p14 Methylation in Human Colon Cancer Is Associated With Microsatellite Instability and Wild-Type p53

Transcription

1 GASTROENTEROLOGY 2003;124: p14 Methylation in Human Colon Cancer Is Associated With Microsatellite Instability and Wild-Type p53 LANLAN SHEN, YUTAKA KONDO, STANLEY R. HAMILTON, ASIF RASHID, and JEAN PIERRE J. ISSA Departments of Leukemia and Pathology, The University of Texas at M. D. Anderson Cancer Center, Houston, Texas Background & Aims: Colorectal cancers with high levels of microsatellite instability (MSI-H) have an unexplained low rate of p53 gene mutations. Most such cancers have the CpG island methylator phenotype (CIMP ) with methylation and transcriptional silencing of the mismatch repair gene MLH1. The p14 (ARF) gene on chromosome 9p is deleted and/or silenced by hypermethylation in a subset of human malignancies. There is evidence suggesting that p14 suppresses tumorigenicity by stabilizing the p53 protein. Methods: We investigated the role of p14 in colorectal cancer by determining its methylation status in cancers that were studied previously for microsatellite instability, CIMP, and mutations of p53 and K-RAS. Results: p14 methylation was present in 21 of 94 cases overall (22%) and was frequent particularly in the subgroups with MSI-H (52% [11 of 21] vs. 14% [10 of 72], P 0.004), in CIMP cases (40% [19 of 48] vs. 4% [2 of 46], P < 0.001), and in cases without p53 alterations (36% [17 of 47] vs. 7% [3 of 44], P 0.004). Of 91 fully characterized cases, 41 (45%) had p53 mutations alone, 17 (19%) had p14 methylation alone, 30 (33%) had neither, but only 3 (3%) had both p53 mutations and p14 methylation. p14 methylation is an early event in colorectal carcinogenesis, being detectable in normal aging epithelium by using sensitive assays. Conclusions: In colorectal cancer, p14 methylation is associated with the presence of microsatellite instability and with absence of p53 mutations. The results provide a possible explanation for the paucity of p53 mutations in colon cancers with microsatellite instability. Colorectal cancers with high levels of microsatellite instability (MSI-H) form a distinct subgroup characterized by numerous mutations in nucleotide repeats, mismatch repair deficiency, and a generally favorable clinical outcome. 1 Sporadic MSI-H cancers usually arise as a result of promoter methylation associated epigenetic inactivation of the MLH1 nucleotide mismatch repair gene. 2 In turn, this hypermethylation is part of a specific methylation defect in colon cancers that affects multiple genes and has been termed the CpG island methylator phenotype (CIMP). 3 A puzzling feature of MSI-H cases has been a low rate of p53 gene mutations 4 7 despite the known central role this gene plays in human carcinogenesis, and the generally high (50%-70%) rate of p53 mutations in colorectal cancer. 8 p14 (also known as p14arf) was identified originally as an alternatively spliced form of the p16 INK4A gene. 9 However, p14 splices into an alternate reading frame in the p16 coding sequence, creating a totally different protein with distinct properties. p14 is inactivated in various cancers through homozygous deletion, promoter methylation, or (rarely) mutations. 10 In mouse models, specific disruption of p14 is highly tumorigenic. p14 interacts physically with MDM2 and stabilizes the p53 protein in the nucleus by blocking its cytoplasmic transport and MDM2-mediated degradation, indicating that it acts as an upstream regulator of p53 function. 10,12 14 Based on this, it has been suggested that p14 inactivation is an alternate mechanism of disrupting the p53 pathway. 12,13 In bladder cancer, p14 inactivation is correlated inversely with p53 mutations, which supports this concept. 15 p14 inactivation also is associated with sensitivity to infection by the ONYX-015 virus, which specifically targets p53-deficient cells. 16 In the current study, we sought to test the hypothesis that MSI-H colon cancers have a high rate of p14 inactivation to explain their low rate of p53 mutations. Indeed, we found a strong positive association between p14 methylation and CIMP, particularly in MSI-H cases, and a strong inverse association with p53 mutations. Our data support the model of p53-related p14 function and explain the rarity of p53 mutations in MSI-H cases. Abbreviations used in this paper: COBRA, combined bisulfite restriction analysis; MSI, microsatellite instability; MSI-H, MSI-high; MSP, methylation sensitive PCR; MSS, microsatellite stable; CIMP, CpG island methylator phenotype; PCR, polymerase chain reaction by the American Gastroenterological Association /03/$30.00 doi: /gast

2 March 2003 p14 METHYLATION IN COLON CANCER 627 Materials and Methods Tissue Samples and Cell Lines Tumor samples and corresponding adjacent tissues were collected from consenting patients in accordance with institutional policies, flash frozen, and stored at 70 C ina tumor bank. We have reported previously 3,6,17 on 100 colon cancers studied for the presence of CIMP, MSI (determined according to strict criteria, testing at least 5 markers, and requiring band shifts at both dinucleotide and mononucleotide tracts), p16 methylation, K-RAS codon 12 and 13 mutations (determined by the mutant-allele specific amplification assay), and p53 mutations (determined by single-stranded conformational polymorphism analysis of exons 4-9 followed by sequencing of all shifted bands). This group consisted of 93 unselected cases and 7 additional cases selected because they were MSI-H. All patients had apparently sporadic colorectal cancer, and none fulfilled the Amsterdam criteria for hereditary nonpolyposis colorectal cancer. Of these 100 cases, DNA was available from 94 cases and all were included in the current report. Normal colonic mucosa was available from an additional group of 17 patients who had colonic resection for nonneoplastic reasons, and these were included as controls. The HCT116, RKO, SW48, and Caco2 cell lines were obtained from the American Type Culture Collection. DNA was extracted from fresh-frozen tissues and cell lines by using a standard phenol-chloroform method. Cell lines were treated with 5-aza-deoxycytidine (Sigma, St. Louis, MO) at 1-5 mol/l concentration for 3-5 days for the demethylation experiments. Bisulfite-Polymerase Chain Reaction Analysis Bisulfite treatment of DNA was performed as previously described. 18 We used combined bisulfite restriction analysis (COBRA) 19 to study p14 methylation in all cases. In brief, bisulfite-modified DNA is amplified by polymerase chain reaction (PCR) and the PCR products are incubated with restriction enzymes that digest only methylated alleles. This method allows the quantification of the methylation density, which is the % of methylated (restricted) vs. unmethylated (unrestricted) PCR products. The primers: TTTYGGGGYGGAGATGGGT (sense) and ATCAC- CAAAAACCTACRCACCATATTC (antisense) were used to amplify a 160-bp fragment of the p14 promoter (Figure 1). These primers amplify a fragment from 63 to 51 relative to the putative transcription start site, and were based on GenBank AC The restriction enzymes TaqI or FNU4HI were used to determine the methylation status of this region. In this analysis, these enzymes only digest methylated alleles. The TaqI enzyme used for most restriction analyses corresponds to 46 of the putative transcription start site and 74 of the translation start site. All restriction products were visualized by 6% polyacrylamide gel electrophoresis followed by staining with ethidium bromide, and imaging/quantitation using a Bio- Figure 1. Hypermethylation and silencing of p14 in colon cancer. (A) On the top is shown a diagram of the CpG island of p14. Each vertical line represents a single CpG site. The location of p14 exon 1 is shown. The arrow indicates putative transcription initiation sites. Thick bars on top indicate the location of MSP and COBRA primers. (B) Methylation of p14 in colon cancer cell lines by CO- BRA. The restriction enzymes FNU4HI (F) or TaqI (T) were used to determine the methylation status of this region whereas (B) BstUI, which has no cutting site in this fragment, was used as a negative control. Arrows point to digested bands, which indicate methylated alleles. Note that Caco2 is unmethylated, HCT116 is partially methylated, and RKO and SW48 are highly methylated. (C) Correlation between p14 methylation and gene expression. Shown are the results of reverse-transcription PCR studies using limited cycle numbers for p14 or glyceraldehyde-3-phosphate-dehydrogenase H (used as an RNA integrity control). C, control; D, DAC treatment; T, TSA treatment; DT, DAC TSA treatment. Note silencing in SW48 and RKO, moderate induction with DAC but not TSA alone, and strong induction with the combination of DAC and TSA. (D) p14 methylation (by COBRA) in primary colorectal cancer. Methylation was measured as in (B), using TaqI. RKO was included as a positive control. Normal mucosa for all these patients had no methylation using this assay (data not shown). An arrowhead indicates the methylated alleles, present in T8-T12 but absent in T1-T7. Rad Geldoc 2000 imager (BioRad, Hercules, CA). The identity of the amplified fragment was verified by digestion with multiple restriction enzymes. Set-up of the PCR assays included negative and positive controls, mixing experiments to rule out bias, and repeat experiments to assess reproducibility. In addition to this COBRA assay, we also used a published methylation sensitive PCR (MSP) assay 20 in selected cases to compare with the COBRA results.

3 628 SHEN ET AL. GASTROENTEROLOGY Vol. 124, No. 3 MSP-PCR products also were visualized on acrylamide gels as described earlier, and quantitated by densitometric determination of the density of the band in the methylated lane divided by the sum of the bands in both methylated and unmethylated lanes. In selected cases, MSP-PCR products from the methylated primers were cloned using a TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced in the MD Anderson Core Sequencing Facility. Reverse-Transcription Polymerase Chain Reaction Total RNA was extracted using Trizol according to the manufacturer s protocol, followed by treatment with DNase. Six micrograms of total RNA were used as a template to generate complementary DNA (cdna) by random hexamers and M-MuLV reverse transcriptase (Roche, Indianapolis, IN). Reverse-transcription samples without reverse transcriptase also were used in each case as negative controls. One thirtieth of cdna product was used to amplify a 306-bp product of glyceraldehyde-3-phosphate-dehydrogenase gene as an RNA quality control. The primers for glyceraldehyde-3-phosphatedehydrogenase were: CGGAGTCAACGGATTTGGTCGTAT (sense); AGCCTTCTCCATGGTGGTGAAGAC (antisense). One tenth of the cdna was used to amplify a 254-bp product of the p14 gene. The primers for p14 were GGTTTTTCGT- GGTTCACATCCCGCG (sense), and CAGGAAGCCCTC- CCGGGCAGC (antisense). Statistics Differences in means were evaluated by using the Student t test (Microsoft Excel; Microsoft, Redmond, WA) and differences in frequencies were evaluated by using the Fisher exact test (Statistica; Statsoft, Tulsa, OK). Methylation vs. age was analyzed by logistic regression analysis (Microsoft Excel). All reported P values are 2-sided, and a P value 0.05 was considered statistically significant. Results A Quantitative p14 Methylation Assay Methylation assays vary in their sensitivity, which sometimes affects reproducibility of results. Bisulfite conversion coupled with PCR and restriction fragment length polymorphism (COBRA) is a robust quantitative assay that usually requires substantial methylation for detection in primary tissues, and therefore is associated strongly with gene silencing. We used a set of primers to amplify the 5 region of the p14 promoter and coupled these with restriction enzymes that digest only methylated alleles. A diagram of the p14 promoter showing CpG sites, primer location, and restriction enzyme location is shown in Figure 1A. As shown in Figure 1B, this assay detected methylation of p14 in 3 of 4 colon cancer cell lines, and mixing experiments showed a linear relationship between methylation of input DNA and the methylation measurements (data not shown). Moreover, the HCT116 cell line showed partial methylation only, which is consistent with the fact that it has one allele mutated at this locus, 21 and thus only requires methylation of the wild-type allele to achieve inactivation. p14 methylation in cell lines correlated well with gene silencing, and this silencing could be relieved by the demethylating drug 5-aza-deoxycytidine alone or in combination with the histone deacetylase inhibitor trichostatin A (Figure 1C). In cell lines, there was a perfect concordance between methylation measured by COBRA and methylation measured by the more sensitive assay MSP at 35 cycles (data not shown). p14 Methylation in Primary Colorectal Cancers We measured p14 methylation in 94 cases of colorectal cancer (examples in Figure 1D) and adjacent (nonneoplastic) mucosa in a subset of these. p14 had no detectable methylation in all 20 mucosal samples studied using the COBRA assay. By contrast, there was substantial p14 methylation in a subset of cancers (median methylation 0%; mean methylation 7.2%; range, 0% to 46%). Because low levels of methylation have an uncertain biologic significance and can be found in normal tissues (see later), we used a cut-off level of 10% to call a case positive for p14 methylation. By this analysis, p14 was methylated in 21 cases (22%) of colorectal cancer. By using MSP at 35 cycles of PCR amplification in a subset of 25 cases, we found that all cases positive by COBRA also were positive by MSP. However, 3 of 20 cases negative by COBRA were positive by MSP, likely reflecting the high sensitivity of this assay 22 (which can detect methylation at 1:1000 dilution). For clinicopathologic correlations, we analyzed the data both using p14 methylation as a continuous variable (i.e., no cut-off level), and as a categoric variable (with a cut-off level of 10% for positivity). The results of these parallel analyses essentially were identical (Table 1). p14 methylation in the cancer samples was not associated with sex, location in the colon, or stage of the disease. By using linear regression analysis of age and p14 as continuous variables, there was a weakly positive correlation between age and methylation in the cancers (R 0.2, P 0.059). As shown in Table 1, there was a trend toward higher p14 methylation in patients over age 60 years. A similar trend was seen if a cut-off of age 70 years was used.

4 March 2003 p14 METHYLATION IN COLON CANCER 629 Table 1. p14 Methylation and Clinicopathologic Characteristics in Colon Cancer Variable N p14 methylation Mean (standard deviation) 95% confidence interval 10% (%) P Value Sex Men (13.3) (22) 0.65 Women (12.2) (22) Age (yr) (7.4) (9) (14.1) (26) Location Proximal (15.1) (26) 0.27 Distal (10.8) (16) Stage I II (12.3) (21) 0.32 III IV (10.7) (11) CIMP Positive (16.1) (40) Negative (5.9) (4) MSI Positive (18.3) (52) Negative (9.4) (14) K-RAS Wild-type (14.3) (22) 0.50 Mutant (11.2) (21) p53 Wild-type (15.8) (36) Mutant (7.4) (7) NOTE. Shown is the mean, standard deviation, and 95% confidence interval for p14 measured as a quantitative variable. Also shown is the number of cases (and percent in each category) considered p14-methylation positive (based on methylation 10%). Two-sided P values were determined by the Student t test based on p14 methylation as a quantitative variable. Similar P values were obtained when considering p14 methylation as a qualitative variable with a 10% cut-off level (not shown). One cancer sample was missing MSI data, and 3 were missing p53 data. p14 Methylation and Molecular Characteristics of the Tumors We next compared p14 methylation with molecular changes in the tumors, including CIMP, MSI-H (vs. microsatellite stable [MSS]), p53 mutations, and K-RAS mutations (Table 1). As earlier, these comparisons were performed by using p14 as a continuous variable or categoric variable in parallel, with identical results. p14 methylation was associated significantly with CIMP, being present in 19 of 48 (40%) CIMP cases vs. 2 of 46 (4%) CIMP cancers (P 0.001). There was also a strong association between p14 methylation and microsatellite instability: p14 methylation was found in 11 of 21 (52%) MSI-H cases vs. 10 of 72 (14%) cases without MSI. This association was particularly striking when we considered both CIMP and MSI: p14 ARF was methylated in 69% (11 of 16) of CIMP /MSI-H cases, 25% (8 of 32) of CIMP /MSS cases, 0% (0 of 5) of CIMP / MSI-H cases, and 5% (2 of 40) of CIMP /MSS cases (Figure 2). There was no association between p14 methylation and K-RAS mutations (Table 1). By contrast, there was a strong inverse relation between p14 methylation and p53 mutations. p14 was methylated in 36% (17 of 47) of cases without p53 mutations vs. 7% (3 of 44) of cases with p53 alterations (P 0.004). Of 91 cases fully characterized for both p53 and p14, 41 (45%) had p53 mutations alone, 17 (19%) had p14 methylation alone, 30 (33%) had neither, but only 3 (3%) had both p53 mutations and p14 methylation (Figure 2). p14 Methylation in Colonic Mucosa The origin of p14 methylation in cancer is unknown. As mentioned earlier, little methylation can be observed in normal tissues using a quantitative assay. However, it is possible that this methylation still originates in normal aging colon, as reported for several genes 23 including MLH1, 24 but remains below the threshold of detection using COBRA. To address this issue, we used MSP with 40 cycles of amplification to increase the sensitivity of the assay. As shown in Figure 3A, using this assay, p14 is methylated in a subset of cells in the colonic mucosa of older individuals. Moreover, p14 methylation appeared to be accentuated in the normal mucosa of 2 patients with ulcerative colitis, as reported for multiple other genes. 25 We cloned the MSP-

5 630 SHEN ET AL. GASTROENTEROLOGY Vol. 124, No. 3 significant variability is present, as evidenced by the scatter in the group of individuals over 70 years of age. Some degree of methylation could be observed in patients without clinical evidence of colon cancer, but the sample is too small to determine whether this group has lower levels of methylation overall. Figure 2. p14 methylation and CIMP, microsatellite instability, and p53 mutations in colon cancer. (A) Bar graph of p14 methylation in subgroups of colon cancer that are CIMP or CIMP, and MSI-H positive, or negative (MSS). Gray bars indicate the frequency of p14 methylation. The actual number of methylated cases in each group is shown below the bars. For comparison, black bars indicate p53 mutations in each group. One cancer sample was missing MSI data, and 3 were missing p53 data. (B) Inverse correlation between p14 methylation and p53 mutations in colon cancer. PCR products obtained from the methylated primer pair in 2 cases. Sequencing of the PCR products confirmed the presence of dense methylation in this area (data not shown). To better characterize this phenomenon, we quantitated p14 methylation measured by MSP using densitometry, realizing that this assay significantly overestimated the actual degree of methylation in positive cases. We studied the normal mucosa of 28 patients with colorectal cancer and 17 patients who had no evidence of cancer of the colon. In this sample, there was a positive correlation between age and methylation (R 0.3, P 0.045). The data, plotted in Figure 3B, indicate a general association between methylation and age, although a Discussion Our results clearly show an inverse relationship between p14 methylation and p53 mutations in sporadic colorectal cancer, and provide additional support for the hypothesis that p14 inactivation is equivalent functionally to p53 mutations in abrogating the p53 pathway. 12,13 These results, along with the high frequency of p14 methylation in sporadic colorectal cancers with MSI-H provide an attractive explanation for the puzzling lack of p53 mutations in MSI-H cases. Thus, given that most sporadic MSI-H cases evolve along a hypermethylator pathway 26 (CIMP), inactivation of p14 in these tumors likely would be considerably easier than in CIMP cancers. In turn, p14 methylation obviates the need for p53 mutations and reduces the selective advantage such mutations would have in MSI-H cancers. By contrast, in CIMP cases, the likelihood of p14 methylation is low, and p53 mutations would then provide a strong selective advantage; hence, their frequency in this setting. These results also provide an attractive explanation for the observed inverse relationship between CIMP and p53 mutations in colorectal cancer. 6 Of note, however, we have not studied cases with MSI-associated familial colorectal cancer here, and it is not known whether these will have similar rates of p14 methylation as that described here. The data presented here support previous observations of an inverse correlation between p53 mutations and p14 methylation in bladder cancer 15 and in hepatocellular carcinoma. 27 However, our results are distinctly different from the data in colorectal cancer presented by Esteller et al. 20 The reasons for these differences are not entirely clear. We used a different and less-sensitive assay for p14 methylation. Given that some degree of methylation is observed frequently in the colonic mucosa of older individuals, it is possible that a very sensitive and nonquantitative assay might overestimate methylation and blur functional associations. Interestingly, using a similar MSP assay, an inverse correlation was observed between p14 inactivation and p53 mutations in lung cancer cell lines but not in primary lung tumors. 28 Again, in primary tumors, it may be difficult to tease out low-level age-related methylation from epigenetic inactivation us-

6 March 2003 p14 METHYLATION IN COLON CANCER 631 Figure 3. p14 methylation in colon mucosa. (A) p14 methylation analysis in colonic mucosa using MSP with 40 cycles of amplification. M, PCR products amplified by methylated-specific primers; U, PCR products amplified by unmethylated-specific primers. The age of each patient is shown on the top, and the percentage of methylation is shown below each lane. IBD, inflammatory bowel disease. Note that the 4 patients under age 50 years had no methylation (top), whereas patients over age 80 years had substantial methylation by this sensitive assay (middle). Two patients with inflammatory bowel disease also had substantial methylation despite their young age (bottom). (B) p14 methylation vs. age in colonic mucosa. The percentage of methylation in each mucosa was measured by the density of the methylated band divided by the sum of the methylated band and unmethylated band. This % methylation is plotted against the age of each patient. Circles indicate the unaffected mucosa of 28 patients with colorectal cancer, and squares indicate the mucosa of 17 control patients who had no evidence of colon cancer. Note a general increase in % methylation with age. This assay is very sensitive and overestimates the degree of methylation. Thus, although the actual % number appears high, the relative number of affected cells is actually very low (based on quantitative assays). ing very sensitive assays. In the current study, we also chose to include a higher number of sporadic MSI-H cases, which may have facilitated the identification of the observed inverse correlation between p53 mutations and p14 methylation. It is worth noting that the 2 colorectal cancer cell lines commonly used to study p14 methylation (RKO and SW48) are both MSI-H and have wildtype p53, in accordance with our observations in primary tumors. It has been shown previously that p14 methylation does not have a direct impact on p16 expression, and vice versa. 29,30 This is related to the fact that the 2 promoters are far from each other, and that promoter methylation in human cells appears to affect transcription initiation rather than elongation. 31 Silencing of p16 by hypermethylation is more frequent in colorectal cancer than silencing of p14. However, in our study, comethylation of both genes was found in some cases, which would then be expected to silence both genes. In fact, p14 and p16 function in distinct pathways, 13,14 and comethylation (or indeed codeletion) may well provide a greater selective advantage than methylation of either gene alone. The causes of p14 methylation remain unclear. Association of methylation of this gene with CIMP suggests that its inactivation is governed by factors shared with several other genes, including p16 (as shown here and previously observed 32 ), MLH1, and THBS1. p14 methylation also has been observed previously in the setting of ulcerative colitis related pathology. 33 The relative rarity of p14 methylation in primary cancers in general and its specificity for CIMP cases argue in favor of a methylation defect as the root cause of the observed epigenetic inactivation in cancer. 23 However, using a sensitive assay, we also found some degree of p14 methylation in the nonneoplastic mucosa of older individuals, as observed for MLH1. 24 This is also consistent with the fact that patients with p14-methylated tumors tended to be older on average. Thus, there must be interplay between agerelated methylation, CIMP, and MSI in colorectal cancer. Perhaps a simple explanation is that age-related methylation predisposes genes to be affected by CIMP. Factors that govern the degree of p14 methylation in colonic mucosa, and its impact on tumor formation, remain to be determined. The inverse relationship between p14 methylation and p53 mutations continue to highlight the functional importance of epigenetic defects in cancer. It has been observed previously that an inverse association existed between mutation and methylation of a given gene (such as RB1 or VHL), strongly suggesting an equivalent

7 632 SHEN ET AL. GASTROENTEROLOGY Vol. 124, No. 3 selective advantage imparted by either event. 34 This inverse association has been extended to inactivation of specific pathways. For example, there appears to be an inverse relationship between p16 inactivation (which is largely by methylation) and RB1 inactivation (largely by mutations) in various cancers. 35 The current study provides an additional example of such functional equivalency between genetic and epigenetic defects, this time involving the p53 pathway. These data also raise caution as to what is truly a tumor or cell line with wild-type p53. In summary, we have shown that, in colorectal cancer, p14 methylation is associated with presence of microsatellite instability and with absence of p53 mutations. Moreover, p14 methylation can be detected in a small proportion of normal-appearing colonic mucosa cells and increases as a function of age. These results provide a possible explanation for the paucity of p53 mutations in colon cancers with microsatellite instability and have potential implications for risk assessment and prevention in colorectal cancer. References 1. Boland CR, Thibodeau SN, Hamilton SR, Sidransky D, Eshleman JR, Burt RW, Meltzer SJ, Rodriguez-Bigas MA, Fodde R, Ranzani GN, Srivastava S. A National Cancer Institute Workshop on microsatellite instability for cancer detection and familial predisposition: development of international criteria for the determination of microsatellite instability in colorectal cancer. Cancer Res 1998;58: Kane MF, Loda M, Gaida GM, Lipman J, Mishra R, Goldman H, Jessup JM, Kolodner R. Methylation of the hmlh1 promoter correlates with lack of expression of hmlh1 in sporadic colon tumors and mismatch repair-defective human tumor cell lines. Cancer Res 1997;57: Toyota M, Ahuja N, Ohe-Toyota M, Herman JG, Baylin SB, Issa JPJ. CpG island methylator phenotype in colorectal cancer. Proc Natl Acad Sci U S A 1999;96: Konishi M, Kikuchi-Yanoshita R, Tanaka K, Muraoka M, Onda A, Okumura Y, Kishi N, Iwama T, Mori T, Koike M, Ushio K, Chiba M, Nomizu S, Konishi F, Utsunomiya J, Miyaki M. Molecular nature of colon tumors in hereditary nonpolyposis colon cancer, familial polyposis, and sporadic colon cancer. Gastroenterology 1996; 111: Cottu PH, Muzeau F, Estreicher A, Flejou JF, Iggo R, Thomas G, Hamelin R. Inverse correlation between RER status and p53 mutation in colorectal cancer cell lines. Oncogene 1996;13: Toyota M, Ohe-Toyota M, Ahuja N, Issa JP. Distinct genetic profiles in colorectal tumors with or without the CpG island methylator phenotype. Proc Natl Acad Sci U S A 2000;97: Samowitz WS, Curtin K, Ma KN, Edwards S, Schaffer D, Leppert MF, Slattery ML. Prognostic significance of p53 mutations in colon cancer at the population level. Int J Cancer 2002;99: Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell 1996;87: Quelle DE, Zindy F, Ashmun RA, Sherr CJ. Alternative reading frames of the INK4a tumor suppressor gene encode two unrelated proteins capable of inducing cell cycle arrest. Cell 1995; 83: Sherr CJ. The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell Biol 2001;2: Kamijo T, Zindy F, Roussel MF, Quelle DE, Downing JR, Ashmun RA, Grosveld G, Sherr CJ. Tumor suppression at the mouse INK4a locus mediated by the alternative reading frame product p19arf. Cell 1997;91: Pomerantz J, Schreiber-Agus N, Liegeois NJ, Silverman A, Alland L, Chin L, Potes J, Chen K, Orlow I, Lee HW, Cordon-Cardo C, DePinho RA. The Ink4a tumor suppressor gene product, p19arf, interacts with MDM2 and neutralizes MDM2 s inhibition of p53. Cell 1998;92: Zhang Y, Xiong Y, Yarbrough WG. ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell 1998;92: Sharpless NE, DePinho RA. The INK4A/ARF locus and its two gene products. Curr Opin Genet Dev 1999;9: Markl ID, Jones PA. Presence and location of TP53 mutation determines pattern of CDKN2A/ARF pathway inactivation in bladder cancer. Cancer Res 1998;58: Yang CT, You L, Uematsu K, Yeh CC, McCormick F, Jablons DM. p14 (ARF) modulates the cytolytic effect of ONYX-015 in mesothelioma cells with wild-type p53. Cancer Res 2001;61: Ahuja N, Mohan AL, Li Q, Stolker JM, Herman JG, Hamilton SR, Baylin SB, Issa JP. Association between CpG island methylation and microsatellite instability in colorectal cancer. Cancer Res 1997;57: Clark SJ, Harrison J, Paul CL, Frommer M. High sensitivity mapping of methylated cytosines. Nucleic Acids Res 1994;22: Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res 1997;25: Esteller M, Tortola S, Toyota M, Capella G, Peinado MA, Baylin SB, Herman JG. Hypermethylation-associated inactivation of p14 (ARF) is independent of p16 (INK4a) methylation and p53 mutational status. Cancer Res 2000;60: Burri N, Shaw P, Bouzourene H, Sordat I, Sordat B, Gillet M, Schorderet D, Bosman FT, Chaubert P. Methylation silencing and mutations of the p14arf and p16ink4a genes in colon cancer. Lab Invest 2001;81: Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci U S A 1996;93: Issa JP. The epigenetics of colorectal cancer. Ann N Y Acad Sci 2000;910: Nakagawa H, Nuovo GJ, Zervos EE, Martin EW Jr, Salovaara R, Aaltonen LA, de la Chapelle A. Age-related hypermethylation of the 5 region of MLH1 in normal colonic mucosa is associated with microsatellite-unstable colorectal cancer development. Cancer Res 2001;61: Issa JP, Ahuja N, Toyota M, Bronner MP, Brentnall TA. Accelerated age-related CpG island methylation in ulcerative colitis. Cancer Res 2001;61: Toyota M, Issa JP. CpG island methylator phenotypes in aging and cancer. Semin Cancer Biol 1999;9: Tannapfel A, Busse C, Weinans L, Benicke M, Katalinic A, Geissler F, Hauss J, Wittekind C. INK4a-ARF alterations and p53 mutations in hepatocellular carcinomas. Oncogene 2001;20: Sanchez-Cespedes M, Reed AL, Buta M, Wu L, Westra WH, Herman JG, Yang SC, Jen J, Sidransky D. Inactivation of the INK4A/ARF locus frequently coexists with TP53 mutations in non-small cell lung cancer. Oncogene 1999;18: Robertson KD, Jones PA. The human ARF cell cycle regulatory

8 March 2003 p14 METHYLATION IN COLON CANCER 633 gene promoter is a CpG island which can be silenced by DNA methylation and down-regulated by wild-type p53. Mol Cell Biol 1998;18: Gonzalgo ML, Hayashida T, Bender CM, Pao MM, Tsai YC, Gonzales FA, Nguyen HD, Nguyen TT, Jones PA. The role of DNA methylation in expression of the p19/p16 locus in human bladder cancer cell lines. Cancer Res 1998;58: Jones PA. The DNA methylation paradox. Trends Genet 1999;15: Zheng S, Chen P, McMillan A, Lafuente A, Lafuente MJ, Ballesta A, Trias M, Wiencke JK. Correlations of partial and extensive methylation at the p14 (ARF) locus with reduced mrna expression in colorectal cancer cell lines and clinicopathological features in primary tumors. Carcinogenesis 2000;21: Sato F, Harpaz N, Shibata D, Xu Y, Yin J, Mori Y, Zou TT, Wang S, Desai K, Leytin A, Selaru FM, Abraham JM, Meltzer SJ. Hypermethylation of the p14 (ARF) gene in ulcerative colitis-associated colorectal carcinogenesis. Cancer Res 2002;62: Baylin SB, Herman JG, Graff JR, Vertino PM, Issa JPJ. Alterations in DNA methylation a fundamental aspect of neoplasia. Adv Cancer Res 1998;72: Okamoto A, Demetrick DJ, Spillare EA, Hagiwara K, Hussain SP, Bennett WP, Forrester K, Gerwin B, Serrano M, Beach DH. Mutations and altered expression of p16ink4 in human cancer. Proc Natl Acad Sci U S A 1994;91: Received April 30, Accepted December 9, Address requests for reprints to: Jean-Pierre Issa, M.D., Department of Leukemia, MD Anderson Cancer Center, Box 428, 1515 Holcombe, Houston, Texas jpissa@mdanderson.org; fax: (713) Supported by research grants from the American Cancer Society (RPG MGO), the National Cancer Institute (R01 CA ), the George and Barbara Bush fund for innovative cancer research, and the Yasuda Medical Research Foundation and the Nitto foundation in Japan (to Y.K.). DNA sequencing in the MDACC core sequencing facility was supported by core grant CA16672 from the National Institutes of Health.