTTGCTTAGGTCCACT, CSF1Rexon21F GTAAAGCACGTTGGGCTGGG, nd CSF1Rexon21R CCCCATC- CATGGAGGAGTTGA. Thermocycling ws performed s follows: 948C (10 minutes); 35 cycles t 948C (30 seconds), 588C (30 seconds), 728C (30 seconds); 728C (7 minutes); nd hold t 48C. The primer concentrtion ws 2 lm for ll primers, nd MgCl 2 concentrtion ws 25mM. RESULTS Regions of Interest Covered by Trgeted Sequencing Pnel The TruSeq Amplicon Cncer Pnel consists of 212 mplicons, representing portions of 48 genes, which re used to generte pired-end reds pproximtely 125 bse pirs (bp) in length. Sequenced regions of mplicons rnge from 109 bp to 141 bp. Ech sequence red begins precisely t one of the 2 ends of the region. Therefore, complete bidirectionl sequence is obtined when this region is shorter thn 125 bp, wheres longer mplicons generte s much s 16 bp of monodirectionl sequence on both ends. Two brod clsses of genes re trgeted by the pnel: tumor suppressor genes nd genes in which ctivting or dominnt-negtive muttions re concentrted in short hot spots. Supplementl Tble S2 shows, for ech gene, the percentge of somtic muttions in the Ctlogue of Somtic Muttions in Cncer (COSMIC) dtbse 17 tht re covered by the pnel. The pnel covers ll of the mjor cncer-ssocited hot spots in the trgeted genes (Supplementl Tble S2), lthough, in some cses, the hot spot is present in region of monodirectionl coverge. For tumorsuppressor genes, in which inctivting muttions re often distributed firly evenly throughout much of the gene, the pnel covers vrying frctions of previously observed muttions (Supplementl Tble S2). For exmple, 95% of somtic muttions in TP53 re covered, but, in severl other genes, less thn 50% of relevnt muttions re covered (Supplementl Tble S2). Thus, lthough mny muttions in tumor suppressor genes cn be detected using this pnel, bsence of detected vrints in one of these genes does not exclude the presence of deleterious muttion in n uncovered portion of the gene. 510 Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l

4 Figure 1. Averge coverge for ech of the 189 mplicons cross ll smples. Dt re shown s men 6 stndrd devition. Figure 2. Correltion between vrint frequencies detected by the Pn-Cncer Muttion Pnel (our pnel bsed on the TruSeq Amplicon Cncer Pnel [Illumin, Sn Diego, Cliforni]) nd the AmpliSeq Cncer Hotspot Pnel (Version 2) (Life Technologies, Crlsbd, Cliforni). Frequencies re shown for ech vrint tht ws detected by both pnels. Coverge To confidently detect low-frequency vrints represented by t lest 10 reds out of the totl reds from the corresponding mplicon, we ssessed coverge sttistics for ech of the 212 mplicons in the TruSeq Amplicon Cncer Pnel (Supplementl Tble S3 nd Supplementl Figure S1). This nlysis showed tht 6 genes (CDKN2A, FGFR3, HRAS, RB1, STK11, nd VHL) contined mplicons hving significntly lower-thn-verge coverge, with mny smples covered t less thn 2003 (Supplementl Tble S3). This contrsted with verge coverge of greter thn for 88% of mplicons. Low coverge increses the levels of bckground noise in the ssy (see Comment ) s well s incresing the probbility of llele dropout. These issues mke dt from low-coverge mplicons less relible. Five of these poorly performing genes (CDKN2A, FGFR3, RB1, STK11, nd VHL) were not high-priority trgets for our clinicl prctice nd were excluded from the vlidtion. These genes were designted for reserch use only. HNF1A ws lso excluded nd designted for reserch use only, even though coverge ws cceptble, becuse it contined C 8 sequence tht sequenced poorly. These exclusions reduced the number of mplicons from 212 to 189 nd brought the number of reported genes to 42. Although coverge ws lso low for HRAS, this gene ws retined in our ssy becuse of its potentil clinicl importnce. For the remining 42 genes, herefter referred to s the pn-cncer muttion pnel, coverge sttistics relevnt to the chosen frequency filters of 10%, 7.5%, 5%, nd 2.5% were compiled to exmine the proportion of mplicons yielding minimum number of reds. The totl coverge per smple rnged from to reds. Averge coverge per mplicon cross the 100 smples rnged from 197 to reds (Figure 1). (Note tht verge coverge in run 1, which included 16 smples, ws pproximtely 2-fold higher thn in runs 2 4, which ech included pproximtely 40 smples [Supplementl Tble S3]). As seen in Tble 1, the vst mjority (96.0% 99.9%) of the mplicons met ech minimum coverge criterion (1003, 1343, 2003, nd 4003, respectively). This ws true for ll 3 specimen types, FFPE, FNA, nd PB/BM. The generlly higher numbers of mplicons with low red count for PB/BM specimens were likely more relted to the fct tht most of these smples were grouped on the sme run rther thn true property of the specimen type. For unknown resons, run 4 hd overll poorer coverge for smll subset of mplicons thn the preceding 3 runs. Sensitivity To exmine the bility of the ssy to detect lowfrequency vrints, dilutions of smple contining the TP53 vrint c.844c.t (p.r282w) t vrint frequency close to 100% were performed, trgeting finl vrint frequencies of 1.2%, 2.5%, 3.7%, nd 5.0%, respectively. As seen in Tble 2, the vrint ws detected in ll replictes of ech dilution. In second experiment, norml control smples were used to ssess sensitivity. Two norml control smples of white nd Asin origins, respectively, were mixed to obtin expected percentges of heterozygous SNP (EGFR rs ) present in the white smple but not in the Asin smple. Three dilutions, trgeted to 10%, 5%, Minimum Coverge All Smples (n ¼ ), No. (%) Tble 1. Coverge Sttistics PB/BM (n ¼ 7938), No. (%) FFPE (n ¼ 6615), No. (%) FNA (n ¼ 4347), No. (%) (99.6) 7871 (99.2) 6610 (99.9) 4339 (99.8) (99.4) 7842 (98.8) 6607 (99.9) 4337 (99.8) (98.9) 7768 (97.9) 6592 (99.7) 4333 (99.7) (97.6) 7622 (96.0) 6523 (98.6) 4297 (98.8) Abbrevitions: FFPE, formlin-fixed, prffin-embedded; FNA, fine-needle spirte; PB/BM, peripherl blood/bone mrrow. The number of mplicons with coverge bove 1003, 1343, 2003, nd 4003 re shown for ll smples nd seprtely for the ech specimen type s frction of the totl number of mplicons. The corresponding percentge of mplicons tht met ech coverge criterion is shown in prentheses. Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l 511

5 Trget 1, % Tble 2. Limit-of-Detection Anlysis Replicte 1, % Replicte 2, % Replicte 3, % Trget 2, b % Dilutions of clinicl smple with the vrint TP53 c844c.t (p.r282w) were processed in triplicte. Trget frequencies nd the observed vrint frequency for ech replicte re listed. b Mixes of 2 norml control smples were processed in duplicte, nd the observed frequency of n originlly heterozygous singlenucleotide polymorphism (dbsnp rs in EGFR) ws trcked. nd 2.5%, respectively, were ech processed in duplicte. As seen in Tble 2, the SNP ws detected in ll replictes of ech dilution, providing dditionl evidence tht the test cn detect predefined vrints down to t lest 2.5%. At very low vrint frequencies, some noise, (ie, flsepositive clls becuse of PCR nd sequencing errors, s well s rtifcts from FFPE processing) might be expected. To exmine bckground noise in ll smple types (FFPE, FNA, PB/BM), we plotted vrint frequency versus coverge for ll softwre-clled vrints in ll smples, including those in excluded genes (Supplementl Figure S2). This nlysis showed tht, in mplicons with t lest 2003 coverge, the vst mjority of the bckground noise vrints were present t less thn 5% in ll 3 smple types (see below). Precision One clinicl specimen (FFPE) with rnge of vrint frequencies ws processed in qudruplicte within single run to ssess repetbility. As seen in Tble 3, 3 vrints t different frequencies were detected in ll 4 replictes within tight rnge. No other vrints were found. There ws no chnge in the dt between the 4 sensitivity settings of 10%, 7.5%, 5%, nd 2.5%, so these dt were pplicble to ll 4 conditions. An FFPE smple ws chosen becuse it represents specimen type tht typiclly yields DNA with lower-mplifiction efficiency thn PB/BM does. Two clinicl specimens of ech type (PB/BM, FNA, nd FFPE, respectively) were predefined for ssessment of reproducibility. The first replicte of the smples were present on one of the first 3 runs (with ll 3 runs represented) nd ws compred with second replicte on run 4. As seen in Tble 4, ech vrint ws seen t similr frequencies in 2 seprte runs using 5% sensitivity setting. At 2.5%, number of vrints were observed tht could not Tble 4. Reproducibility Specimen Vrint 1, % Replicte Replicte 2, % PB/BM-1 TP53 p.e198* PB/BM-2 TP53 p.g245s FNA-1 NRAS p.q61r FNA-2 KDR p.g873e FNA-2 NRAS p.q61r FFPE-1 KRAS p.g13c FFPE-2 KRAS p.g12c FFPE-2 CSF1R p.s928_g934del Abbrevitions: FFPE, formlin-fixed, prffin-embedded; FNA, fineneedle spirte; PB/BM, peripherl blood/bone mrrow. Two smples of ech specimen type (PB/BM, FNA, nd FFPE) were processed in seprte runs. The vrint frequency for ech replicte is shown. be repeted; most of these vrints were derived from elevted noise in run 2 (dt not shown). Concordnce With Clinicl Snger Sequencing Concordnce with existing Snger dt ws investigted by exmining the vlidtion dt for muttions in KRAS, BRAF, EGFR, nd NRAS. FFPE-preserved colon cncer smples re routinely tested for cliniclly ctionble muttions t codons 12 nd 13 in KRAS nd codon 600 in BRAF. Thyroid tumor spirtes (FNA) re tested for BRAF nd NRAS. Vrious EGFR muttions, deletions, nd insertions (exons 18 21) re tested in lung cncer or metstses. The concordnce dt were clculted for ech specimen type. As seen in Tble 5, FFPE specimens with preexisting clinicl Snger dt for KRAS, BRAF, nd EGFR (n ¼ 31) showed 100% concordnce with these dt. Similrly, FNA specimens (n ¼ 22) showed 100% concordnce with preexisting clinicl Snger dt for NRAS nd BRAF (Tble 6). At the 10% sensitivity cutoff, 2 of the vrints detected by Snger sequencing were not reported by next-genertion sequencing (ie, they were observed t,10% frequency). Snger sensitivity is highly vrible dependent on bckground noise nd sequence context, nd these 2 smples hd smll positive peks, demonstrting tht test with 10% sensitivity my miss certin Sngerdetectble vrints. Further Verifiction of Detected Vrints In ddition to the concordnce nlysis with clinicl dt, we performed Snger sequencing for TP53 on ll smples tht hd vilble mteril nd where TP53 muttion ws detected by the pn-cncer muttion pnel. Becuse of the inherently lower sensitivity of popultion-bsed Snger sequencing, there ws no expecttion of being ble to confirm low-frequency vrints. When only vrints detected t greter thn 5% frequency were considered, the greement with Snger sequencing results ws 100% (Tble 7). Tble 3. Repetbility Vrint Replicte 1, % Replicte 2, % Replicte 3, % Replicte 4, % Men (SD), % APC c.4505g.a (pa1474t) (0.5) PTPN11 c.179g.t (p.g60v) (1.6) TP53 c.722c.g (p.g60v) (1.0) One formlin-fixed, prffin-embedded specimen ws processed in qudruplicte nd sequenced within single run. Three vrints were detected cross ll 4 smples. No other vrints greter thn 2.5% were detected. The vrint frequency for ech replicte nd clculted mens nd stndrd devitions re shown. 512 Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l

6 Tble 5. Concordnce in Formlin-Fixed, Prffin-Embedded Smples Pn-Cncer Muttion Pnel KRAS BRAF EGFR Exons Snger Sequencing G12V G12D G13D WT V600E Wild Type Positive Wild Type KRAS G12V 4 G12D 2 G13D 3 Wild type 10 BRAF V600E 2 Wild Type 7 EGFR exons Positive 0 Wild type 10 A23 2 comprison with clinicl Snger sequencing results is shown for the 31 formlin-fixed, prffin-embedded specimens. A subset of specimens ws dditionlly sequenced on PGM using the Ion AmpliSeq Cncer Hotspot v2 pnel to provide comprison with n lternte technology. Although both technologies fll in the ctegory of nextgenertion sequencing, the error profiles of the 2 pltforms, MiSeq nd PGM, re very different becuse of the chemistries employed. 18 The AmpliSeq pnel mplifies segments of the sme genes s the pn-cncer smples s well s 2 dditionl genes, but the exct positions covered in some cses differ between the 2 pnels. Nine FFPE clinicl specimens were chosen for sequencing with the AmpliSeq pnel for concordnce nlysis. Note tht the concordnce ws not expected to be 100% becuse of differences in primer design for the 2 pnels. At the 10%, 7.5%, nd 5% sensitivity levels, 38 vrints were identified in the 9 specimens by the pn-cncer pnel test. Thirty-one of these positions (82%) were lso covered by AmpliSeq pnel mplicons. Thirty of the thirty-one vrints were recpitulted in the AmpliSeq pnel dt (97% confirmtory outcome). At the 2.5% sensitivity level, 40 muttions were identified by the pn-cncer pnel test. The 2 dditionl muttions were not covered by the AmpliSeq pnel, nd the outcome remined t 97%. The observed frequencies of the 30 vrints tht were detected by both methodologies re shown in Figure 2. Pn-cncer pnel sequencing of the single discordnt specimen t the 5% sensitivity level (vrint PDGFRA c2360 T.A t 5.25%) ws repeted in the finl vlidtion run, but the vrint cll Tble 6. Concordnce in Fine-Needle Aspirte Smples Pn-Cncer Muttion Pnel NRAS BRAF Snger Q61K Q61R Wild Type V600E Wild Type NRAS Q61K 2 Q61R 4 Wild type 11 BRAF V600E 8 Wild type 14 A232 comprison with clinicl Snger sequencing results is shown for the 22 fine-needle spirte specimens. Note tht some smples contin more thn one muttion. ws not reproduced. Anlysis of the common SNPs in both smples ruled out smple swp with high confidence. It is likely tht the originl vrint cll resulted from muttion generted during probe extension or PCR (see Comment ). Seprte nlysis of the PGM dt gve very similr results to those seen with MiSeq. Four muttions ffecting protein sequence were found in the PGM dt tht were not identified using MiSeq (not shown). In ll cses, the relevnt codon ws in region not covered by the TruSeq Amplicon Cncer Pnel. (No muttions in 3 of these codons re present in the COSMIC dtbse 17 ; the remining codon is represented by 16 entries in COSMIC.) Insertion nd deletion vrints were identified in 10 smples (Supplementl Tble S1). Sufficient mteril remined for specimens 3, 12, 41, nd 53, nd primers were designed to mplify the regions of interest. The deletions in these 4 smples, rnging from 1 to 21 bses, were ll confirmed by Snger sequencing of the generted mplicons (dt not shown). Additionlly, becuse the vlidtion set did not contin ny specimens with cliniclly relevnt EGFR deletions, we included 2 such specimens in subsequent run nd successfully detected the p.e476_a750delelrea muttion (Supplementl Figure S3). Anlysis of 64 Vlidtion Smples Using the 5% sensitivity cutoff estblished bove, we detected 123 vrints in the 64 vlidtion smples (Supplementl Tble S1). Of these, 108 (88%) were convincing nd could be reported out cliniclly, wheres 13 (11%) ppered to be rtifcts, nd 2 (2%) would hve to be reproduced to be clled with confidence. All potentil rtifct vrints were present t frequency of 6.8% or less. The Somtic Vrint Cller softwre ssigns qulity scores (mximum, 100) for ll vrints, nd 8 (of 13; 62%) of the likely rtifct vrints were the only ones in our nlysis with score less thn 100 (Supplementl Tble S1). Furthermore, 8 (62%) of the rtifctul vrints were found in just 2 smples (smples 43 nd 54). Both of these smples only mrginlly met our qulity control criteri, nd it is likely tht poor smple qulity ws responsible for the presence of rtifcts (see Comment ). Two other questionble vrints were detected in HRAS, which performs poorly in librry preprtion (see bove). Two of the other rtifctul vrints were identicl (MPL p.w515*) nd involved n pprent sequencing rtifct tht we hve seen in mny smples in Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l 513

7 Tble 7. Confirmtion of TP53 Vrints by Snger Sequencing Specimen Gene Nucleotide Vrint Amino Acid Vrint Detected by Snger Pn-Cncer Pnel Vrint Frequency, % PB/BM-1 TP53 c.758c.t p.t253i No 3.7 PB/BM-2 TP53 c.758c.t p.t253i No 4.6 FFPE-1 TP53 c.713c.a p.c238f Yes b 8.5 FFPE-2 TP53 c.847g.a p.r283c Yes 20.4 FFPE-2 TP53 c.839c.g p.r280t Yes 33.7 FFPE-3 TP53 c.437c.t p.w146* Yes 34.9 FFPE-4 TP53 c.524c.t p.r175h Yes 35.3 PB/BM-2 TP53 c.733c.t p.g245s Yes 43.2 FFPE-2 TP53 c.569g.a p.p190l Yes 55.2 FFPE-5 TP53 c.523g.a p.r175c Yes 59.9 FFPE-6 TP53 c.817g.a p.r273c Yes 61.1 FFPE-5 TP53 c.818c.t p.r273h Yes 61.8 FFPE-7 TP53 c.428a.c p.v143g Yes 62.7 PB/BM-1 TP53 c.722g.c p.s241c Yes 65.7 FFPE-8 TP53 c.524c.t p.r175h Yes 74.9 FFPE-9 TP53 c.839c.a p.r280i Yes 76.1 FFPE-10 TP53 c.475c.g p.a159p Yes 84.2 PB/BM-3 TP53 c.592c.a p.e198* Yes 86.2 FFPE-11 TP53 c.481c.t p.a161t Yes 88.4 FFPE-12 TP53 c.523g.c p.r175g Yes 94.1 PB/BM-4 TP53 c.844g.a p.r282w Yes 96.3 Abbrevitions: FFPE, formlin-fixed, prffin-embedded; PB/BM, peripherl blood/bone mrrow. Four PB/BM nd 12 FFPE specimens with TP53 vrints detected by the Pn-Cncer Muttion Pnel were sequenced with Snger TP53 ssy. b Pek only slightly bove bckground. different sequencing runs. These results suggested tht few rtifctul vrints my still be identified using the 5% sensitivity cutoff. Therefore, it is importnt to exercise cution when nlyzing vrints with low coverge, low qulity scores, or with frequencies just bove 5%, prticulrly those in poorly performing mplicons or in lowerqulity smples (see Comment ). COMMENT Next-genertion sequencing enbles prllel processing of smples for high-sensitivity detection of muttions in multiple genes. Our clinicl lbortory performs weekly processing of vrible numbers of specimens by Snger sequencing for severl genes. Additionl, low-volume, muttionl nlyses in less-commonly requested genes re sent to commercil reference lbortories. We found it ttrctive to stremline processing of ll these specimens with single ssy. Such btch processing llows for efficient wet-lbortory time mngement nd moreconvenient reporting system becuse ll smples re processed simultneously nd identiclly. We vlidted pn-cncer muttion pnel bsed on Illumin s TruSeq Amplicon Cncer Pnel by sequencing 68 clinicl smples nd norml controls. DNA extrcted from different sources of input mteril (FFPE, FNAs, PB/BM) ws processed. As depth of sequencing nd sensitivity is intimtely relted, we nlyzed the dt t 4 different combintions of these vribles (Tble 8), ll bsed on requirement for minimum of 10 reds tht contin the vrint sequence. Both fctors lso contribute to noise in next-genertion sequencing, but the sensitivity increses with sequencing coverge until lower brrier cused by cross-linking rtifcts in FFPE specimens nd PCR error from the librry preprtion is reched. 19,20 At the 2.5% sensitivity level, predefined vrints could still be comfortbly detected, but bckground noise in one of the 4 runs decresed reproducibility of other vrints when specimens were compred between runs. Thus, the test ws vlidted to 5% sensitivity with requirement for t lest 10 reds tht contin the vrint llele. Therefore, t lest 200 totl reds must be present to cll vrint t 5%. Using these cutoffs, we found 100% repetbility nd reproducibility when tested directly in smll number of smples (Tbles 3 nd 4). Concordnce with existing clinicl Snger sequencing ws 100%. Typicl Snger sensitivity is bout 15%, but, in some cses, vrints t lower frequencies cn be detected depending on run qulity nd sequence context. 21 When 9 smples were tested by sequencing with n lternte next- Tble 8. Summry of Vlidtion Dt 4003 Coverge/ 2.5% Sensitivity 2003 Coverge/ 5% Sensitivity 1343 Coverge/ 7.5% Sensitivity 1003 Coverge/ 10% Sensitivity Coverge 97.6% % % % Reproducibility nd repetbility Poor LOD (Sensitivity) Pss Pss Pss Pss Concordnce/Snger detectble vrints ,100 b Confirmtion by lternte NGS technology Abbrevitions: LOD, limit of detection; NGS, next-genertion sequencing. Results from ech test re shown for ech filter setting. Results with uncceptble flse-positive or flse-negtive levels re shown in bold type. b When the sensitivity filter ws limited to 10%, 2 of the vrints detected by clinicl Snger sequencing would hve been missed, reflecting the vried sensitivity of Snger sequencing by position depending on run qulity nd sequence context. 514 Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l

8 genertion sequencing technology, 18 one of 31 vrints (3%) ws not detected. This vrint lso ws not reproduced when the smple ws resequenced using MiSeq. It is likely tht the originl vrint cll ws rtifctul nd resulted from poor smple qulity. The limiting fctor on the sensitivity of our ssy ws noise in the sequence dt (ie, rtifctul sequence vrints tht pper in sequencing runs but tht re not derived from the smple genome) (Supplementl Figure S2). Noise vrints tht ppered t significnt levels (.2.5%) could be grouped into 2 min types. One type ppered to be cused by consistent sequencing errors t specific DNA sequences. These vrints were seen repetedly in multiple smples nd in different runs, lthough their frequencies vried from run to run. Becuse sequencing errors re often strnd-specific, this type of noise ws less of problem in regions of bidirectionl coverge. We re currently ssembling dtbse of common sequencing errors so tht they cn be filtered out before nlysis. The second type of noise ppered to correspond to muttions generted during the probe extension nd PCR steps of librry preprtion. These vrints were most frequent in mplicons with low coverge nd were different between smples nd even mong different runs of the sme smple. It is possible for such muttions to be present t high frequency (.2.5%) only if very few of the lmost 10 5 smple-derived copies of the gene present in the librry preprtion step re ctully used s templtes in the mplifiction. This would llow muttion from single nucleotide misincorportion t n erly step to become overrepresented in the finl librry. This type of noise ws n issue for the genes tht were excluded from our vlidtion nd ws lso seen when DNA smples tht did not meet our qulity control criteri were used in the ssy (not shown). However, becuse these noise vrints differed between runs, it ws possible to distinguish between noise nd genuine vrints simply by running the smple in duplicte: noise vrints chnged between duplictes, but genuine muttions were present in both (not shown). In clinicl prctice, we will sequence mrginl qulity specimens in duplicte to distinguish genuine muttions from noise. Some mplicons consistently showed lower levels of both of these types of noise, so it is possible tht, in the future, different sensitivity cutoffs could be used for different mplicons. The sensitivity of the ssy did not depend on the smple type. In theory, smple types could differ either in coverge or in noise levels. Coverge for FFPE smples ws comprble to tht for FNA nd PB/BM smples (Tble 1). Furthermore, known muttion in n FFPE smple ws detected t the expected frequency when it ws diluted into norml PB smple, indicting tht the FFPE DNA ws not underrepresented in the librry, even when mplified in competition with PB DNA. The FFPE smples lso did not exhibit higher levels of noise bove the 5% limit thn did FNA or PB/BM smples (Supplementl Figure S2). Different cncer types hve been found to be more frequently ssocited with muttions in prticulr genes, which underlies the fundmentl ide of personlized medicine. To ssess whether the detected muttions conformed to expecttions bsed on prior reserch, we grouped specimens by dignosis nd compred the results to well-known, disese-dependent muttion profiles. A summry of the muttion profile nd the 6 cncer types covered by the vlidtion specimens cn be found in Supplementl Tble S1. Recurrently mutted genes identified t the 5% sensitivity level re mong the most frequently mutted genes for the respective cncer types ccording to the COSMIC dtbse. 17 For instnce, in CRC specimens (n ¼ 19), recurrently mutted genes identified included APC (n ¼ 14; 74%), TP53 (n ¼ 11; 58%), KRAS (n ¼ 11; 58%), PIK3CA (n ¼ 4; 21%), BRAF (n ¼ 2; 11%), nd SMAD4 (n ¼ 2; 11%). Somtic muttions cusing loss of function of APC hve been reported in most spordic CRCs, indicting role in initil clonl expnsion. 22 The prognostic significnce of APC in CRC is currently uncler. A study mong Tiwnese ptients with CRC indicted tht APC muttion crriers hd lower rtes of clinicl survivl fter 5-fluorourcil djuvnt chemotherpy 23 ; TP53 muttions hve been found in 43% of CRC cses, 17 with the prognostic vlue being complex nd dependent on the primry tumor site. 24 Hot-spot muttions in KRAS (codons 12 nd 13) nd BRAF (V600E) re routine clinicl testing trgets before prescribing nti- EGFR ntibody for CRC. PIK3CA muttions hve been reported to be ssocited with poor prognosis mong ptients with curtively resected colon cncer. 25 In recent study of 964 ptients with CRC, it ws found tht spirin therpy ws ssocited with longer survivl mong ptients with mutted PIK3CA by down-regulting PIK3CA signling ctivity. 26 SMAD4 muttions hve been found in 14% of CRC cses nd indicte poor prognosis. 27 A mjor remining chllenge for clinicl next-genertion sequencing is to ccurtely clssify ech vrint ccording to its function in disese. Gene pnels with limited disese ssocition scope, such s the one presented here, contin only genes with known connections to the condition(s) of interest. This mkes it less burdensome, but by no mens esy, to clssify vrints. In some cses, informtion cn be glened from references collected in dtbses such s COSMIC, nd in other cses, the nnottion cn be inferred from bsic knowledge of the protein functionl domins nd pthwys. However, in mny instnces, the functionl effect of given mino cid chnge will remin inconclusive until more informtion becomes vilble. 1 To fcilitte the physicl process of vrint ssessment nd reporting, we built n in-house, PHP-MySQL bsed, softwre ppliction designted ClinMut Reporter tht ws vlidted s prt of the pn-cncer muttion pnel described here. This ppliction extrcts informtion on vrint identity, position, frequency, nd coverge from the instrument generted lignment files nd removes synonymous vrints s well s common SNPs with minor llele frequency greter thn 1% in the generl popultion. The remining muttions re displyed long with nnottions, such s COSMIC ID nd the functionl chnge, tht is, missense, frmeshift, mong others. Lbortory directors cn further clssify ech vrint ccording to predicted pthogenicity bsed on vilble literture. After review nd pprovl by the responsible pthologist, report cn be instntly generted for ech ptient s clinicin tht further detils informtion bout the mutted genes, protein pthwys, disese links, nd ongoing clinicl trils relted to the detected vritions. Severl multicenter studies hve shown sufficient robustness of even highly complex next-genertion sequencing ssys for clinicl use. 28,29 Coupled with multiplex librry preprtion nd/or utomtion, the complexity is drsticlly reduced, nd especilly the smller pltforms re mking Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l 515

9 rpid hedwy into clinicl lbortories. The clonl nture of next-genertion sequencing llows for incresed sensitivity s well s the bility to phse cis/trns vrints. Incresed sensitivity is criticl for pplictions such s detecting somtic vrints in mixed tissues, 19 trcking miniml residul disese for lymphocyte clonlities, 30 nd finding drug-resistnt retrovirl qusispecies. 31 Phsing is crucil to experiments involving 16S nd humn leukocyte ntigen, but resolution t the moleculr level cn lso give importnt indictors of pthogenicity when 2 deleterious vrints cn be shown to occur on seprte lleles. In the present dt set, we could distinguish 2 truncting TP53 muttions in 2 distinct red popultions from the sme specimen (dt not shown). Although it is possible tht the 2 muttions occurred in seprte subpopultions, it is likely tht both copies of this importnt tumor suppressor gene were ffected. The prlleliztion inherent in next-genertion sequencing mens tht, for the technology to be cost effective, threshold number of specimens must be collected. To decrese turnround times for the processing of clinicl specimens, we intend to lso vlidte specific combintions of ssys on single instrument run, which will use the lrge cpcity nd minimize the cost per smple. This cn be esily ccomplished by ssigning specific groups of moleculr brcode indices to ech ssy ensuring tht the bioinformtics pipeline cn correctly sort nd nlyze the dt. Multiplex genertion of mplicons, such s the extension/ligtion process underlying both TruSeq technology nd moleculr inversion probes, 32 gretly reduces lbor time nd the potentil for humn error, both typicl pin points for clinicl lbortory opertions. However, becuse such multiplex librries re creted in single rection, ll mplicons must be generted under identicl PCR conditions in the mplifiction step. This leds to bis ginst difficult regions, for exmple, those with high GC content. Most of the low coverge mplicons tht we detected hd more thn 64% GC content (Supplementl Tble S3; Supplementl Figure S4), suggesting tht high GC content ws fctor in poor mplicon performnce. In the cse of TruSeq probes, ssy development is further hmpered by need to resynthesize the entire pool of oligonucleotides toreplcesingleprobe.thecostoflrge,customprobe librry mkes it prohibitive to perform empiricl optimiztion. As described in this report, even using commercilly vilble probe set in our hnds yielded suboptiml results for severl mplicons. For our future ssys, it is likely tht n intermedite strtegy involving severl different librry mplifictions per smple my be needed, or, lterntively, combintion of probe librry nd stndrd PCR mplicons to be pooled before the nextgenertion sequencing step. In conclusion, we hve successfully vlidted nextgenertion sequencing bsed pn-cncer pnel tht provided sensitive detection of vrints cross 42 genes. This powerful pproch to identifying lterntive therpies to moleculr trgets cn be effectively implemented in specilized clinicl lbortories. This project ws funded, in prt, by Thoms Jefferson University Hospitl, the Division of Genomic Pthology, the Deprtment of Pthology, Antomy, & Cell Biology, Thoms Jefferson University, nd grnt with the Pennsylvni Deprtment of Helth. The Pennsylvni Deprtment of Helth specificlly disclims responsibility for ny nlyses, interprettions, or conclusions. References 1. Rehm HL, Ble SJ, Byrk-Toydemir P; Working Group of the Americn College of Medicl Genetics nd Genomics Lbortory Qulity Assurnce Committee. ACMG clinicl lbortory stndrds for next-genertion sequencing. Genet Med. 2013;15(9): Grgis A, Klmn L, Berry M, et l. Assuring the Qulity of next-genertion sequencing in clinicl lbortory prctice. Nt Biotechnol. 2012;30(11): Grossmnn V, Roller A, Klein HU, et l. Robustness of mplicon deep sequencing underlines its utility in clinicl pplictions. J Mol Dign 2013;15(4): McCourt CM, McArt DG, Mills K, et l. Vlidtion of next genertion sequencing technologies in comprison to current dignostic gold stndrds for BRAF, EGFR, nd KRAS muttionl nlysis. PLoS One 2013;8(7):e doi: /journl.pone Singh RR, Ptel KP, Routbort MJ, et l. Clinicl vlidtion of nextgenertion sequencing screen for muttionl hotspots in 46 cncer-relted genes. J Mol Dign. 2013;15(5): Luthr R, Ptel KP, Reddy NG, et l. Next-genertion sequencing-bsed multigene muttionl screening for cute myeloid leukemi using MiSeq: pplicbility for dignostics nd disese monitoring. Hemtologic. 2014; 99(3): Wgle N, Berger MF, Dvis MJ, et l. High-throughput detection of ctionble genomic ltertions in clinicl tumor smples by trgeted, mssively prllel sequencing. Cncer Discov. 2011;2(1): Bedling C, Neff TL, Heinrich MC, et l. Combining highly multiplexed PCR with semiconductor-bsed sequencing for rpid cncer genotyping. J Mol Dign. 2013;15(2): Cheng YD, Yng H, Chen GQ, Zhng ZC. Moleculrly trgeted drugs for metsttic colorectl cncer. Drug Des Devel Ther. 2013;7: Hoyle M, Peters J, Crthorne L, et l. Cost-effectiveness of cetuximb, cetuximb plus irinotecn, nd pnitumumb for third nd further lines of tretment for KRAS wild-type ptients with metsttic colorectl cncer. Vlue Helth. 2013;16(2): Rvnn MC, Mtlk MS. Vemurfenib in ptients with BRAF V600E muttion-positive dvnced melnom. Clin Ther. 2012;34(7): Ski K, Horiike A, Irwin DL, et l. Detection of epiderml growth fctor receptor T790M muttion in plsm DNA from ptients refrctory to epiderml growth fctor receptor tyrosine kinse inhibitor. Cncer Sci. 2013;104(9): Ascierto PA, Schdendorf D, Berking C, et l. MEK162 for ptients with dvnced melnom hrbouring NRAS or Vl600 BRAF muttions: nonrndomised, open-lbel phse 2 study. Lncet Oncol. 2013;14(3): Robles AI, Hrris CC. Clinicl outcomes nd correltes of TP53 muttions nd cncer. Cold Spring Hrb Perspect Biol. 2010;2(3): doi: / cshperspect Brnett DW, Grrison EK, Quinln AR, Strömberg MO, Mrth GT. BmTools: Cþþ API nd toolkit for nlyzing nd mnging BAM files. Bioinformtics. 2011;27(12): Thorvldsdóttir H, Robinson JT, Mesirov JP: Integrtive Genomics Viewer (IGV): high-performnce genomics dt visuliztion nd explortion. Brief Bioinform. 2013;14(2): Forbes SA, Tng G, Bindl N, et l. COSMIC (the Ctlogue of Somtic Muttions in Cncer): resource to investigte cquired muttions in humn cncer. Nucleic Acids Res. 2010;38(dtbse issue):d652 D657. doi: / nr/gkp Mrdis ER. Next-genertion sequencing pltforms. Annu Rev Anl Chem (Plo Alto Clif). 2013;6: doi: /nnurev-nchem Thoms RK, Nickerson E, Simons JF, et l. Sensitive muttion detection in heterogeneous cncer specimens by mssively prllel picoliter rector sequencing. Nt Med 2006;12(7): Milbury CA, Correll M, Quckenbush J, Rubio R, Mkrigiorgos GM. COLD-PCR enrichment of rre cncer muttions prior to trgeted mplicon resequencing. Clin Chem. 2012;58(3): Thitis AC, Norris-Kirby A, Rich RG, et l. Comprison of Snger sequencing, pyrosequencing, nd melting curve nlysis for the detection of KRAS muttions. Dignostic nd clinicl implictions. J Mol Dign. 2010;12(4): Fodde R. The APC gene in colorectl cncer. Eur J Cncer. 2002;38(7): Chen SP, Wu CC, Lin SZ, et l. Prognostic significnce of interction between somtic APC muttions nd 5-fluorourcil djuvnt chemotherpy in Tiwnese colorectl cncer subjects. Am J Clin Oncol. 32(2): Russo A, Bzn V, Icopett B, et l; TP53-CRC Collbortive Study Group. The TP53 colorectl cncer interntionl collbortive study on the prognostic nd predictive significnce of p53 muttion: influence of tumor site, type of muttion, nd djuvnt tretment. J Clin Oncol. 2005;23(30): Arch Pthol Lb Med Vol 139, April 2015 NGS Cncer Pnel Vlidtion Simen et l