Large BRCA1 and BRCA2 genomic rearrangements in Malaysian high risk breast-ovarian cancer families

Transcription

1 Breast Cancer Res Treat (2010) 124: DOI /s BRIEF REPORT Large BRCA1 and BRCA2 genomic rearrangements in Malaysian high risk breast-ovarian cancer families Peter Kang Shivaani Mariapun Sze Yee Phuah Linda Shushan Lim Jianjun Liu Sook-Yee Yoon Meow Keong Thong Nur Aishah Mohd Taib Cheng Har Yip Soo-Hwang Teo Received: 21 June 2010 / Accepted: 23 June 2010 / Published online: 9 July 2010 Ó Springer Science+Business Media, LLC Abstract Early studies of genetic predisposition due to the BRCA1 and BRCA2 genes have focused largely on sequence alterations, but it has now emerged that 4 28% of inherited mutations in the BRCA genes may be due to large genomic rearrangements of these genes. However, to date, there have been relatively few studies of large genomic rearrangements in Asian populations. We have conducted a full sequencing and large genomic rearrangement analysis (using Multiplex Ligation-dependent Probe Amplification, MLPA) of 324 breast cancer patients who were selected from a multi-ethnic hospital-based cohort on the basis of age of onset of breast cancer and/or family history. Three unrelated individuals were found to have large genomic rearrangements: 2 in BRCA1 and 1 in BRCA2, which P. Kang S. Mariapun S. Y. Phuah S.-Y. Yoon S.-H. Teo (&) Cancer Research Initiatives Foundation, Sime Darby Medical Centre, 2nd Floor, Outpatient Centre, 1 Jalan SS12/1A, Subang Jaya 47500, Selangor, Malaysia soohwang.teo@carif.com.my L. S. Lim J. Liu Human Genetics Division, Genome Institute of Singapore, Agency for Science Technology & Research (A*STAR), Singapore, Singapore J. Liu Centre for Molecular Epidemiology, Yong Loo Lin School of Medicine, National University of Singapore, Singapore, Singapore M. K. Thong Department of Paediatrics, University Malaya Medical Centre, Kuala Lumpur, Malaysia N. A. Mohd Taib C. H. Yip S.-H. Teo Department of Surgery, University Malaya Medical Centre, Kuala Lumpur, Malaysia accounts for 2/24 (8%) of the total mutations detected in BRCA1 and 1/23 (4%) of the mutations in BRCA2 detected in this cohort. Notably, the family history of the individuals with these mutations is largely unremarkable suggesting that family history alone is a poor predictor of mutation status in Asian families. In conclusion, this study in a multi-ethnic (Malay, Chinese, Indian) cohort suggests that large genomic rearrangements are present at a low frequency but should nonetheless be included in the routine testing for BRCA1 and BRCA2. Keywords Breast cancer BRCA1 BRCA2 Rearrangements Germline Introduction Genetic testing to identify deleterious BRCA1 and BRCA2 mutations in families with history of breast or ovarian cancer has become an integral part of clinical practice in many countries. Although early tests have focused primarily on sequence alterations, more recently, numerous studies conducted primarily in Caucasian populations have shown that 4 28% of mutations in the BRCA genes may be due to large genomic rearrangements [1]. At least 81 different BRCA1 genomic rearrangements and 17 BRCA2 genomic rearrangements have been reported to date ([2] and references therein). However, there have been relatively few reports of such large genomic rearrangements from Asia, with only seven reports involving a total of 649 patients from Hong Kong, Singapore, Korea, Japan and Malaysia [3 9]. This is in part because there have been relatively few studies involving comprehensive analysis of BRCA1 and BRCA2 in Asia, and to date, few Asian countries have had the resources and

2 580 Breast Cancer Res Treat (2010) 124: finances for breast cancer genetic counseling and genetic testing services. Moreover, there have been major challenges in identifying at risk individuals because unlike Caucasian populations where multiplex families and extensive family history are available, the majority of Asian families do not fulfil the typical high risk profile described in other populations because of the lack of accurate reporting of family history of cancer, complex family dynamics and the lower age-standardised rate of breast cancer in Asia [10, 11]. The aim of our study was to assess the prevalence of large genomic rearrangements in BRCA genes in a breast cancer cohort previously tested negative for BRCA mutations using DNA sequencing. Materials and methods Breast cancer cohort The recruitment of Malaysian families with a high risk of breast or ovarian cancer started in 2003 at the University Malaya Medical Centre in Kuala Lumpur [10]. Patients with breast cancer were first approached by clinicians responsible for their care to see if they would participate in a research study to determine the genetic factors which increase the risk of breast cancer in Malaysia. Thereafter, individuals interested in the project were approached by a member of the research team who explained to them the nature and objectives of the research project. A total of 1,077 index cases were referred to our study between January 2003 and December Index cases signed a consent form and a blood sample was taken. A family history was recorded and the pedigree analysed. Where possible, pathology reports were requested to confirm all diagnoses of breast and ovarian cancers in the index case. The study was approved by the ethics committee of University Malaya Medical Centre. Inclusion criteria for analysis of BRCA1 and BRCA2 Breast cancer patients were included for analysis of BRCA1 and BRCA2 if they were considered high-risk by the following criteria: (a) early-onset breast cancer (B40 years) and 1 or more additional cases of breast cancer in first- or second-degree relatives; (b) breast cancer (C40 years) and two or more additional cases of breast cancer in first- or second-degree relatives; (c) bilateral breast cancer (\50 years old); or (d) breast cancer and a personal or family history of breast and ovarian cancer. In addition, approximately 50% of patients who were considered of medium risk were included for analysis. These included patients with only early-onset breast cancer (B40 years) but no significant family history [12] or breast cancer (C40 years) and one additional case of breast cancer in a first- or second-degree relative. Individuals were categorised based on self-reported race or ethnicity [10]. Of the 1,077 index cases, 324 were analysed for mutations in the BRCA1 and BRCA2 genes. Mutation detection Blood from index cases was separated into two 10 ml EDTA-tubes and DNA was extracted using standard methods. Samples were tested for mutations in the BRCA1 and BRCA2 genes using direct DNA sequencing as previously described. Those samples which tested wild-type (mutation negative) were subsequently analysed by multiplex ligation-dependent probe amplification (MLPA) using kit P002B/P087 (MRC-Holland, Amsterdam) which includes probes for each of the 24 exons of BRCA1 and kit P045, which includes probes for the 27 exons of BRCA2 and for exon 9 of CHEK2. Confirmation tests were performed on a second blood sample. Naming and interpretation of sequence analysis (BRCA1 gdna sequence: accession no. L78833; BRCA2 gdna sequence: accession no. AY436640) were performed as previously described [4] and all patients were classified as having a deleterious mutation if the BRCA1 or BRCA2 protein terminated prematurely at least 10 or 110 amino acids, respectively, from the C terminus. Identification of genomic breakpoints Putative deletions were evaluated in genomic DNA by long-range PCR. PCR primers were located in introns flanking the rearrangement and PCR products of abnormal size were sequenced in both directions. Detection of BRCA1 exon 1 14 deletion in BRC 776 by Illumina SNP array DNA samples were analyzed on the Illumina Human 1M- Duo DNA Analysis BeadChip (Illumina Inc.) according to manufacturer s protocol. Raw signals were processed using the GenomeStudio TM Data Analysis Software s Genotyping Module (Illumina Inc.) to give Log R Ratio (LRR) and B Allele Frequency (BAF) readings. Large deletions in genomic DNA were called using the QuantiSNP v1.1 algorithm [13] on exported Illumina LRR and BAF values for each sample. The following stringent QC criteria were applied to ensure high-quality calls: (1) LRR standard

3 Breast Cancer Res Treat (2010) 124: Table 1 Characteristics of families with negative BRCA1 and BRCA2 (n = 280) Characteristics No. (%) Cancer type Female breast, age at index diagnosis, years B C Breast or ovarian cancers in family (1 and 2 only) Female breast Female ovary 7 3 Both 1 Neither Manchester score B C Ancestry Malay Chinese Indian Others 4 1 A total of 324 breast cancer patients were analysed for mutations in BRCA1 and BRCA2 by DNA sequencing and multiple ligation dependent probe amplification (MLPA) analysis. Table 1 shows the distribution of patients according to their age at diagnosis, family history of breast and ovarian cancer in first- and second-degree relatives, Manchester score and self-declared ethnicity. Notably, the 135 individuals with no family history of breast and ovarian cancer were included in the study because they had either early age of onset of breast cancer (B40 years of age: 88 individuals; years of age: 35 individuals), bilateral breast cancer (28 individuals), both breast and ovarian cancer (4 individuals) or family history of prostate cancer in the third degree (6 individuals) deviation \ 0.2; (2) Minimum no. of SNPs [ 10; and (3) Log Bayes Factor [ 30. This analysis reported regions with genomic copy number deviating from 2, and provided details on chromosomal coordinates, number and identity of implicated SNPs, and chromosomal copy number (0 or 1, for homozygous or heterozygous deletions, respectively) for each region. Results Mutation testing outcome A total of 2,407 patients with breast cancer were treated at the University Malaya Medical Centre between January 2003 and December 2009, of which 1,077 individuals with breast cancer were recruited to the present study. We conducted full sequence analysis of the BRCA1 and BRCA2 genes in 324 high- and medium-risk women (see Materials and methods and Table 1). DNA sequencing analysis led to the discovery of 37 distinct deleterious mutations in 44 individuals (BRCA1 185 delag and BRCA2 490 delct were found in 3 individuals each; and BRCA1 589 delct, BRCA G[T and BRCA C[G were found in 2 individuals each). Detection of large genomic rearrangements using multiplex ligation PCR amplification (MLPA) revealed two genomic rearrangements in BRCA1 and one in BRCA2. Large genomic rearrangements therefore account for 2/24 (8%) of the total mutations detected in BRCA1 and 1/23 (4%) of the mutations in BRCA2 detected in this cohort (Table 2). BRCA1 exon deletion Patient BRC748 is an Indian breast cancer patient who developed breast cancer at the age of 29, but has no family history of breast and ovarian cancer (Fig. 1a). Her rearrangement involved the deletion of exons of BRCA1 (Table 2). Using primers located in introns 12 and 15, mutant PCR products were amplified from the genomic DNA of BRC748 and sequenced using a series of internal primers (Table 3; [4]). The 5 0 breakpoint of the 9,400 base pair deletion occurred 794 bp upstream of exon 13 in intron 12, and the 3 0 breakpoint occurred 360 bp downstream of exon 15 in intron 15. Sequence analysis indicated that the 5 0 and 3 0 breakpoint of the deletion occurred within two AluSX repeats oriented in the same forward direction, at locations 45,276 45,572 and 54,676 54,964, respectively, and the site of the crossover even was shown to lie within a 21 bp sequence. In addition, a mutation-specific PCR assay was used for determining the prevalence of this BRCA1 rearrangement Table 2 Inherited genomic rearrangements in BRCA1 and BRCA2 Patient Mutation Size, bp Type of sequence at breakpoint Ancestries of families with mutation 5 0 site 3 0 site BRC748 BRCA1 exon 13_15 del 9,400 AluSX AluSX Indian BRC776 BRCA1 exon 1_14 del *78,500 ND ND Chinese BRC888 BRCA2 exon 14_16 del 6,859 AGACTG AGACTG Indian

4 582 Breast Cancer Res Treat (2010) 124: Table 3 Primer sequences used for sequencing analysis of BRCA1 and BRCA2 rearrangements Primer Nucleotide sequence Nucleotide position a BRCA1 exon deletion analysis B1int12F GCACACTCTTCTTTGAAATGGA ,944 44,481 B1int15R TTTTTGAGATGGAGTCTTGCTC ,943 54,964 B1int15R2 b 5 0 -CCTTTGGACTCTTGTCTAACAG ,026 55,047 BRCA2 exon deletion analysis B2int13F CACCTGATTGTGGAATTGTTG ,880 37,900 B2int13F GGGACAGAGGGAAACAAAAA ,378 38,397 B2int16R5b 5 0 -TTAAAAATCGCATCTCCTTGC ,812 45,832 a Nucleotide positions are numbered according to BRCA1 and BRCA2 genomic sequences, L78833 and AY436640, respectively b Primer sequence from Lim et al. [4] (a) Throat ca, ~60 Breast ca, Brain tumour, 1 Uterine ca, 42 Leukaemia, 4 (b) Ovarian/cervical/uterine ca, ~50 Colon ca, 75 Kidney ca, ~50 Lung ca, ~50 Lung ca, ~ Breast ca, 57 Ovarian ca, ~60 Ovarian ca, ~60 4 Ovarian ca, ~40 Colon ca, ~ (c) Breast ca, ~ Breast ca, 33 Breast ca, 47 Gastric ca, 43 CRC & Brain ca, Fig. 1 Pedigree of families with genomic rearrangements in BRCA1 and BRCA2, indicating the positions of affected individuals (open circle females; open square males). Index patients are indicated with an arrow. Patients who tested positive or negative for BRCA mutations are indicated with? or -, respectively. a BRC 748, b BRC 776, c BRC 888

5 Breast Cancer Res Treat (2010) 124: mutation in 121 Indian breast cancer patients and no other individuals were found to have this mutation. BRCA1 exon 1 14 deletion In patient BRC776, a Chinese breast cancer patient who developed breast cancer at the age of 57 and who had family history of ovarian and other cancers (Fig. 1b), the rearrangement involved deletion of exons 1 14 of BRCA1. Using the Illumina SNP chip, we found that there was heterozygote loss of rs (located at 38,485,428 on chromosome 17) and intervening regions to rs (located at 38,564,021) showing that there is a loss of approximately 78,500 bp of sequence from the promoter region of BRCA1 to exon 14. BRCA2 exon deletion In patient BRC888, an Indian breast cancer patient who developed breast cancer at the age of 33 and who had family history of breast cancer (Fig. 1c), the rearrangement involved deletion of exons of BRCA2. In order to delineate the breakpoint, a series of PCR amplifications were performed using different combinations of forward and reverse primers located in introns 13 and 16. The 5 0 breakpoint of the 6,859 base pair deletion occurred 1,962 bp upstream of exon 14, and the 3 0 breakpoint occurred 1,827 bp downstream of exon 16 in intron 16 (Table 3). Sequence analysis indicated that the 5 0 and 3 0 breakpoint of the deletion occurred within 38,654 38,659 and 45,513 45,518, respectively. Notably, the breakpoint did not occur in an Alu or LINE sequence, but appeared to take place across a region with microhomology. In addition, a mutation-specific PCR assay was used for determining the prevalence of this BRCA2 rearrangement mutation in 121 Indian breast cancer patients and no other individuals were found to have this mutation. Discussion This study provides important data on the prevalence and spectrum of large genome rearrangements in the BRCA1 and BRCA2 genes in the multi-ethnic population of Malaysia. Our results indicate that 14% (47/324) of those from medium to high risk families in Malaysia carry cancer predisposing genomic deletions in BRCA1 or BRCA2 and that large genomic rearrangements constitute 8% (2/24) and 4% (1/23) of the total BRCA1 and BRCA2 mutations, respectively, in this cohort. Our results are consistent with previous studies in various European populations ([14] and references therein; [15 28]) and in Singapore ([4] and references therein) where large genomic rearrangements constitute 8 and 4% of the total BRCA1 and BRCA2 mutations, respectively. We would therefore suggest that large genomic rearrangements, though present at a low frequency, should nonetheless be included in the routine testing for BRCA1 and BRCA2. Genomic rearrangements were found in 3 of the mutation negative families and 1% (3/324) of the medium- and high-risk families. Of the 3 patients who were shown to have large genomic rearrangements in the BRCA genes, their Manchester scores were 11, 14 and 24. Two of these scores are typically only medium risk and further highlight the urgent need for more robust risk prediction models for Asians in order to identify individuals who have inherited predisposition to breast cancer. In addition, it is notable that two studies suggest BRCA2 genomic rearrangements should only be screened in presence of male breast cancer [18, 29], but the family with the BRCA2 large genomic rearrangement did not have any reported male breast cancer in the family. Acknowledgements We thank participants and their families for taking part in this study and Lee Sheau Yee, Eswary Thirthagiri and Daphne Lee for assistance with DNA preparation, pathology data and helpful discussions. This study was funded by research grants from the Malaysian Ministry of Science, Technology and Innovation, University Malaya and Cancer Research Initiatives Foundation. References 1. Mazoyer S (2005) Genomic rearrangements in the BRCA1 and BRCA2 genes. Hum Mutat 25(5): Sluiter MD, van Rensburg EJ (2010) Large genomic rearrangements of the BRCA1 and BRCA2 genes: review of the literature and report of a novel BRCA1 mutation. Breast Cancer Res Treat. doi: /s z 3. Kwong A et al (2009) A BRCA2 founder mutation and seven novel deleterious BRCA mutations in southern Chinese women with breast and ovarian cancer. Breast Cancer Res Treat 117(3): Lim YK et al (2007) Identification of novel BRCA large genomic rearrangements in Singapore Asian breast and ovarian patients with cancer. Clin Genet 71(4): Ang P et al (2007) BRCA1 and BRCA2 mutations in an Asian clinic-based population detected using a comprehensive strategy. Cancer Epidemiol Biomarkers Prev 16(11): Yap KP et al (2006) Detection of a novel Alu-mediated BRCA1 exon 13 duplication in Chinese breast cancer patients and implications for genetic testing. Clin Genet 70(1): Seong MW et al (2009) Low contribution of BRCA1/2 genomic rearrangement to high-risk breast cancer in the Korean population. Fam Cancer 8(4): Miki Y et al (1996) Mutation analysis in the BRCA2 gene in primary breast cancers. Nat Genet 13(2): Sharifah NA, et al (2010) Identification of novel large genomic rearrangements at the BRCA1 locus in Malaysian women with breast cancer. Cancer Epidemiol. doi: /j.canep Thirthagiri E et al (2008) Evaluation of BRCA1 and BRCA2 mutations and risk-prediction models in a typical Asian country

6 584 Breast Cancer Res Treat (2010) 124: (Malaysia) with a relatively low incidence of breast cancer. Breast Cancer Res 10(4):R Rao NY et al (2009) Evaluating the performance of models for predicting the BRCA germline mutations in Han Chinese familial breast cancer patients. Breast Cancer Res Treat 116(3): Toh GT et al (2008) BRCA1 and BRCA2 germline mutations in Malaysian women with early-onset breast cancer without a family history. PLoS One 3(4):e Colella S et al (2007) QuantiSNP: an objective Bayes Hidden Markov Model to detect and accurately map copy number variation using SNP genotyping data. Nucleic Acids Res 35(6): Walsh T et al (2006) Spectrum of mutations in BRCA1, BRCA2, CHEK2, and TP53 in families at high risk of breast cancer. JAMA 295(12): Ratajska M et al (2008) BRCA1 and BRCA2 point mutations and large rearrangements in breast and ovarian cancer families in Northern Poland. Oncol Rep 19(1): Hansen TO et al (2009) Large BRCA1 and BRCA2 genomic rearrangements in Danish high risk breast-ovarian cancer families. Breast Cancer Res Treat 115(2): Pylkas K et al (2008) Analysis of large deletions in BRCA1, BRCA2 and PALB2 genes in Finnish breast and ovarian cancer families. BMC Cancer 8: Engert S et al (2008) MLPA screening in the BRCA1 gene from 1,506 German hereditary breast cancer cases: novel deletions, frequent involvement of exon 17, and occurrence in single earlyonset cases. Hum Mutat 29(7): Miramar MD et al (2008) Genetic analysis of BRCA1 and BRCA2 in breast/ovarian cancer families from Aragon (Spain): two novel truncating mutations and a large genomic deletion in BRCA1. Breast Cancer Res Treat 112(2): Purnomosari D et al (2007) BRCA1 and BRCA2 germline mutation analysis in the Indonesian population. Breast Cancer Res Treat 106(2): Veschi S et al (2007) High prevalence of BRCA1 deletions in BRCAPRO-positive patients with high carrier probability. Ann Oncol 18(6):vi86 vi Vasickova P et al (2007) High occurrence of BRCA1 intragenic rearrangements in hereditary breast and ovarian cancer syndrome in the Czech Republic. BMC Med Genet 8: Gutierrez-Enriquez S et al (2007) Screening for large rearrangements of the BRCA2 gene in Spanish families with breast/ ovarian cancer. Breast Cancer Res Treat 103(1): Palanca Suela S et al (2008) Identification of a novel BRCA1 large genomic rearrangement in a Spanish breast/ovarian cancer family. Breast Cancer Res Treat 112(1): Weitzel JN et al (2007) Evidence for common ancestral origin of a recurring BRCA1 genomic rearrangement identified in high-risk Hispanic families. Cancer Epidemiol Biomarkers Prev 16(8): Casilli F et al (2006) The contribution of germline rearrangements to the spectrum of BRCA2 mutations. J Med Genet 43(9):e Buffone A et al (2007) Prevalence of BRCA1 and BRCA2 genomic rearrangements in a cohort of consecutive Italian breast and/or ovarian cancer families. Breast Cancer Res Treat 106(2): Armaou S et al (2007) Novel genomic rearrangements in the BRCA1 gene detected in Greek breast/ovarian cancer patients. Eur J Cancer 43(2): Tournier I et al (2004) Significant contribution of germline BRCA2 rearrangements in male breast cancer families. Cancer Res 64(22):