Suppression of in vivo tumor growth and induction of suspension cell death by tissue inhibitor of metalloproteinases (TEMP)-3

Transcription

1 Carcnogeness vol.17 no.9 pp , 1996 Suppresson of n vvo tumor growth and nducton of suspenson cell death by tssue nhbtor of metalloprotenases (TEMP)-3 Junhu Ban 1, Yul Wang 1, Mark R.Smth 2, Hyungtae Km 3, Chrstne Jacobs 1, Joany Jackman 4, Hsang-Fu Kung 5, Nancy H. Colburn 3 and Y Sun 1-36 'Department of Molecular Bology, Parkc-Davs Pharmaceutcal Research, A Dvson of Wamer-Lamber Company, Ann Arbor, M 48105, 2 Bologcal Carcnogeness and Development Program, SAC-Fredenck and 3 Cell Bology Secton, Laboratory of Vral Carcnogeness, Natonal Cancer nsttute, Frederck Cancer Research and Development Center, Frederck, MD 21702, 4 Department of Bochemstry and Molecular Bology, Georgetown Unversty, Washngton DC and 'Laboratory of Bochemcal Physology, Dvson of Basc Scence, NC-FCRDC, Frederck, MD, USA To whom correspondence should be addressed at: Department of Molecular Bology, Parke-Davs Pharmaceutcal Research, 2800 Plymouth Road, Ann Arbor, M 48105, USA Tssue nhbtor of metalloprotenases-3(temp-3), a novel member of TEMP famly genes, has been recently cloned and shown to be expressed n preneoplastc but not n neoplastc mouse JB6 epdermal cells (Sun et al Cancer Res., 54, 11139). Ths down regulaton of the gene appears to be attrbutable at least n part to alteraton of gene methylaton (Sun et al 1995 J. Bol Chem., 270, 19312). Lttle s known, however, about the role of TEMP-3 n human cancers. We screened several human tumor cell lnes for TEMP-3 expresson and found that a colon carcnoma lne, DLD-1, dd not express TEMP-3. f down regulaton of TMP-3 s causally related to carcnogeness, re-expresson by transfecton may reverse the tumor cell phenotype. We therefore overexpressed human TEMP-3 n DLD-1 cells. TEMP-3 transfectants showed a serum-dependent growth nhbton n monolayer culture and a decreased growth potental n nude mce n a manner dependent on the level of TEMP-3 expresson. A transfectant expressng a hgh level of actve htemp-3 completely lost the ablty to form tumors followng s.c. njecton nto nude mce. We also tested TEMP-3 expressng cells and neocontrol TEMP-3 negatve cells for ther ablty to grow n lqud suspenson culture, snce both cells grew n sem-sold soft agar. As compared to neocontrol cells, TMP-3 overexpressors formed large aggregates, followed by cell death. Ths effect was not mmcked by BB94, a broad MMP nhbtor. We conclude from ths study that () TEMP-3 overexpresson n human colon carcnoma cells nduces growth arrest n low serum condtons and nhbts n vvo tumor growth and () the TEMP-3-nduced large aggregate formaton and subsequent cell death under suspenson growth cannot be explaned by ts MMP nhbtory actvty. ntroducton Tssue nhbtor of metalloprotenases (TMPs*) desgnates a famly of genes consstng thus far of three members, Abbrevatons: TMPs, tssue nhbtor of metalloprotenases; MMP, matrx metalloprotenase; RT-PCR, reverse transcrptase-polymerase chan reacton; ECM, extracellular matrx; EMEM, mnmal essental medum eagle; FCS, fetal calf serum. TMP-1, TMP-2 and TMP-3 (1-10). The three members have dstnct sequences wth an overall homology of 40% and each gene s mapped to a unque chromosome. Human TMP-1 maps to the X chromosome at Xpll.l-Xpll.4 (11), human TMP-2 to chromosome 17q25 (12) and human TTMP- 3 to chromosome 22ql (8). Each TMP gene shows a unque expresson pattern n tssues (5,13) and s subject to dfferental regulaton (TMP-2 s consttutvely expressed, whle TMP-1 and TMP-3 are nducble) (5,7,13,14). Although there s only ~40% overall sequence dentty among the TMP famly genes, crtcal resdues have been conserved ncludng 12 cystenes whch form sx ntramolecular dsulfde bonds requred for the loop structure characterstc of TMP protens (15). As the naturally occurrng nhbtors of matrx metalloprotenases (MMP), all TMPs can nhbt MMP actvty although a degree of substrate specfcty exsts (3,5,13). An mbalance between TMPs and MMPs has been mplcated n some human dseases such as arthrts and tumor metastass (16). Besdes functonng as nhbtors of MMPs, TMPs have also demonstrated other bologcal functons whch may not be explaned by MMP nhbtory actvtes. TTMP-1 and -2 manfest growth stmulaton and/or growth nhbton actvtes n a cell lne specfc manner (17-21), whle TMP-3 s nvolved n cell cycle regulaton, dfferentaton and senescence (7). Recently, we and others have cloned the mouse and human TMP-3 genes usng dfferent approaches (4-10). Unlke TMP-1 and TMP-2, whch are secreted nto condtoned medum, TMP-3 s secreted yet t remans attached to the extracellular matrx (ECM). Ths unque subcellular locaton coupled wth ts nducblty by many agents (5,7,14) suggests mportant bologcal functons for TMP-3. We have recently found that mouse TMP-3 s specfcally not expressed n neoplastc JB6 cells (4) and that ths down regulaton of gene expresson appears to be accounted for by abnormal gene methylaton (14). We have therefore examned the potental nvolvement of TMP-3 n human cancers and reported here that TMP-3 functons as a tumor suppressor to nhbt n vvo tumor growth and a death nducer when grown n lqud suspenson culture n human colon carcnoma cells. Materals and methods Cell culture, RNA solaton and Northern analyss Human tumor cell lnes, DLD-1, HT-29, Saos-2, and HeLa were obtaned from the Amercan Type Culture Collecton and cultured as specfed. Nasopharyngeal carcnoma lnes, HONE-T-1, CNE 2 A15, human epdermal keratnocytes (Rhek) and ts H-ras transformed lne (Rhek-ras), prmary human embryonal kdney cell lne (293) were cultured as descrbed (22). SV40 large T antgen-mmortalzed human prostate lne (269) was cultured n serum-free RPM-1640 supplemented wth EGF (10 ng/ml), transferrn (5 ng/ml), nsuln (5 ng/ml), selenum (5 ng/ml) and dexamethasone (0.1 M). Cells were grown n 10% or 15% fetal calf serum up to 80% confluency and were harvested (wthout medum change) for total RNA solaton and Northern analyss as detaled prevously (23,24), usng human TMP-3 cdna as a probe. Vector constructon, DNA transfecton and stable transfectant selecton Human TMP-3 cdnas contanng the entre codng regon were obtaned from mmortalzed human keratnocytes (Rhek) by the RT-PCR technque Oxford Unversty Press 1805

2 J.Ban et al. (22,25). The pnmers used for PCR were htmp3.1a 5' GGAATTCATGACCCCTTGGCTCGGG and htmp02 5'GGAATTCAGGGTCTGGCGCTCAGGG. htmp-3 cdna generated by PCR was Eco Rl-dgested and subcloned nto the mammalan expresson vector pcdna3 (CMV promoter, nvtrogen, San Dego, CA). The entre htmp-3 cdna subcloned was sequenced to ensure the proper orentaton and freedom from RT-PCRntroduced mutatons. DNA was transfected by usng Lpofectn reagent (BRL) nto DLD-1 cells at 50-70% confluence n 60-mm dshes (26). Stable transfectants were selected wth Genetcn (G418, GBCO) at 600 Hg/ml. The level of exogenous httmp-3 n the transfectants was measured by Western anajyss. Western blot analyss Expresson levels of exogenous htmp-3 were examned n 8 TMP-3 transfectants and 3 vector controls by Western analyss as descrbed earler (14). Brefly, extracellular matrx (ECM), where TLMP-3 localzes (3,5), was solated by ncubatng cells wth a soluton contanng 10 mm EDTA/10 mm EGTA. An equal amount of ECM proten (1.25 ng), normalzed by a proten assay (27), was loaded onto a- PAGE gel and transferred onto a ntrocellular membrane. TMP-3 proten was detected wth peptde antbody made aganst an 18 amno acd peptde correspondng to the carboxyl termnal end of the mouse TMP-3 proten (there s one amno acd dfference between human and mouse n ths regon). Reverse zymography analyss TMP-3 actvty as a MMP nhbtor was measured by reverse zymography. The assay was performed as descrbed (28) wth some modfcatons. Brefly, ECMs from ether Dnl-3 or Do2-5 were harvested by a polceman after removng cells that were detached by the treatment of PBS contanng 10 mm EDTA and 10 mm EGTA. Proten samples were mxed wth 2XSDS sample buffer wthout reducng reagent and separated on 12% SDS-PAGE contanng 23% HT1080 cell condtoned medum and 1% gelatn. After electrophoress, the gel was washed twce (15 mn per wash) n 2.5% Trton X100, rnsed three tmes wth water and ncubated n X developng buffer (10 mm Tns.base, 40 mm Trs.HCl, 200 mm NaCl, 5 mm CaCl2 and 0.02% Brj 35) for 24 h at 37 C. The gel was then staned wth Coomasse blue and destaned wth 40% methanol/10% acetc acd/50% water. The punned human TMP-2 (0.5 (g, kndly provded by Dr. W.Stetler-Stevenson at the NC) was used as postve control. [3H]thymdne ncorporaton, soft agar assay and n vvo tumorgencty The percentage of transfectant cells n S-phase of the cell cycle was measured wth a [3H]thymdne ncorporaton assay (29). Brefly, cells were plated onto glass cover slps at 1X103 cells/ml n meda wth varous concentratons of fetal calf serum. The cultures were ncubated at 37 C for 44 h, pulsed wth [3H]thymdne (Amersham, 0 5 nc/ml) for 4 h, fxed n 3.7% glutaraldehyde (v/v PBS), and autoradographed for 48 h n Nuclear Trackng Emulson (Kodak). The percentage of 3H-labelled cells was montored by mcroscopc observaton randomly countng cells on each coverslp. The soft agar assay was performed as descrbed (26) wth serum concentratons at ether 10% or 7%. For n vvo tumorgencty, ether 7.5X 105 or 1.5X 10* cells from confluent monolayers were njected s.c. nto the upper back of athymc nude mce (Harlan-Sprague-Dawley). Tumor formaton and tumor sze were scored every week up to 9 weeks. Suspenson growth assay and BB94 treatment Confluent Dnl-3 and Do2-5 cells were trypsnzed and 5X10* suspended sngle cells were grown n 100 ml EMEM medum supplemented wth 10% fetal bovne serum n the str flasks wth contnuous strrng at the settng of three on a Mult-Str (Bellco Glass, nc. Vneland, NJ). One ml alquots of cell suspensons were taken each day followng suspenson growth (up to 7 days) and placed nto a 24-well culture plate for monolayer culture. Pctures were taken from these alquots ether 20 mn or 24 h after they grew n monolayer. For BB94 (batmastat, [4-(/V-hydroxyamno)-2R-sobutyl-3S(thenylthomelhyl-succnyl]-L-phenylalanne-/V-methylamde, PD163906) treatment, Dnl 3 cells were grown n suspenson as descrbed above n the presence of 20 um BB94 up to 7 days. Results Lack of htmp-3 expresson n colon carcnoma cells Snce mtmp-3 s expressed n preneoplastc but not neoplastc JB6 cells (4), mplyng ts possble nvolvement n multstage carcnogeness, we sought to study the nvolvement of human TMP-3 n human cancer. Several human tumor or transformed cell lnes orgnatng from colon, nasopharynx, bone, cervx, prostate, kdney, and foreskn were screened for mrna 1806 NPC Colon Kb -2.8 Kb -2.3 Kb Fg. 1. Lack of human TMP-3 expresson n colon carcnoma DLD-1 cells. Total RNA (15 ng) was solated from subconfluent human cell lnes and subjected to Northern blot analyss as descrbed n Materals and methods. Approxmately equal amounts of RNA were loaded as determned by the densty of rbosomal 28S and 18S (not shown). The sze of the TMP-3 mrna s ndcated. Saos-2, an osteogenc sarcoma lne; NPC, nasopharyngeal carcnoma cell lnes; Rhek, human epdermal keratnocytes; 293, prmary embryonal kdney lne; and prostate, an mmortalzed prostate lne (269). expresson of httmp-3 by Northern analyss. As shown n Fgure 1, expresson of TTMP-3 vared among the cell lnes. Lack of expresson was found n two out of two colon carcnoma lnes, DLD-1 and HT29. Other TTMP famly genes (TTMP-1, TMP-2) were not, however, down regulated as measured by Northern analyss (data not shown). These results ndcate that TMP-3 s the only member of TTMP famly genes not expressed n colon carcnoma cells. Establshment and characterzaton ofdld transfectants overexpressng TMP-3 To examne the possble role of TTMP-3 n colon carcnoma cells, we transfected htmp-3 cdna nto DLD-1 cells, along wth vector controls. Stable transfectants were selected after 3 weeks neo selecton and were assayed for TMP-3 proten expresson by Western blot. As shown n Fgure 2A, TTMP-3 was not expressed n the vector/neo-control cells (Dnl-1, Dnl-3), but was expressed at low levels n one transfectant clone (Do2-2) and at hgh levels n another clone (Do2-5). Other TMP-3 transfectants showed no expresson and were not used for further study (not shown). As a postve control, ECM from mouse JB6 preneoplastc cells (C141.5a), known to express a hgh level of mouse TTMP-3 (4) was ncluded. The amount of TTMP-3 proten n Do2-5 s comparable to that found n preneoplastc JB6 C141.5a cells. To test whether TTMP-3 hghly expressed n Do2-5 cells s bochemcally actve, we performed a reverse zymography assay, an assay for TTMP as an MMP nhbtor. As shown n Fgure 2B, an actve TMP-3 band can be seen n TMP-3 expressng Do2-5 cells, but not n the neo-control Dnl-3 cells. The purfed TTMP-2 proten, ncluded as a postve control for the assay, s ndcated n the Fgure. The result shows that the overexpressed TMP-3 seen on the Western blot s actually an actve form of TTMP-3, functonng as an MMP nhbtor. Changes n tumor cell phenotype dependent on TMP-3 expresson The stable transfectants shown n Fgure 2A were examned for potental changes n growth rate and tumor cell phenotype. The growth rate for all transfectants s the same as that of the parental lne DLD-1 at 15% serum durng exponental growth. All have doublng tmes of ~20 h (data not shown). However, when hgh densty cultures were grown n low serum meda, the TTMP-3 overexpressng lne (Do2-5) showed a serum

3 Tumor suppresson and death nducton by TMP-3 J 8 8 1t t S r N, - y- B c " r- ) CM C O Q Q O Q 46 KD Tmp-3 30 KO. - Tmp-2 TMP KD 14.3KD Fg. 2. Expresson of exogenous actve TMP-3 n transfectants. DLD-1 cells were transfected wth TMP-3 expressng construct, pcdna-3-tmp-3, along wth the vector control and stable transfectants selected as descrbed n Materals and methods. The TMP-3 proten expresson level was assayed by Western blot analyss (A) usng a peptde antbody made aganst C-termnal 18 amno acd peptde of the TMP-3 proten. Molecular weght markers (klodalton) and human TTMP-3 are ndcated wth arrows. A hgh TMP-3 expressng mouse cell lne, C141.5a was ncluded as a postve control. A reverse zymographc actvty assay (B) was performed to examne that TMP-3 expressed s actve n nhbtng MMPs. The TMP-3 hgh expressor, Do2-5 was used, along wth the neo-control Dnl-3. The purfed TMP-2 proten was used as a postve control for the assay. ndcated are actve TMP-3 n Do2-5 cell ECM and purfed TMP-2. The m stands for molecular sze marker. B <? 7*T - S ' ^^~" A. T/ o o o ll o o -DO 2-5 -DO 2-2 _ ao ON ON 1-3 Serum Concentraton % Dn1-1(neo) Dn1-3(neo) 3o2-2(T MP3) Do2-5(TMP3) TMP-3 transfectants Fg. 3. Growth of TMP-3 transfectants n monolayer culture and soft agar. (A) Serum-dependent growth of TMP-3 transfectants measured by [3H]thymdne ncorporaton assay: 1X105 cells/ml were seeded on glass cover slps and cultured wth varous concentratons of fetal calf serum for 44 h at 37 C. Cells were pulsed wth [3H]thymdne and thymdne ncorporaton was determned as descrbed n the Materals and methods. Four ndependent experments were performed n duplcate and error bars represent the standard devaton of the mean. (B) Anchorage ndependent growth of TMP-3 transfectants: 1 X104 sngle cells were suspended n 0.33% agar contanng 10% fetal calf serum n a 60 mm dsh. Colones of eght or more cells were counted after 14 days. Shown s the mean ± SE of the mean from three ndependent assays, each run n duplcate. dependent decrease n the percentage of cells enterng S-phase as determned by [3H]thymdne ncorporaton assay (Fgure 3A). At low serum concentratons (0.5% or 2%) only 12% or 27% of the TTMP-3 expressng cells were n S phase, respectvely, as compared to ~40-50% for the vector control cells (Fgure 3A). The TMP-3 low-expressor (Do2-2) cells dd not show a dfference from the vector controls, suggestng a threshold effect for the serum dependency of TMP-3 nhbton of trtated thymdne ncorporaton. Changes n tumor cell phenotype of the transfectants were examned by anchorage ndependent growth n agar and by n vvo tumorgencty followng subcutaneous njecton n nude mce. As shown n Fgure 3B, all transfectants grew n soft agar wth colony formng effcency of 60% at a serum concentraton of 10% (Fgure 3B) and 25% at 7% serum (data not shown). No dfferences n colony number and sze were observed among these transfectants. Ths result ndcates that overexpresson of TTMP-3 dd not change the ablty of the tumor cells to grow n sem-sold medum. When these cells, grown to confluence n monolayer, were njected nto nude mce (7.5X105 cells/mouse) to test for n vvo tumor formaton, a dramatc dfference was, however, revealed (Fgure 4, upper panel). The vector control clone (Dn 1-1) showed a latent perod for detectable tumor formaton of 3 weeks n three out of sx mce. The tumors contnued to grow and after 9 weeks, sx out of sx njected mce formed tumors. Clone Do2-2, the low TMP-3 expressor, also formed tumors at 3 weeks n two out of sx mce, but the tumors grew slowly and only those two mce out of sx had formed tumors after 9 weeks. n contrast, the hgh TMP-3 expressor, clone Do2-5 dd not form tumors at all n any of the sx njected mce wth the excepton of one mouse n whch a tumor 1807

4 J.Ban el al Days post rmoculaton O O Days post tmoculaton Fg. 4. nhbton of tumor cell growth n nude mce by overexpresson of htmp-3: 7.5X10 3 (upper panel) or 1.5 X10 6 (bottom panel) TMP-3 transfectant cells were grown to confluence and njected s.c. nto the upper back of athymc nude mce. Sx mce were njected n each expermental group. Growth of tumor cells was scored once a week. The error bars represent the standard error of the mean of tumor dameter. The numbers shown above or below the curve are the number of mce bearng tumors out of the sx mce njected per expermental group. Dnl-land Dnl-3 are vector controls; Do2-2 and Do2-5 are TMP-3 transfectants wth low and hgh levels of TMP-3 expresson, respectvely. formed at day 18 and regressed at day 25. The n vvo tumorgencty assay was repeated wth twce the number of njected cells (1.5X10 6 cells/mouse) and the results are shown n Fgure 4 (bottom panel). Vector controls, Dnl-1 and Dnl-3 showed a rapd tumor growth and a shorter latent perod as compared to Do2-2, a low level TMP-3 expressor. Although all sx mce recevng Do2-2 cells formed tumors, the tumors hardly grew, mantanng a small sze. Once agan, the Do2-5 lne wth a hgh level of TMP-3 expresson, dd not form tumors at all after 9 weeks. These results ndcate that () TTMP-3 has tumor suppressng actvty; and () tumor suppresson s seen only n the n vvo assay mplyng a requrement for systemc nfluences and/or cell-cell nteractons; () there s a TMP-3 concentraton dependency for nhbton of tumor growth; and (v) the cell number (0.75 X10 5 versus 1.5 X10 6 ) njected does not change the trends of n vvo tumor growth seen n TMP-3 postve and negatve cells Overexpresson of TMP-3 nduces formaton of large aggregates and subsequent cell death when grown n lqud suspenson culture Both TMP-3 expressng cells and neo-control cells are able to grow n sem-sold medum as shown n Fgure 3B. We then tested whether there s a dfference between TMP-3 postve and negatve cells under a more strngent condton, growth n lqud suspenson. Snce TMP-3 s an extracellular matrx proten (see Fgure 2A and ref. 5), growth under the condtons n whch extracellular matrx may not be necessary should reveal some functon, f any, of TMP-3 whch cannot be observed under normal crcumstance. Dnl-3 neo-control cells, whch showed the most malgnant phenotype n mce and Do2-5 cells whch have hgh level of TMP-3 expresson and have completely lost tumorgencty n nude mce were chosen for comparson. Fgure 5 showed morphologcal appearances of TMP-3 postve and negatve cells beng grown n suspenson for ndcated perods of tme. The cells were alquoted from the suspenson culture nto a 24-well plate and grown for 20 mn before pctures were taken. ndeed, suspenson growth nduces large cell aggregate formaton n TMP- 3 expressng Do2-5 cells, but not n TMP-3 negatve Dnl-3 cell. Both lnes begn to form aggregates after 3 days of suspenson growth. After 4 days, the sze of aggregates dfferentate between the two lnes, wth TMP-3 postve Do2-5 cells formng larger aggregates (not shown). Ths becomes more obvous at day 6 (bottom panel, compare Do2-5 on the rght column and Dnl-3 on the left). Formaton of large aggregates nduced by TMP-3 expresson was not mmcked by BB94, a broad MMP nhbtor wth Cso of 2-20 nm for nhbton of MMPs (30). Addton of BB94 nto TMP-3 negatve Dnl-3 cells at a nontoxc concentraton of 20 um (three magntudes hgher than the C 50 ) dd not sgnfcantly nduce the formaton of large aggregates (mddle column). To determne the vablty of these cells n aggregates, we grew them n monolayer culture for 24 h after they were n suspenson for 1, 3, or 5 days, respectvely. As shown n Fgure 6, after 3 days suspenson growth, Do2-5 cells n aggregates began to show sgns of cell death. Cells became detached and shrunken wth cell debrs seen (mddle panel on the rght). The cell death was more obvous after 5 days suspenson growth, wth large aggregates peelng off. TMP- 3 negatve Dnl-3 cells, n contrast, remaned healthy up to day 6 (Fgure 6, left column). Agan, addton of BB94 nto the growth medum of Dnl-3 cells dd not nduce cell death (data not shown). These results suggest that the MMP nhbtory actvty of TMP-3 does not account for the large aggregate formaton and subsequent cell death seen n TMP-3 expressng cells grown n suspenson. Dscusson The major fndngs presented n ths report are that overexpresson of TMP-3, an extracellular matrx proten causes () serum dependent growth nhbton; () complete suppresson of n vvo tumor growth; and () formaton of large cell aggregates and subsequent cell death when grown n lqud suspenson culture. Suppresson of n vvo tumor growth was dependent upon the level of TMP-3 expresson snce ths was more obvously seen n the hgh expressor (Do2-5), to a lesser extent n the low expressor (Do2-2), and not at all n the neocontrol cells (Dnl-1 and Dnl-3). Thus, expresson of

5 Tumor suppresson and death nducton by TMP-3 Dnl-3 (TMP3-) Dnl-3 +BB94 Do2-5 (TMP3+) Day 1 Day 3 Day 6 Fg. 5. Overexpresson of TMP-3 nduces large aggregate formaton n suspenson growth. Dnl-3 and Do2-5 cells were grown n suspenson for a varous tme and 1 ml alquots of cells were taken from the suspenson every day up to 7 days and grown n monolayer as descrbed n Materals and methods. Shown are pctures taken 20 mn followng monolayer culture n representatve areas. The day post suspenson growth s also ndcated. The left column s TTMP-3 negatve Dnl-3 cells, the mddle column s the Dnl-3 cells grown n suspenson n the presence of BB94 (20 M), and the rght column s TTMP-3 postve Do2-5 cells. The magnfcatons are X40 for days 1 and 3 photo, and X100 for day 6, respectvely. TMP-3 appears to play an actve role n suppresson of colon carcnoma DLD-1 cell growth. Although TMP-3 overexpressng cells faled to grow n nude mce, they dd grow n soft agar at serum concentratons of 10% or 7%. Ths apparent dscrepancy mght be explaned by the fact that TTMP-3 s an ECM proten and may be nvolved n cell-cell nteractons. n soft agar assays, a sngle cell suspenson s mxed wth agar and colones grow from sngle cells (wthout ntal cell-cell nteracton). n contrast, n the nude mouse tumorgencty assay, a mass of about one mllon cells s njected and n vvo cell-cell nteracton s possble. Alternatvely, the dssocaton between these two tumor cell phenotype assays may smply reflect the observaton sometmes seen n human cell models, that attanment of anchorage ndependent phenotype s not necessarly accompaned by tumorgencty, but s pretumorgenc. Suppresson of tumor growth and tumor cell nvason have been reported for other TMP famly genes n human and mouse melanoma cell lnes, human fbrosarcoma cells, and human colon carcnoma cell lnes SW480 and SW620 (3138). The mechansm of acton of ths suppresson s beleved to nvolve nhbton of metalloprotenase (MMP) actvty by TTMPs, as there are substantal lnes of evdence ndcatng the nvolvement of MMPs n tumorgeness, partcularly n metastass (39). That could be the mechansm for TTMP-3, a new member of the TMP famly of genes, to nhbt the growth of human colon carcnoma DLD-1 cells, snce TTMP-3 overexpressed n Do2-5 cells s an actve MMP nhbtor (Fgure 2B). The fact that BB94 (at a concentraton of three magntudes hgher than the C^) fals to mmc TTMP3 to nduce large aggregates and subsequent death of cells grown n suspenson, however, suggests that MMP nhbton s nsuffcent for producng the tumor cell growth nhbton seen wth TMP-3. Our results therefore suggest a new mechansm, n addton to or nstead of MMP nhbton (5,40), by whch TMP-3 may functon as a cell death nducer or tumor cell growth nhbtor. t s not clear how an extracellular matrx proten nduces cell aggregaton under condtons n whch ECM s not necessary for anchorage. t mght reflect a cellular defense mechansm needed to ncrease sgnal communcatons under unfavorable growth condtons. We have determned the nature of the cell death usng methods descrbed prevously (23,41) and have dentfed t as necrotc death rather than apoptoss, somethng that most lkely derves from lack of nutrton n aggregated cells (data not shown). The cell death, therefore, appears to be a secondary effect of TMP-3 expresson, resultng from the large cell aggregates. TMP-3 seems to play a complex role n cellular transformaton and tumor formaton. We have shown here that TTMP-3 expresson nhbts subcutaneous tumor formaton by colon 1809

6 J.Ban et al. Dnl-3 (TMP-3-) Do2-5 (TMP-3+) Day 1 Day 3 Day 5 Fg. 6. Large aggregates undergo cell death n TMP-3 expressng Do2-5 cells. Cells were grown n suspenson frst for ndcated tme perod (day) and alquots were then grown n monolayer culture for 24 h before pctures were taken n representatve areas. The magnfcaton for the photo s X100. The left column s TMP-3 negatve Dnl-3 cells and the rght column s TMP-3 postve Do2-5 cells. carcnoma cells. n JB6 tumor cells, whch also lack TMP-3 expresson, rentroducton of TMP-3 dd not, however, change tumor cell phenotypes assayed n vtro and n vvo (42). Furthermore, Yang and Hawkes (43) showed a morphologcal transformaton actvty for purfed chcken TTMP-3 n cultured chcken embryo fbroblasts. All these observatons may suggest the mportance of TMP-3 nteractng proten(s) n the determnaton of whether TMP-3 nduces a phenotype change. Apparently, the actvty of TMP-3, whether oncogenc or tumor suppressng, may depend upon the level of ts nteractng proten(s) ncludng MMPs. Current efforts are underway to dentfy these TTMP-3 nteractng protens and to elucdate the sgnal transducton pathway(s) leadng to growth arrest and tumor suppresson. Acknowledgement We would lke to thank Dr. W.Stetler-Stevenson at the Natonal Cancer nsttute for provdng the purfed T1MP-2 used as a postve control for reverse zymography assay. References l.docherty.aj.p, Lyons.A., Smth.BJ., Wnght.E.M., Stephens.P.E., Harrs.TJ.R., Murphy.G. and ReynoldsJJ. (1985) Sequence of human 1810 tssue nhbtor of metalloprotenases and ts dentty to erythrodpotentatng actvty. Nature, 318, Stetler-Stevenson,W.G., Kntzsch.H.C. and Lotta,L.A. (1989) Tssue nhbtor of metalloprotenases (TMP-2): a new member of the metalloprotenase nhbtor famly. J. Bol. Chem, 264, Pavloff.N., Staskus,P.W., Kshnan.N.S. and Hawkes.S.P. (1992) A new nhbtor of metalloprotenases from chcken: ChMP-3: a thrd member of the TMP famly. J. Bol. Chem., 267, Sun,Y., Hegamyer.G. and Colbum.N.H. (1994) Molecular clonng of fve messenger RNAs dfferentally expressed n preneoplastc or neoplastc JB6 mouse epdermal cells: one s homologous to human tssue nhbtor of metalloprotenases-3. Cancer Res., 54, Leco,KJ., Khokha,R., Pavloff.N., Hawkes.S.P. and Edwards.D.R. (1994) Tssue nhbtor of metalloprotenases-3 (TMP-3) s an extracellular matrx-assocated proten wth a dstnctve pattern of expresson n mouse cells and tssues. J. Bol. Chem.. 269, ,Slbger,S.M., Jacobsen,V.L., Cupples.R.L. and Kosk,R.A. (1994) Clonng of cdnas encodng human TMP-3, a novel member of the tssue nhbtor of metalloprotenase famly. Gene, 141, Wck,M., Burger.C, Brusselbach.S., Lucbello.F. and Muller,R. (1994) A novel member of human tssue nhbtor of metalloprotenases (TMP) gene famly s regulated durng Gl progresson, mtogcnc stmulaton, dfferentaton, and senescence. J. Bol Chem., 269, Upte,S.S., Matte,M.-G. and Olsen.B- (1994) Clonng of the cdna encodng human tssue nhbtor of metalloprotenases-3 (TMP-3) and mappng of the TMP-3 gene to chromosome 22. Genomcs, 19, UraJ.A., Ferrando.A.A., Velasco.G., FrejeJ.M.P. And Lopez-Otn.C. (1994) Structure and expresson n breast tumors of human TMP-3, a

7 Tumor suppresson and death nducton by TMP-3 new member of the metalloprotenase nhbtor famly. Cancer Res., 54, Wlde,C.G., Hawkns,P.R., Coleman.R.T., Levne.W.B., Delegeane.A.M., Okamoto.P.M., to,l.y, Scott,R.W. and SelhamerJJ. (1994). Clonng and characterzaton of human tssue nhbtor of metalloprotenases-3. DNA Cell Bol., 13, ll.huebner.k., sobe,m., GassonJ.C, Golde.D.W. and Croce.C.M. (1986). Localzaton of the gene encodng erythrod potentatng actvty to chromosome regon XpU.l-Xpll.4. Am. J. Hum. Genet., 38, DeClerck,Y., Szprer.C, Aly,M.S., CassmanJJ., Eeckhout.Y. and Rousseau.G. (1992) The gene for tssue nhbtor of metalloprotenases-2 s localzed on human chromosome arm 17q25. Genomcs, 14, Denhardt,D.T., Feng.B., EdwardsJD.R., Cocuzz.E.T. and Malyankar.UJv. (1993) Tssue nhbtor of metalloprotenases (TMP, aka EPA): structure, control of expresson and bologcal functons. Pharmac. Ther, 59, Sun,Y, Hegamyer.G., Km.H., Sthanandam.K., L,H., Watts.R. and Colbum,N. (1995) Molecular clonng of mouse tssue nhbtor of metalloprotenases-3 (mttmp-3) and ts promoter specfc lack of expresson n neoplastc JB6 cells may reflect altered gene methylaton. /. Bol. Chem., 270, Wllamson,R.A., Marston.F.A.O., Angal.S. era/. (1990) Dsulphde bond assgnment n human tssue nhbtor of metalloprotenases (TTMP). Bochem. J., 268, Brkedal-Hansen,H., Moore.W.G.., BoddenJv.K., Wndsor^J., Brkedal- Hansen.B., DeCarlo,A. and EnglerJ.A. (1992) Matrx metalloprotenases: a revew. Crt. Rev. Oral Bol. Med., 4, Murphy,A.N., Unsworth.EJ. and Stetler-Stevenson.W.G. (1993) Tssue nhbtor of metalloprotenases-2 nhbts bfgf-nduced human mcrovascular endothelal cell prolferaton. 7. Cell. Physol, 157, NemethJ.A. and Goolsby.C.L. (1993) TMP-2, a growth-stmulatory proten from SV-40-transformed human fbroblasts. Exp. Cell Res., 207, Bertaux,B., Hornebeck.W., Esen,A.Z. and DubertretX. (1991) Growth stmulaton of human keratnocytes by tssue nhbtor of metalloprotenases. J. nvest. Dermatol, 97, O.Hayakawa,T., Yamashta,K., Tanzawa,K., Uchjma,E. and wata,k. (1992) Growth-promotng actvty of tssue nhbtor of metalloprotenases-1 (TMP-1) for a wde range of cells: a possble new growth factor n serum. FEBS Lett., 298, Corcoran,M.L. and Stetler-Stevenson.W.G. (1995) Tssue nhbtor of metalloprotenases-2 stmulates fbroblast prolferaton va a campdependent mechansm. J. Bol. Chem., 270, Sun,Y., Hegamyer.G., Cheng,Y.-J., Hldeshem.A., ChenJ.Y, Chen..H., Cao,Y, Yao.K.T. and Colburn,N.H. (1992). An nfrequent pont mutaton of the p53 gene n human nasopharyngeal carcnoma. Proc. Natl Acad. Sc. USA, 89, Sun,Y, Pommer.Y. and Colburn^N.H. (1992) Acquston of a growth nhbtory response to phorbol ester nvolves DNA damage. Cancer Res., 52, Sun,Y, ColburnJM.H. and Oberley.L.W. (1993) Depresson of catalase gene expresson after mmortalzaton and transformaton of mouse lver cells. Carcnogeness, 14, Sun,Y, Nakamura,K., Hegamyer.G., Dong,Z. and Colbum.N.H. (1993). No pont mutaton of H-ras or p53 genes expressed n preneoplastc-toneoplastc progresson as modeled n mouse JB6 cell varants. Mol. Carcnogeness, 8, Sun,Y, Nakamura,K., Wendel.E. and Colburn.N.H. (1993). Progresson toward tumor cell phenotype s enhanced by overexpresson of a mutant p53 tumor suppressor gene solated from nasopharyngeal carcnoma. Proc. Nal Acad. Sc. USA, 90, KarlssonJ.-O., Ostwald,K., Kabjom.C. and Andersson.M. (1994). A method for proten assay n Laemml buffer. Anal Bochem., 219, Staskus,P.W., Masarz^.R., PallanckX.J. and Hawkes.S.P. (1991) The 21- kda proten s a transformaton-senstve metalloprotenase nhbtor of chcken fbroblasts. J. Bol. Chem., 266, 449^* Smth,M.R., Lu,Y.-L., Km,N., Rhee.S.G. and Kung,H.F. (1990). nhbton of serum- and Ras-stmulated DNA synthess by antbodes to phospholpase C. Scence, 247, Tarabolett,G., Garofalo,A., Belott.D., Druds.T., Borsott.P., Scanzan.E., Brown,P.D. and Gavazz.R. (1995) nhbton of angogeness and murne hemangoma growth by batmastat, a synthetc nhbtor of matrx metalloprotenases. J. Natl Cancer nst., 87, Schultz,R.M., Slberman.S., Persky.B., Bajkowsk.A.S. and Carmchael.D.F. (1988). nhbton by human recombnant tssue nhbtor of metalloprotenases of human amnon nvason and lung colonzaton by murne B16-F10 melanoma cells. Cancer Res., 48, Khokha,R., Zmmer.MJ., Graham,C.H., Lala.P.K. and Waterhouse.P. (1992) Suppresson of nvason by nducble expresson of tssue nhbtor of metalloprotenase-1 (TMP-1) n B16-F10 melanoma cells. J. Natl Cancer nst., 84, Khokha,R. (1994) Suppresson of the tumorgenc and metastatc abltes of murne B16-F10 melanoma cells n vvo by the overexpresson of the tssue nhbtor of the metalloprotenases-1. J. Natl Cancer nst., 86, Koop,S., Khokha,R., Schmdt,E.E., MacDonald..C, Morrs, V.L., Chambers.A.F. and GroonvVC. (1994) Overexpresson of metalloprotenase nhbtor n B16F10 cells does not affect extravasaton but reduces tumor growth. Cancer Res., 54, Albn,A., Melchor.A., Sant,L., Lotta,L.A., Brown.P.D. and Stetler- Stevenson.W. (1991) Tumor cell nvason nhbted by TTMP-2. /. Natl Cancer nst., 83, Montgomery,A.M.P., Mueller,B.M., Resfeld,R.A., Taylor.S.M. and Deaerck,Y.A. (1994) Effect of tssue nhbtor of the matrx metalloprotenases-2 expresson on the growth and spontaneous metastass of a human melanoma cell lne. Cancer Res., 54, Khokha,R., Waterhouse.R, Yagel.S., Lala,P.K., Overall.C.M., Norton.G. and Denhardt,D.T. (1989). Antsense RNA-nduced reducton n murne TTMP levels confers oncogencty on Swss 3T3 cells. Scence, 244, WttyJ.R, McDonnell.S., Newell.K.J., Cannor.P, Navrejv., Tressler.RJ. and Matrsan.L.M. (1994) Modulaton of matrlysn levels n colon carcnoma cell lnes affects tumorgencty n vvo. Cancer Res., 54, Khokha,R. and Denhardt,D.T. (1989) Matrx metalloprotenases and tssue nhbtor of metalloprotenases: a revew of ther role n tumorgeness and tssue nvason. nvason Metast., 9, O.Apte,S.S., Olsen.B.R. and Murphy,G. (1995) The gene structure of tssue nhbtor of metalloprotenases (TMP)-3 and ts nhbtory actvtes defne the dstnct TTMP gene famly. J. Bol. Chem., 270, Sngh,N., Sun.Y, Nakamura,K., Smth,M. and Colbum.N.H. (1995) C-JUN/ AP as possble medators of tumor necross factor-a-nduced apoptotc response n mouse JB6 tumor cells. Oncology Res., 7, Sun,Y, Km.H., Parker.M., Stetler-Stevenson.W. and Colburn,N.H. (1996) Lack of suppresson of tumor cell phenotype by overexpresson of TTMP- 3 n mouse JB6 tumor cells: dentfcaton of a transfectant wth ncreased tumorgencty and nvasveness. Antcancer Res., 16, Yang,T.-T. and Hawkes.S.P. (1992) Role of the 21-kDa proten TMP-3 n oncogenc transformaton of cultured chcken embryo fbroblasts. Proc. Natl Acad. Sc. USA, 89, Receved on March 20, 1996; revsed on May 31, 1996; accepted on June 6,