Expression of circulating microrna-1 and microrna-133 in pediatric patients with tachycardia

Transcription

1 MOLECULAR MEDICINE REPORTS 11: , 2015 Expression of circulting microrna-1 nd microrna-133 in peditric ptients with tchycrdi LING SUN 1*, SHUO SUN 2*, SHAOYING ZENG 1, YUFEN LI 1, WEI PAN 1 nd ZHIWEI ZHANG 1 Deprtments of 1 Peditrics nd 2 Crdiology, Gungdong Acdemy of Medicl Sciences, Gungdong Generl Hospitl, Gungzhou, Gungdong , P.R. Chin Received October 16, 2013; Accepted My 22, 2014 DOI: /mmr Abstrct. Proxysml or persistent tchycrdi in peditric ptients is common disese. Certin circulting micrornas (mirnas) hve been ssocited with rrhythmi. The present study investigted mirnas in the plsm of peditric ptients with tchycrdi. Forty peditric subjects were included retrospectively: 24 with recurrent sustined tchycrdi [seven cses of ventriculr tchycrdi (VT) nd 17 cses of suprventriculr tchycrdi (SVT)] nd 16 helthy controls. Circulting mir 1 nd mir 133 in the plsm were detected by fluorescent quntittive polymerse chin rection. mir 1 levels were significntly decresed in the rrhythmi group compred with those in the controls (P=0.004) whilst mir 133 expression levels were not significntly different between the two groups (P=0.456). Both mir 1 nd mir 133 levels showed significnt differences between the SVT nd VT groups (P=0.004 nd P=0.046, respectively), nd significnt decrese in mir 1 levels ws observed in the SVT group s compred with the controls (P<0.001). No significnt difference ws observed in the expression levels of mir 133. By contrst, mir 133 levels were significntly incresed in the VT group compred with those in the controls (P=0.024), wheres no sttisticlly significnt difference ws observed in the expression levels of mir 1. Receiver operting chrcteristic curves showed tht 1/miR 1 ws significnt for the evlution of tchycrdi. Additionlly, mir 1 produced enhnced sensitivity nd specificity for the evlution of SVT compred with mir 133, wheres mir 133 ws better mrker to ssess VT. This study demonstrted tht mirnas Correspondence to: Dr Wei Pn or Dr Zhiwei Zhng, Deprtment of Peditrics, Gungdong Acdemy of Medicl Sciences, Gungdong Generl Hospitl, 126 Zhongshn Second Rod, Yuexiu, Gungzhou, Gungdong , P.R. Chin E mil: drpnwei@163.com E mil: drzhngzhiwei@sin.com * Contributed eqully Key words: microrna-1, microrna-133, mrkers, tchycrdi, peditric ptients my be pproprite mrkers for peditric tchycrdi; mir 1 levels were decresed in the rrhythmi group compred with those in the helthy controls. Furthermore, ptients with SVT hd lower mir 1 expression levels while those with VT hd higher mir 133 expression levels. Introduction Proxysml or persistent tchycrdi is common condition in peditric ptients. Peditric crdic nd non crdic diseses, such s noxi, hydropeni nd electrolyte imblnce, cn induce rrhythmis (1). Persistent tchycrdi cn result in serious nd potentilly ftl pthologies such s hert filure; therefore, timely nd effective tretment is of gret clinicl significnce. However, the subjective symptoms of tchycrdi, such s choking senstion in the chest or plpittions, re not s evident in peditric ptients, prticulrly infnts, s those in dult ptients (2). This cn led to missed tretment opportunities nd cn result in severe complictions, including rrhythmi, crdiomyopthy nd sudden mortlity. Thus, finding novel, specific biomrkers of tchycrdi hs gret implictions for the erly prevention nd tretment of this condition in peditric ptients nd my reduce the chnce of sudden mortlity cused by mlignnt rrhythmis. At present, the tretment of rrhythmis primrily involves drug therpy nd rdiofrequency ctheter bltion. However, this methodology is not preferred for peditric ptients since the orgns of the ptients re still undergoing development nd vsculr complictions cn occur (3,4). Therefore, the use of rdiofrequency ctheter bltion nd drug therpy in the tretment of peditric rrhythmis is limited. In recent yers, clinicl studies hve begun ttempts to control proxysml or persistent tchycrdi in peditric ptients by gene trgeted therpy, with the im of improving crdic function in ffected children (5,6). micrornas (mirnas) re clss of single strnded, endogenous, non coding RNA molecules contining nucleotides. mirnas re formed by the mirna processing enzyme Dicer, from single strnded bse pir RNA precursor with hirpin structure. Through incomplete complementry bse piring with the 3' untrnslted region of trget mrna, mirna cn inhibit specific protein trnsltion nd expression or induce the degrdtion of trget mrna (7 9). mirnas re involved

2 4040 SUN et l: EXPRESSION OF mir-1 AND mir-133 IN CHILDREN WITH TACHYCARDIA in numerous key processes, including erly development, cell prolifertion, differentition nd poptosis (10). To dte, tissue specific mirnas identified in the hert hve included mir 1, mir 133/b nd mir 208 (11,12). Additionlly, the specific expression of circulting mirnas hs been found in vrious types of cncer nd crdic diseses (13). However, this study, to the best of our knowledge, is the first to report the levels of mirnas in the plsm of peditric ptients with recurrent sustined tchycrdi symptoms. Finding specific mrkers of tchycrdi is prticulrly importnt for the erly dignosis nd tretment of this disese in children. Mterils nd methods Blood specimen collection. This study ws pproved by the Ethics Committee of the Institute of Crdiovsculr Diseses, Gungdong Generl Hospitl (Gungzhou, Chin). The fmilies of ll peditric ptients tht were included in this study signed n informed consent form. Blood specimens were collected from 40 peditric ptients between October 2012 nd April The ptients included 16 norml, helthy children with norml electrocrdiogrms (ECGs) nd no history of crdiovsculr disese (control group) nd 24 children with recurrent sustined tchycrdi who were not receiving rdiofrequency bltion or ntirrhythmic drug therpy (experimentl group). An ECG of the peditric ptients tken t the onset of tchycrdi ws used s the dignostic criterion. Blood specimens were centrifuged within 2 h of collection (1,358 x g, 10 min, 4 C). The seprted plsm nd blood cells were dispensed into Eppendorf tubes nd stored t 80 C prior to use. Primer design nd synthesis. mir 1, mir 133 nd U6 gene sequences were retrieved from the mirbse dtbse ( nd used s reference for designing the polymerse chin rection (PCR) primers. The designed primers were synthesized by Shnghi Invitrogen Biotechnology Co., Ltd (Shnghi, Chin). The primer sequences were s follows: mir 1 forwrd primer, 5' ACACTCCAGCTGGGTGGAATGTAAAGAAGT 3' nd reverse primer, 5' TCAACTGGTGTCGTGGAGTCGGCA ATTCTTGAGCAGCTGGT 3'; mir 133 forwrd primer, 5'-ACACTCCAGCTGGGTTTGGTCCCCTTCAAC 3' nd reverse primer, 5'-CTCAACTGGTGTCGTGGAGTCGGC AATTCAGTTGAGCAGCTGGT 3'; reverse universl primer URP, 5' TGGTGTCGTGGAGTCG 3'; internl reference U6 forwrd primer, 5' CTCGCTTCGGCAGCACA 3' nd U6 reverse primer, 5' AACGCTTCACGAATTTGCGT 3'. The downstrem primers of mir 1, mir 133 nd U6 were mixed in equl volumes to obtin concentrtion of 10 µm for ech primer. Reverse trnscription (RT) nd fluorescent quntittive PCR (qpcr). Totl RNA ws extrcted from the plsm using TRIzol LS regent (Invitrogen Life Technologies, Crlsbd, CA, USA) ccording to the mnufcturer's instructions. The totl RNA ws subjected to reverse trnscription (RT) by PCR immeditely subsequent to extrction. The 20 µl RT PCR rection system (ReverTr Ace-α-Reverse Trnscription kit; Toboyo Co., Ltd., Osk, Jpn) contined 2 µl 10X buffer, Tble I. Bseline dt of the peditric ptients. 1 µl 2.5 mm deoxynucleotide triphosphte, 3 µl mixed downstrem primer, 0.5 µl reverse trnscriptse Moloney murine leukemi virus nd 13.5 µl RNA templte. The RT PCR progrm comprised 25 C for 15 min followed by 50 C for 50 min. A totl of 2 µl RT product (cdna) ws utilized for qpcr. The 20 µl rection systems for the qpcr detection of mir 1, mir 133 nd U6 contined 10 µl SYBR Premix Tq II (2X; Tkr Bio, Inc., Shig, Jpn), 0.2 µl 30 pmol/µl upstrem primer, 0.2 µl 30 pmol/µl downstrem primer, 7.6 µl dh 2 O nd 2 µl cdna. The fluorescent qpcr progrm comprised 95 C for 5 min, followed by 40 cycles of C (94 C for 10 sec, 55 C for 20 sec, 72 C for 10 sec nd 80 C for 35 sec) using n ABI 7500 fluorescent quntittive PCR mchine in plte red mode (Applied Biosystems Life Technologies, Foster City, CA, USA), which identifies genotypes, detects gene locus muttions nd nlyzes single nucleotide polymorpyhsms. The progrm ended with the preprtion of melting curve t C. Sttisticl nlysis. The stndrd curves of mir 1 nd mir 133 were used to clculte the bsolute quntities of mir 1 nd mir 133. The levels of circulting mir 1 nd mir 133 in the plsm re expressed s the men ± stndrd devition. Mesurement dt were nlyzed by the independent two smple t test with P<0.05 considered sttisticlly significnt. The sensitivity of mir 1 nd mir 133 to detect rrhythmi ws tested with receiver operting chrcteristic (ROC) curves. All dt were processed using SPSS 16.0 (SPSS Inc., Chicgo, IL, USA) sttisticl softwre. Results Arrhythmic Non rrhythmic Number Gender (n mle/n femle) 15/9 9/7 Age (yers) 6.6± ±1.8 Bseline dt. This study included 40 peditric ptients: 24 with rrhythmi nd 16 helthy controls (24 mles nd 16 femles) with verge ges of 6.6±3.9 nd 9.8±1.8 yers in the rrhythmi nd control groups, respectively. In the rrhythmi group, there were seven cses of ventriculr tchycrdi nd 17 cses of suprventriculr tchycrdi (SVT). Bseline dt of the peditric ptients re shown in Tble I. Circulting mirna levels in the plsm of peditric ptients. The stndrd curves prepred by double dilution of mir 1 nd mir 133 stndrds (y, cycle threshold vlue; x, Log initl copies; CO) re shown in Fig. 1. The mplifiction nd melting curves for the qpcr re shown in Figs. 2 nd 3. The mir 1 levels in the plsm of peditric ptients showed significnt difference between the rrhythmi nd non rrhythmi groups (3.09x10 6 ±2.11x10 6 vs. 5.16x10 6 ±1.99x10 6 copies/ml, P=0.004), wheres no

3 MOLECULAR MEDICINE REPORTS 11: , Tble II. mir 1 nd mir 133 levels in the plsm of peditric ptients. mir type Arrhythmic (copies/ml) Non rrhythmic (copies/ml) P vlue mir x10 6 ±2.11x x10 6 ±1.99x mir x10 6 ±4.74x x10 6 ±2.03x Indictes sttisticl significnce. mir, microrna. A B Figure 1. Stndrd curves for (A) mir 1 nd (B) mir 133. mir 1, y= x (R 2 = ); mir 133, y= x (R 2 = ). mir, microrna; Ct, cycle threshold; CO, initil copies. A A B B Figure 3. microrna 133 (A) mplifiction nd (B) melting curves from SYBR quntittive polymerse chin rection detection. Figure 2. microrna 1 (A) mplifiction nd (B) melting curves from SYBR quntittive polymerse chin rection detection. sttisticlly significnt differences were observed in the mir 133 levels between the two groups (1.34x10 6 ±4.74x10 5 vs. 1.43x10 6 ±2.03x10 5 copies/ml, P=0.456) (Tble II). The bove results indicte tht mir 1 levels were decresed in the plsm

4 4042 SUN et l: EXPRESSION OF mir-1 AND mir-133 IN CHILDREN WITH TACHYCARDIA Tble III. mir 1 nd mir 133 levels in the plsm of mle nd femle peditric ptients. mir type Mle (copies/ml) Femle (copies/ml) P vlue mir x10 6 ±2.41x x10 6 ±2.15x mir x10 6 ±3.47x x10 6 ±4.44x N=40 ptients; mle, n=24; femle, n=16. mir, microrna. A B Figure 4. (A) mir 1 nd (B) mir 133 levels in the plsm of peditric ptients. mir, microrna. Figure 5. Frequency distribution of mir 1 nd mir 133 in mle nd femle peditric ptients. mir, microrna. of the ptients with rrhythmi wheres mir 133 levels exhibited no significnt vrition (Fig. 4). mirna levels in the plsm of peditric ptients of different genders. The levels of mir 1 nd mir 133 in the plsm of peditric ptients with rrhythmi showed no sttisticlly significnt differences between the mles nd femles (mir 1, 3.86x10 6 ±2.41x10 6 vs. 4.01x10 6 ±2.15x10 6 copies/ml, P=0.842; mir 133, 1.33x10 6 ±3.47x10 5 vs. 1.45x10 6 ±4.44x10 5 copies/ml, P=0.351) (Tble III). The frequency distribution of mir 1 nd mir 133 in the plsm of mle nd femle peditric ptients with rrhythmi nd controls is shown in Fig. 5. Sensitivity nd specificity of 1/miRNA for the evlution of rrhythmi (ROC curve). ROC curves were prepred with 1/miR 1 nd 1/miR 133. Arrhythmi ws defined s the positive event (Fig. 6). The results showed tht the dignosis of tchycrdi with 1/miR 1 hd sttisticl significnce (P=0.004; re under the ROC curve, 0.773; 95% confidence intervl of the re, ), wheres the dignosis of tchycrdi

5 MOLECULAR MEDICINE REPORTS 11: , Tble IV. Sensitivity nd specificity of 1/miRNA for the evlution of rrhythmi. 1/miR type Are under ROC curve P vlue 95% CI 1/miR /miR Indictes sttisticl significnce. mir, microrna; ROC, receiver operting chrcteristic; CI, confidence intervls. Tble V. Comprison of mir 1 nd mir 133 between the suprventriculr nd ventriculr tchycrdi groups. mir type Suprventriculr tchycrdi (copies/ml) Ventriculr tchycrdi (copies/ml) P vlue mir x10 6 ±1.62x x10 6 ±2.36x mir x10 6 ±5.08x x10 6 ±1.69x Indictes sttisticl significnce. mir, microrna. Tble VI. Comprison of mir 1 nd mir 133 between the suprventriculr tchycrdi nd norml control groups. mir type Suprventriculr tchycrdi (copies/ml) Norml control (copies/ml) P vlue mir x10 6 ±1.62x x10 6 ±1.99x10 6 <0.001 mir x10 6 ±5.08x x10 6 ±2.03x Indictes sttitsticl significnce. mir, microrna. Tble VII. Comprison of mir 1 nd mir 133 between the ventriculr tchycrdi nd norml control groups. mir type Ventriculr tchycrdi (copies/ml) Norml control (copies/ml) P vlue mir x10 6 ±2.36x x10 6 ±1.99x mir x10 6 ±1.69x x10 6 ±2.03x Indictes sttisticl significnce. mir, microrna. with 1/miR 133 hd no sttisticl significnce (P=0.73) (Tble IV). Subgroup nlysis of mirna levels in the plsm of ptients with rrhythmi. Subgroup nlysis ws performed on the peditric ptients with rrhythmi for the comprison of plsm mir 1 nd mir 133 levels between the SVT nd VT groups (Tble V). Sttisticlly significnt differences were observed in the mir 1 nd mir 133 levels in the plsm between the SVT nd VT groups (mir 1, 2.41x10 6 ±1.62x10 6 vs. 4.76x10 6 ±2.36x10 6 copies/ml, P=0.004; mir 133, 1.22x10 6 ±5.08x10 5 vs. 1.64x10 6 ±1.69x10 5 copies/ml, P=0.046). In ddition, sttisticlly significnt differences in plsm mir 1 levels were observed between the ptients with SVT nd the control group (2.41x10 6 ±1.62x10 6 vs. 5.16x10 6 ±1.99x10 6 copies/ml, P<0.001) (Tble VI), wheres the plsm mir 133 levels showed no significnt difference between these two groups. The expression levels of mir 133 in the plsm were, however, significntly different between the VT nd norml control groups (1.64x10 6 ±1.69x10 5 vs. 1.43x10 6 ±2.03x10 5 copies/ml, P=0.024) (Tble VII), wheres no significnt difference ws observed in the plsm mir 1 levels between these two groups. Together, these results indicte tht circulting mir 1 levels in the plsm of peditric ptients with SVT were downregulted, wheres mir 133 levels in the plsm of peditric ptients with VT were upregulted. Sensitivity of ROC curves for the evlution of SVT nd VT. According to the ROC curves, mir 1 hd enhnced sensitivity nd specificity for the evlution of SVT (P<0.001; re under the ROC curve, 0.826; 95% confidence intervl of the re, ) (Fig. 7A), wheres mir 133 hd better sensitivity nd specificity for the evlution of VT (P=0.01; re under

6 4044 SUN et l: EXPRESSION OF mir-1 AND mir-133 IN CHILDREN WITH TACHYCARDIA A B Figure 6. Receiver operting chrcteristic curve sensitivity nd specificity of (A) 1/miR 1 nd (B) 1/miR 133 for the evlution of rrhythmi. mir, microrna. A B Figure 7. (A) Sensitivity nd specificity of mir 1 for the evlution of suprventriculr tchycrdi. (B) Sensitivity nd specificity of mir 133 for the evlution of ventriculr tchycrdi. mir, microrna. the ROC curve, 0.814; 95% confidence intervl of the re, ) (Fig.7B). Discussion mirnas regulte cell prolifertion nd differentition by mrna specific bse piring nd their expression exhibits cell or tissue specificity (14-16). Studies hve demonstrted tht numerous mirnas re involved in the reconstruction of ion chnnels by regulting gene expression in crdiomyocytes during the process of rrhythmi (17 19). At present, studies on the ssocition between mirna nd rrhythmi re primrily focusing on pthologicl nd physiologicl processes such s myocrdil ischemi nd crdic hypertrophy (20-23). The interctions of mirnas with ion chnnel encoding genes nd clmodulin regulte crdic contrctility, rhythm nd excitement, thereby inducing rrhythmi (24,25). However, less reserch hs been undertken into rrhythmi in peditric ptients without orgn disese, nd, to the best of our knowledge, no reports re vilble on the specific expression of circulting mirna in peditric ptients with persistent tchycrdi. In the present study, mir 1 nd mir 133 levels in the plsm of peditric ptients with tchycrdi nd helthy controls were quntittively detected by qpcr. The results showed tht circulting mir 1 levels in the plsm were lower in the ptients with rrhythmi thn those in the helthy controls, whilst no significnt differences were observed in the mir 133 expression levels. Of note, the results of the subgroup nlysis reveled tht there were significnt differences in circulting mir 1 nd mir 133 levels in the plsm of peditric ptients between the SVT nd VT groups. Additionlly, circulting plsm mir 1 levels were decresed in ptients with SVT, wheres plsm mir 133

7 MOLECULAR MEDICINE REPORTS 11: , levels were significntly incresed in ptients with VT, s compred with those in the norml controls. Together, these results demonstrte tht different circulting mirnas in the plsm of peditric ptients with SVT nd VT my cuse the reconstruction of vrious ion chnnels, thereby inducing rrhythmis of different types. Myocrdil ischemi induced rrhythmi is mjor crdiovsculr pthology ssocited with mir 1 nd mir 133. It hs been reported tht mir 1 expression is significntly incresed in ptients with myocrdil ischemi nd infrction nd is custive of rrhythmis. A possible mechnism for this is tht the ischemi relted bnormlly high expression of mir 1 leds to reduction in gp junction α 1 protein/connexin43 expression nd dely in crdic conduction, s well s to reduction in potssium inwrdly rectifying chnnel, subfmily J, member 2 expression, decline in inwrd rectifier current density nd resting potentil rise, ultimtely leding to the occurrence of ischemic rrhythmi (26-29). Zhng et l (30) found in n niml model of myocrdil ischemi tht mir 1 overexpression in the ventriculr hert muscle cused trioventriculr block; the underlying mechnism ws ssocited with reduction in Connexin43 expression nd decline in L type C 2+ currents. In the present study, none of the peditric ptients included hd orgnic hert disese. The finding of downregulted mir 1 expression in the plsm of peditric ptients contrsted with upregulted mir 1 expression following myocrdil ischemi, indicting tht peditric SVT involves different pthogenesis. Connexin43 is protein component of gp junctions, involved in regulting synchronized contrction of the hert. The expression level of Connexin43 is reltively low in the sinotril nd trioventriculr nodes, wheres its expression in the surrounding tissues is high (31). Therefore, dt from the present study suggest tht the pthogenesis of SVT in peditric ptients without hert disese is ssocited with the presence of considerble Connexin43 expression djcent to the trioventriculr nodes nd in the trioventriculr ccessory pthwys. The upregultion of Connexin43 expression my inhibit the expression of mir 1, leding to increses in the myocrdil conduction velocity. A mjor limittion of the present study lies in the difficulty of obtining myocrdil tissues from peditric ptients to quntittively determine Connexin43 expression in the myocrdil tissue. mir 133 is nother mirna with specific expression in myocrdil tissue tht is known to ffect the utorhythmicity of hert tissue through pcemker chnnels [potssium/sodium hyperpolriztion ctivted cyclic nucleotide gted ion chnnel 2 (HCN2) nd HCN4] (32,33) or potssium ion chnnels [potssium voltge gted chnnel, KQT like subfmily, member 1 (KCNQ1) nd potssium voltge gted chnnel, Isk relted fmily, member 1 (KCNE1)] (34,35). In mir 133 trnsgenic mice, mir 133 inhibits the rpid delyed rectifier potssium current encoded by the congenitl long QT2 syndrome gene nd the slow delyed rectifier potssium current encoded by the KCNQ1 nd KCNE1 genes. Dmge to the repolrizing current chnnels leds to the extension of ction potentil durtion or prolongtion of the QT intervl (36). In the present study, mir 133 levels were incresed in peditric ptients with VT; this finding my be ssocited with dmge to the repolrizing current chnnels, lthough further investigtions re required to vlidte this hypothesis. This study investigted whether the levels of circulting mir 1 nd mir 133 in the plsm of peditric ptients differed between mle nd femle ptients; the results showed no significnt differences in mir 1 nd mir 133 levels between the genders (P>0.05). However, Stuffer et l (37) found tht gender ws ssocited with significntly different Connexin43 nd mir 1 expression, with mir 1 expression in the plsm lower in femle thn in mle ptients (37). This inconsistency between the studies my be due to the smll smple size nd different ethnicities nd ges of ptients included. Studies with lrger smple size re required, s well s comprisons between the levels of circulting mirnas in the plsm of peditric nd dult ptients. Since differences in the levels of specific mirnas hve been identified in the plsm of peditric ptients with rrhythmis, mirna interference technology my be used s suitble tretment of refrctory rrhythmis. To rectify the downregultion of mir 1 expression in peditric ptients with SVT, we speculte tht synthetic mir 1 my be introduced into cells by exogenous, double strnded mirna or mirna mimic technologies. To trget the upregultion of mir 133 expression in peditric ptients with VT, mirna ntisense oligonucleotide technology nd mirna brrier oligonucleotide technology cn be used to inhibit the expression of mir 133, further controlling the occurrence of rrhythmi. However, these nd other relevnt technologies re still in the erly stges of testing. The identifiction of specific mirnas hs provided novel perspective for studying the pthogenesis of rrhythmi. Accordingly, new ides hve been considered for the future development of novel, secure nd effective drugs for treting rrhythmi. The expression of specific circulting mirna in plsm hs gret medicl significnce for erly rrhythmi prevention. In the ner future, gene trgeted therpy nd the prevention of rrhythmi in peditric ptients re likely to hve gret benefit. References 1. Blguer Grgllo M, Jordán Grcí I, Critg Bosch J, et l: Suprventriculr tchycrdi in infnts nd children. An Peditr (Brc) 67: , 2007 (In Spnish). 2. Clbrò MP1, Cerrito M, Luzz F, et l: Suprventriculr tchycrdi in infnts: epidemiology nd clinicl mngement. Curr Phrm Des 14: , Weindling SN, Sul JP nd Wlsh EP: Efficcy nd risks of medicl therpy for suprventriculr tchycrdi in neontes nd infnts. Am Hert J 131: 66 72, Kugler JD, Dnford DA, Del BJ, et l: Rdiofrequency ctheter bltion for tchyrrhythmis in children nd dolescents. N Engl J Med 330: , Schwrtz P, Crotti L nd Insoli R: Arrhythmogenic disorders of genetic origin: long QT syndrome: from genetics to mngement. Circ Arrhythm Electrophysiol 5: , Shimizu W nd Horie M: Phenotypicl mnifesttions of muttions in genes encoding subunits of crdic potssium chnnels. Circ Res 109: , Meister G nd Tuschl T: Mechnisms of gene silencing by double strnded RNA. Nture 431: , Alvrez Grci I nd Misk EA: MicroRNA functions in niml development nd humn disese. Development 132: , Mirnd KC, Huynh T, Ty Y, et l: A pttern bsed method for the identifiction of MicroRNA binding sites nd their corresponding heteroduplexes. Cell 126: , Cheng AM, Byrom MW, Shelton J nd Ford LP: Antisense inhibition of humn mirnas nd indictions for n involvement of mirna in cell growth nd poptosis. Nucleic Acids Res 33: , 2005.

8 4046 SUN et l: EXPRESSION OF mir-1 AND mir-133 IN CHILDREN WITH TACHYCARDIA 11. d Cost Mrtins PA, Leptidis S, Slic K nd De Windt LJ: MicroRNA regultion in crdiovsculr disese. Curr Drug Trgets 11: , Iked S nd Pu WT: Expression nd function of micrornas in hert disese. Curr Drug Trgets 11: , Jzbutyte V nd Thum T: MicroRNA 21: from cncer to crdiovsculr disese. Curr Drug Trgets 11: , Lgos-Quintn M, Ruhut R, Ylcin A, et l:identifiction of tissue specific micrornas from mouse. Curr Biol 12: , Mrsit CJ, Eddy K, Kelsey KT:MicroRNA responses to cellulr stress. Cncer Res 66: , Etheridge A, Lee I, Hood L, et l: Extrcellulr microrna: new source of biomrkers. Mutt Res 717: 85-90, vn Rooij E, Sutherlnd LB, Qi X, Richrdson JA, Hill J nd Olson EN: Control of stress dependent crdic growth nd gene expression by microrna. Science 316: , vn Rooij E, Quit D, Johnson BA, et l: A fmily of micrornas encoded by myosin genes governs myosin expression nd muscle performnce. Dev Cell 17: , Luo X, Zhng H, Xio J nd Wng Z: Regultion of humn crdic ion chnnel genes by micrornas: theoreticl perspective nd pthophysiologicl implictions. Cell Physiol Biochem 25: , Ye Y, Hu Z, Lin Y, et l: Downregultion of microrna-29 by ntisense inhibitors nd PPAR-gmm gonist protects ginst myocrdil ischemi-reperfusion injury. Crdiovsc Res 87: , Qin Y, Yu Y, Dong H, et l: MicroRNA 21 inhibits left ventriculr remodeling in the erly phse of rt model with ischemireperfusion injury by suppressing cell poptosis.int J Med Sci 9: , Zhng X, Wng X, Zhu H, et l: Synergistic effects of the GATA 4 medited mir-144/451 cluster in protection ginst simulted ischemi/reperfusion-induced crdiomyocyte deth. J Mol Cell Crdiol 49: , Gnesn J, Rmnujm D, Sssi Y, et l: MiR-378 controls crdic hypertrophy by combined repression of mitogen-ctivted protein kinse pthwy fctors. Circultion 127: , Luo X, Zhng H, Xio J, et l: Regultion of humn crdic ion chnnel genes by micrornas: theoreticl perspective nd pthophysiologicl implictions. Cell Physiol Biochem 25: , Terentyev D, Belevych AE, Terentyev R, et l: mir-1 overexpression enhnces C(2+) relese nd promotes crdic rrhythmogenesis by trgeting PP2A regultory subunit B56lph nd cusing CMKII dependent hyperphosphoryltion of RyR2. Circ Res 104: , Ai J, Zhng R, Li Y, et l: Circulting microrna 1 s potentil novel biomrker for cute myocrdil infrction. Biochem Biophys Res Commun 391: 73 77, Wng GK, Zhu JQ, Zhng JT, et l: Circulting microrna: novel potentil biomrker for erly dignosis of cute myocrdil infrction in humns. Eur Hert J 31: , D'Alessndr Y, Pompilio G nd Cpogrossi MC: MicroRNAs nd myocrdil infrction. Curr Opin Crdiol 27: , Iekushi K, Seeger F, Assmus B, Zeiher AM nd Dimmeler S: Regultion of crdic micrornas by bone mrrow mononucler cell therpy in myocrdil infrction. Circultion 125: , S1 S7, Zhng Y, Sun L, Zhng Y, et l: Overexpression of microrna 1cuses trioventriculr block in rodents. Int J Biol Sci 9: , Boyett MR, Ind S, Yoo S, et l: Connexins in the sinotril nd trioventriculr nodes. Adv Crdiol 42: , Luo X, Lin H, Pn Z, et l: Down regultion of mir 1/miR 133 contributes to re expression of pcemker chnnel genes HCN2 nd HCN4 in hypertrophic hert. J Biol Chem 283: , Xio J, Yng B, Lin H, Lu Y, Luo X nd Wng Z: Novel pproches for gene specific interference vi mnipulting ctions of micrornas: exmintion on the pcemker chnnel genes HCN2 nd HCN4. J Cell Physiol 212: , Li Y, Yng CM, Xi Y, et l: MicroRNA 1/133 trgeted dysfunction of potssium chnnels KCNE1 nd KCNQ1 in humn crdic progenitor cells with simulted hyperglycemi. Int J Crdiol 167: , Mtkovich SJ, Wng W, Tu Y, et l: MicroRNA 133 protects ginst myocrdil fibrosis nd modultes electricl repolriztion without ffecting hypertrophy in pressure overloded dult herts. Circ Res 106: , Xio J, Luo X, Lin H, et l: MicroRNA mir 133 represses HERG K + chnnel expression contributing to QT prolongtion in dibetic herts. J Biol Chem 282: , Stuffer BL, Sobus RD nd Suchrov CC: Sex differences in crdiomyocyte connexin43 expression. J Crdiovsc Phrmcol 58: 32 39, 2011.