acid were from Fisher Scientific (Loughborough, UK). Methanol and acetonitrile (HPLC grade) were from VWR (Lutterworth, Leicestershire, UK).

Size: px
Start display at page:

Download "acid were from Fisher Scientific (Loughborough, UK). Methanol and acetonitrile (HPLC grade) were from VWR (Lutterworth, Leicestershire, UK)."

Transcription

1 1 SUPPLEMENTAL MATERIAL 2 SUPPLEMENTARY METHODS Materials Unless stated otherwise, all solvents were from Rathburn Chemical Ltd. (Walkerburn, UK) and other chemicals from Sigma-Aldrich (Dorset, UK). HPLC gradient water and formic acid were from Fisher Scientific (Loughborough, UK). Methanol and acetonitrile (HPLC grade) were from VWR (Lutterworth, Leicestershire, UK) Quantitation of steroids and finasteride by LC-MS/MS Testosterone, DHT, 2,3,4-[ 13 C 3 ]-testosterone and 2,3,4-[ 13 C 3 ]-5α-DHT, were from Sigma- Aldrich (Dorset, UK). d9-finasteride was synthesised in-house (16) Samples were extracted via solid-phase extraction (Oasis HLB 30mg, Waters, Manchester, UK). Extraction cartridges were primed with methanol (1 ml) then water (1 ml). Samples (500 µl) were enriched with internal standard (1 ng); water (500 µl) was added. Samples were then mixed with a pipette and loaded onto primed extraction cartridges. After a wash step (50% methanol in water, 1 ml), analytes were eluted with methanol (1 ml). Eluates were dried under oxygen-free nitrogen (37 C) and reconstituted in mobile phase (100 µl). Injection volume was 10 µl LC-MS/MS analysis was performed on a Waters Acquity UPLC (Manchester, UK) with autosampler, coupled to an ABSciex QTRAP 5500 mass spectrometer (Warrington, UK), operated with Analyst Software version Analytes were separated at 35ºC on Kinetex C18 column (150 x 3 mm, 2.6 µm). Elution was achieved with a 9 minute linear gradient from 30:70 to 80:20 (methanol: water with 0.1% FA) at a flow rate of 250 µl/ min. Initial 1

2 hold was 1 minute with a linear gradient applied until 10 minutes, hold until 16 minutes, with a total run-time of 19 minutes. The mass spectrometer was operated in positive APCI mode, with curtain gas 25 psi, collision gas low, spray voltage 5 kv, nebuliser current 3.5 µa, source temperature 500 C, ion source gas 55 psi. Multiple reaction monitoring of the analyte quantifier and qualifier transitions were performed as summarised in Supplementary Table 1. Peak areas ratios of analyte/internal standard were calculated and calibration lines, with appropriate weighting factors applied and amounts in serum calculated by interpolation Quantitation of glucose, glycerol, d2-glucose and d5-glycerol by gas chromatography mass spectrometry (GC-MS) A standard curve was prepared in expected concentration ranges of glucose ( mm), glycerol ( µm), d2-glucose ( mm) and d5-glycerol ( µm) in plasma. Internal standards were 13 C 6 -glucose (Isotec; Dorset, UK), d2-glucose and d5-glycerol (Cambridge Isotope Laboratories, Inc., Andover, USA). An enrichment curve was prepared representing 0-12% enrichment for both glucose and glycerol, with d2-glucose and d5- glycerol respectively Acetonitrile (1 ml) was added to extraction wells (96-well Strata Impact protein precipitation plate, Phenomenex, Macclesfield, Cheshire, UK). Standards, enrichment standards and samples (200 µl) were added. Internal standard solution (25 µl) was added to standard curve and samples. Internal standard was not added to enrichment samples. After a 20 minute incubation (RT), vacuum was applied (0.3 bar) and extracts collected. Eluates were reduced to dryness under oxygen-free nitrogen (OFN; 37 C). Acetate derivatives were formed; to the dry residue pyridine: acetic anhydride (200 µl, 1:1, v/v) was added and this was allowed to stand (RT, 15 minutes). Derivatised samples were dried under OFN (37 C) 2

3 1 2 and reconstituted in 5% acetic anhydride in heptane. 1 µl of sample was injected onto the GC-MS system The gas chromatograph mass spectrometer (GC-MS) consisted of a Finnigan GC8000 TOP GC, a AS800 autosampler, a single quadropole Voyager mass spectrometer, operated via Xcalibur software version 1.2 (Finnigan, now Thermo Scientific, Manchester, UK). The analytical column was a HP-Innowax column (30 m x 0.32 mm x 0.25 µm; Agilent Technologies Ltd., Stockport, UK). The sample was injected (1 µl) by splitless injection, with injector temperature set to 260 C. The column oven temperature was 60 C at injection, programmed to reach 150 C at a rate of 30 C/minute, and then further programmed to reach 260 C at a rate of 10 C, with a final hold time of 3 minutes. Interface and source temperatures were 240 C and 175 C respectively. Helium gas was used as the mobile phase, at a flow rate of 2.5 ml/min. Mass spectra were recorded using negative ion chemical ionisation with methane as reagent gas at an electron energy of 70 ev. Selected ion monitoring was used with a total run-time of 18 minutes. Derivatives of glycerol, d5-glycerol and butanetriol were monitored from 0-10 minutes, and those of glucose, d2-glucose and 13 C 6 -glucose monitored from minutes. Monitored ions were: glycerol triacetate m/z 217, d5-glycerol triacetate m/z 222, butanetriol triacete m/z 231 (internal standard), glucose pentacetate m/z 287, d2-glucose pentacetate m/z 289, 13 C 6 -glucose pentacetate m/z 293 (internal standard). 21 3

4 SUPPLEMENTARY FIGURE LEGENDS Supplementary Figure 1 Recruitment and participation rates Yes indicates an interest in participation, No indicates either an unfavourable response or no response. Two of the 4 participants who did not complete the study were assigned a study number following informed consent but did not participate further. Supplememtal Figure 2 Glucoseinfusion rates during euclyaemic hyperinsulinaemic clamp Graphs showing glucose infusion rates (steady state phases of the hyperinsulinaemic euglycaemic clamp; mins no insulin, mins low-dose insulin, mins high-dose insulin shown in grey). Open and closed symbols are data from subjects prior to or after receiving drug treatment respectively. N=14-16/ group. Data are mean± SEM. Supplementary Figure 3 Salivary cortisol concentrations Salivary cortisol levels through the day before (open shapes) and after (filled shapes) three months of dutasteride, finasteride or tamsulosin; absolute levels and variations through the day did not differ in response to treatment. Samples collected at waking, 30 minutes after waking ( 30 min ), 1200h, 1600h, and bedtime. Data points are mean; error bars indicate SEM. 4

5 Supplemental Table 1 Primers and probes for PCR Gene: Name Gene accession number Quantitation of transcript abundance by real-time qpcr ACACA: Acetyl-Coenzyme A carboxylase α isoform 1 NM_ PLIN2: Adipocyte differentiation-related protein (Perilipin 2) NM_ ADIPOQ: Adiponectin NM_ AR: Androgen receptor NM_ DGAT2: Diacylglycerol O-acyltransferase homolog 2 NM_ ESR1: Estrogen receptor α NM_ ESR2: Estrogen receptor β NM_ FASN: Fatty acid synthase NM_ GPD2: Glycerol-3-phosphate dehydrogenase 2 (mitochondrial) NM_ NR3C1: Glucocorticoid receptor NM_ ,NM_ ,NM_ ,NM_ ,NM_ LIPE: Hormone sensitive lipase NM_ Primer sequences Forward followed by reverse GATGTGGATGATGGGCTACA TGAGGCCTTGATCATTACTGG TCAGCTCCATTCTACTGTTCACC CCTGAATTTTCTGATTGGCACT GGTGAGAAGGGTGAGAAAGGA TTTCACCGATGTCTCCCTTAG GCCTTGCTCTCTAGCCTCAA GTCGTCCACGTGTAAGTTGC GAGGGGTCTGGGAGATGG TTGAGCCAGGTGACAGAGAA TTACTGACCAACCTGGCAGA ATCATGGAGGGTCAAATCCA TGGGTGATTGCCAAGAGC GTTTGAGAGGCCTTTTCTGC UPL Probe CAGGCACACACGATGGAC 11 CGGAGTGAATCTGGGTTGAT TCGCGCGTGAGGATCTAT AGTCCTAAAACAGTTGCAAGAGC TTCAAAAGAGCAGTGGAAGGA TTTCTTCGAATTTTATCGATGATG TGCTCGGAATCACAGACACT CAGGTCCATGTTGTGGATGA

6 LEP: Leptin NM_ LPL: Lipoprotein lipase NM_ HSD11B1: 11β-Hydroxysteroid dehydrogenase type 1 (11β HSD1) NM_ GPAM: Glycerol-3-phosphate acyltransferase 1 (mitochondrial) NM_ MCP1: Monocyte chemotactic protein 1 NM_ PPARG: Peroxisome proliferator-activated receptor γ (PPARγ) NM_ PPARGC1A: PPARγ coactivator 1α NM_ SRD5A1: 5α-Reductase type 1 (5αR1) NM_ SREBF1: Sterol regulatory element binding transcription factor 1 NM_ SREBF2: Sterol regulatory element-binding transcription factor 2 NM_ UCP 2: Uncoupling protein 2 NM_ PPIA: Peptidylprolyl isomerase A (cyclophilin A) NM_ TBP: TATA-binding protein NM_ TTGTCACCAGGATCAATGACA GTCCAAACCGGTGACTTTCT ATGTGGCCCGGTTTATCA CTGTATCCCAAGAGATGGACATT CAATGGAAGCATTGTTGTCG GGCAGCAACCATTGGATAAG GGAAAGTTTATCCAGTATGGCATT TGATATCTTCCTGGTCATCGTG TTCTGTGCCTGCTGCTCAT GGGGCATTGATTGCATCT TGACAGGAAAGACAACAGACAAAT GGGTGATGTGTTTGAACTTGATT TGAGAGGGCCAAGCAAAG ATAAATCACACGGCGCTCTT TTGGAGAAATCATGGAGTGGT ACTCTTCAAATTTCCGGAGGTA CGCTCCTCCATCAATGACA TGCGCAAGACAGCAGATTTA ATCTGGATCTCGCCAGAGG CCAGGCAGGTTTGTAGGTTG TGAAAGCCAACCTCATGACA GATGACAGTGGTGCAGAAGC ATGCTGGACCCAACACAAAT TCTTTCACTTTGCCAAACACC GAACATCATGGATCAGAACAACA ATAGGGATTCCGGGAGTCAT GAPDH: Glyceraldehyde-3-phosphate dehydrogenase AGCCACATCGCTCAGACAC

7 NM_ Tissue screening by reverse transcriptase-pcr SRD5A1: 5α-Reductase type 1 (5αR1) SRD5A2: 5α-Reductase type 1 (5αR2) GCCCAATACGACCAAATCC TGGCGCTTCTCTATGGACTT ACACAGCACCTGACACGAA GCCCTCTCCTCATAGTGCTG GCAAGCAGCATGTAACCTCA Assays used for real-time polymerase chain reaction analysis and primers used for isozyme distribution of 5αR1 and 5αR2. PCR = polymerase chain reaction

8 Supplemental Table 2 Conditions for LC-MS/MS assays for steroids and drugs in serum Precursor Product Declustering Collision Cell exit ion ions potential (V) energy (V) potential (V) m/z m/z Quan; qual Testosterone ; ; 31 14; 16 DHT Finasteride ; ; 41 14; 28 Dutasteride ; ; 55 48; C 3 -Testosterone ; ; 35 4; 8 13 C 3 -DHT d9-finasteride ; ; 41 34; 36 Using atmospheric pressure chemical ionisation; quan, quantifier ion; qual, qualifier ion; V, volts; DHT, dihydrotestosterone.

9 Supplemental Table 3 Effects of drug intervention on serum adipokines and cytokines Leptin pg/ml Adiponectin µg/ml Resistin ng/ml MCP-1 pg/ml IL-8 pg/ml Dutasteride Finasteride Tamsulosin P from ANOVA Before After Change Before After Change Before After Change (461) 3487 (504) 28 (281) (485) p=0.32 (1696) (1518) (928) (1899) (2052) 13.4 (0.5) 14.7 (0.6) 1.3 (1.0) 13.7 (0.7) 14.6 (0.5) 0.9 (0.7) 16.4 (0.2) 16.7 (0.4) 0.3 (0.4) p= (0.4) 24.0 (0.4) 0.4 (0.5) 23.3 (0.3) 23.6 (0.6) 0.2 (0.6) 27.0 (0.3) 29.9 (0.3) 2.9 (0.6) p= (17.5) 238 (20.2) 1 (17) 189 (17.4) 197 (21.5) 8 (14) 274 (29.4) 249 (28.6) -25 (15) p= (0.9) 5.6 (0.9) 0.0 (0.3) 6.0 (1.2) 6.3 (0.9) 0.3 (0.6) 7.3 (0.4) 6.2 (0.4) -1.1 (0.4) p=0.08 Data are mean (SEM). MCP-1, monocyte chemoattractant protein 1; IL-8, interleukin 8. Kruskal-Wallis test.

10 Supplemental Table 4 Effects of drug interventions on subcutaneous adipose mrna transcripts Dutasteride (n=13) Finasteride (n=14) Tamsulosin (n=12) P from ANOVA Before After Before After Before After AR (androgen receptor) 0.34 (0.05) 0.22 (0.04) 0.31 (0.03) 0.23 (0.03) 0.22 (0.03) 0.26 (0.05) p=0.045* SRD5A1 (5αR1) 0.28 (0.03) 0.29 (0.02) 0.28 (0.02) 0.24 (0.03) 0.30 (0.03) 0.31 (0.03) p=0.47 HSD11B1 (11βHSD1) 0.44 (0.08) 0.28 (0.07) 0.35 (0.06) 0.23 (0.03) 0.52 (0.16) 0.27 (0.09) p=0.58 NR3C1 (total GR) 0.35 (0.05) 0.34 (0.03) 0.34 (0.05) 0.31 (0.04) 0.26 (0.03) 0.27 (0.03) p=0.62 ESR1 (ERα) 0.32 (0.04) 0.26 (0.04) 0.40 (0.06) 0.32 (0.05) 0.32 (0.04) 0.32 (0.04) p=0.40 ESR2 (ERβ) 0.32 (0.04) 0.32 (0.06) 0.35 (0.04) 0.31 (0.04) 0.32 (0.04) 0.29 (0.04) p=0.86 ACACA (Acetyl CoA carboxylase) 0.20 (0.03) 0.25 (0.05) 0.27 (0.04) 0.24 (0.04) 0.21 (0.02) 0.26 (0.05) p=0.28 UCP2 (Uncoupling protein 2) 0.25 (0.05) 0.29 (0.08) 0.24 (0.03) 0.27 (0.04) 0.24 (0.04) 0.23 (0.02) p=0.65 FASN (Fatty acid synthase) 0.29 (0.04) 0.30 (0.06) 0.39 (0.07) 0.28 (0.06) 0.25 (0.05) 0.43 (0.14) p=0.17 LIPE (Hormone sensitive lipase) 0.36 (0.10) 0.24 (0.04) 0.44 (0.08) 0.34 (0.04) 0.33 (0.05) 0.32 (0.06) p=0.62 PLIN2 (Perilipin) 0.30 (0.04) 0.22 (0.04) 0.32 (0.04) 0.25 (0.03) 0.33 (0.05) 0.26 (0.03) p=0.97 PPARG (PPARγ) 0.46 (0.06) 0.40 (0.06) 0.49 (0.05) 0.46 (0.04) 0.45 (0.05) 0.48 (0.09) p=0.61 PPARGC1A (PPARγ, coactivator 1α) 0.43 (0.13) 0.19 (0.02) 0.38 (0.05) 0.34 (0.05) 0.26 (0.03) 0.25 (0.05) p=0.33

11 GPD2 (G3P dehydrogenase) 0.33 (0.03) 0.38 (0.04) 0.30 (0.03) 0.28 (0.02) 0.31 (0.03) 0.35 (0.03) p=0.36 LEP (Leptin) 0.19 (0.04) 0.17 (0.03) 0.19 (0.02) 0.12 (0.02) 0.18 (0.04) 0.17 (0.04) p=0.37 ADIPOQ (Adiponectin) 0.35 (0.03) 0.32 (0.06) 0.40 (0.04) 0.30 (0.04) 0.26 (0.03) 0.34 (0.06) p=0.10 MCP (0.06) 0.29 (0.04) 0.40 (0.07) 0.39 (0.08) 0.48 (0.07) 0.34 (0.06) p=0.47 DGAT (0.05) 0.29 (0.06) 0.31 (0.05) 0.24 (0.06) 0.18 (0.02) 0.32 (0.09) p=0.12 SREBF (0.04) 0.17 (0.06) 0.18 (0.03) 0.26 (0.08) 0.13 (0.02) 0.24 (0.06) p=0.28 SREBF (0.04) 0.44 (0.05) 0.44 (0.06) 0.40 (0.08) 0.36 (0.04) 0.44 (0.08) p=0.27 LPL (Lipoprotein lipase) 0.32 (0.04) 0.25 (0.04) 0.30 (0.03) 0.23 (0.03) 0.30 (0.03) 0.31 (0.05) p=0.39 GPAM (G3P acyl-transferase) 0.33 (0.06) 0.32 (0.06) 0.28 (0.04) 0.22 (0.03) 0.25 (0.04) 0.27 (0.07) p=0.62 Data are mean (SEM). Analysed by Kruskal-Wallis test. *p=0.02 dutasteride versus tamsulosin, and p=0.06 dutasteride versus finasteride.

12 Supplemental Figure Clinic patients reviewed 37 Primary care patients invited Healthy participant advertising 255 Information sheets requested or sent 95 Yes 160 No 58 Attend screening 44 Ineligible / Unable to participate 51 Consented 7 Not consented/ Ineligible 47 Completed study 4 Did not complete study 46 Included in final analysis

13 Supplemental Figure Dutasteride Prior After G;ucose Infusion Rate mg/min Finasteride Tamsulosin Prior After Prior After Duration of Tracer Infusions (mins)

14 Supplemental Figure 3

Analysis of Testosterone, Androstenedione, and Dehydroepiandrosterone Sulfate in Serum for Clinical Research

Analysis of Testosterone, Androstenedione, and Dehydroepiandrosterone Sulfate in Serum for Clinical Research Analysis of Testosterone, Androstenedione, and Dehydroepiandrosterone Sulfate in Serum for Clinical Research Dominic Foley, Michelle Wills, and Lisa Calton Waters Corporation, Wilmslow, UK APPLICATION

More information

Dienes Derivatization MaxSpec Kit

Dienes Derivatization MaxSpec Kit Dienes Derivatization MaxSpec Kit Item No. 601510 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

Extraction of Aflatoxin M1 From Infant Formula Using ISOLUTE Myco SPE Columns prior to LC-MS/MS Analysis

Extraction of Aflatoxin M1 From Infant Formula Using ISOLUTE Myco SPE Columns prior to LC-MS/MS Analysis Application Note AN807 Extraction of Aflatoxin M From Infant Formula Using ISLUTE Myco Page Extraction of Aflatoxin M From Infant Formula Using ISLUTE Myco SPE Columns prior to LC-MS/MS Analysis This application

More information

Extraction of Multiple Mycotoxins From Nuts Using ISOLUTE Myco prior to LC-MS/MS Analysis

Extraction of Multiple Mycotoxins From Nuts Using ISOLUTE Myco prior to LC-MS/MS Analysis Application Note AN784 Extraction of Multiple Mycotoxins from Nuts Using ISOLUTE Myco Page 1 Extraction of Multiple Mycotoxins From Nuts Using ISOLUTE Myco prior to LC-MS/MS Analysis This application note

More information

Determination of 6-Chloropicolinic Acid (6-CPA) in Crops by Liquid Chromatography with Tandem Mass Spectrometry Detection. EPL-BAS Method No.

Determination of 6-Chloropicolinic Acid (6-CPA) in Crops by Liquid Chromatography with Tandem Mass Spectrometry Detection. EPL-BAS Method No. Page 1 of 10 Determination of 6-Chloropicolinic Acid (6-CPA) in Crops by Liquid Chromatography with Tandem Mass Spectrometry Detection EPL-BAS Method No. 205G881B Method Summary: Residues of 6-CPA are

More information

A Robustness Study for the Agilent 6470 LC-MS/MS Mass Spectrometer

A Robustness Study for the Agilent 6470 LC-MS/MS Mass Spectrometer A Robustness Study for the Agilent 7 LC-MS/MS Mass Spectrometer Application Note Clinical Research Authors Linda Côté, Siji Joseph, Sreelakshmy Menon, and Kevin McCann Agilent Technologies, Inc. Abstract

More information

Supporting Information Table of content

Supporting Information Table of content Supporting Information Table of content Supporting Information Fig. S1 Supporting Information Fig. S2 Supporting Information Fig. S3 Supporting Information Fig. S4 Supporting Information Fig. S5 Supporting

More information

Extraction of Multiple Mycotoxins From Grain Using ISOLUTE Myco prior to LC-MS/MS Analysis

Extraction of Multiple Mycotoxins From Grain Using ISOLUTE Myco prior to LC-MS/MS Analysis Application Note AN782 Extraction of Multiple Mycotoxins from Grain Using ISOLUTE Myco Page 1 Extraction of Multiple Mycotoxins From Grain Using ISOLUTE Myco prior to LC-MS/MS Analysis This application

More information

Supporting information

Supporting information Supporting information Figure legends Supplementary Table 1. Specific product ions obtained from fragmentation of lithium adducts in the positive ion mode comparing the different positional isomers of

More information

Rapid and Robust Detection of THC and Its Metabolites in Blood

Rapid and Robust Detection of THC and Its Metabolites in Blood Rapid and Robust Detection of THC and Its Metabolites in Blood Application Note Forensics/Doping Control Author Stephan Baumann Agilent Technologies, Inc. Santa Clara CA 95051 USA Abstract A robust method

More information

Quantification of lovastatin in human plasma by LC/ESI/MS/MS using the Agilent 6410 Triple Quadrupole LC/MS system

Quantification of lovastatin in human plasma by LC/ESI/MS/MS using the Agilent 6410 Triple Quadrupole LC/MS system Quantification of lovastatin in human plasma by LC/ESI/MS/MS using the Agilent 641 Triple Quadrupole LC/MS system Application Note Clinical Research Author Siji Joseph Agilent Technologies Bangalore, India

More information

Validation of a Reliable LC-MS/MS Method for Analysis of Simultaneously in Clinical Laboratory

Validation of a Reliable LC-MS/MS Method for Analysis of Simultaneously in Clinical Laboratory Validation of a Reliable LC-MS/MS Method for Analysis of Simultaneously in Clinical Laboratory Five Steroids Atecla Nunciata Lopes Alves, Berenice Bilharinho Mendonca, Helena Panteliou Lima Valassi. Laboratório

More information

LC-MS/MS Method for the Determination of Tenofovir from Plasma

LC-MS/MS Method for the Determination of Tenofovir from Plasma LC-MS/MS Method for the Determination of Tenofovir from Plasma Kimberly Phipps, Thermo Fisher Scientific, Runcorn, Cheshire, UK Application Note 687 Key Words SPE, SOLA CX, Hypersil GOLD, tenofovir Abstract

More information

A RAPID AND SENSITIVE ANALYSIS METHOD OF SUDAN RED I, II, III & IV IN TOMATO SAUCE USING ULTRA PERFORMANCE LC MS/MS

A RAPID AND SENSITIVE ANALYSIS METHOD OF SUDAN RED I, II, III & IV IN TOMATO SAUCE USING ULTRA PERFORMANCE LC MS/MS A RAPID AD SESITIVE AALYSIS METD OF SUDA RED I, II, III & IV I TOMATO SAUCE USIG ULTRA PERFORMACE LC MS/MS Choon Keow G, aomi TAAKA, Michelle KIM, Swee Lee YAP Waters Asia, Regional Technology Center,

More information

Robust extraction, separation, and quantitation of structural isomer steroids from human plasma by SPE-UHPLC-MS/MS

Robust extraction, separation, and quantitation of structural isomer steroids from human plasma by SPE-UHPLC-MS/MS TECHNICAL NOTE 21882 Robust extraction, separation, and quantitation of structural isomer steroids human plasma by SPE-UHPLC-MS/MS Authors Jon Bardsley 1, Kean Woodmansey 1, and Stacy Tremintin 2 1 Thermo

More information

Fatty Acid Mass Spectrometry Protocol Updated 10/11/2007 By Daren Stephens

Fatty Acid Mass Spectrometry Protocol Updated 10/11/2007 By Daren Stephens Fatty Acid Mass Spectrometry Protocol Updated 10/11/2007 By Daren Stephens Synopsis: This protocol describes the standard method for extracting and quantifying free fatty acids found in cells and media

More information

SPE-LC-MS/MS Method for the Determination of Nicotine, Cotinine, and Trans-3-hydroxycotinine in Urine

SPE-LC-MS/MS Method for the Determination of Nicotine, Cotinine, and Trans-3-hydroxycotinine in Urine SPE-LC-MS/MS Method for the Determination of Nicotine, Cotinine, and Trans-3-hydroxycotinine in Urine J. Jones, Thermo Fisher Scientific, Runcorn, Cheshire, UK Application Note 709 Key Words SPE, SOLA

More information

Determination of β2-agonists in Pork Using Agilent SampliQ SCX Solid-Phase Extraction Cartridges and Liquid Chromatography-Tandem Mass Spectrometry

Determination of β2-agonists in Pork Using Agilent SampliQ SCX Solid-Phase Extraction Cartridges and Liquid Chromatography-Tandem Mass Spectrometry Determination of β2-agonists in Pork Using Agilent SampliQ SCX Solid-Phase Extraction Cartridges and Liquid Chromatography-Tandem Mass Spectrometry Application Note Food Safety Authors Chenhao Zhai Agilent

More information

PHOTOCATALYTIC DECONTAMINATION OF CHLORANTRANILIPROLE RESIDUES IN WATER USING ZnO NANOPARTICLES. DR. A. RAMESH, Ph.D, D.Sc.,

PHOTOCATALYTIC DECONTAMINATION OF CHLORANTRANILIPROLE RESIDUES IN WATER USING ZnO NANOPARTICLES. DR. A. RAMESH, Ph.D, D.Sc., PHOTOCATALYTIC DECONTAMINATION OF CHLORANTRANILIPROLE RESIDUES IN WATER USING ZnO NANOPARTICLES DR. A. RAMESH, Ph.D, D.Sc., raamesh_a@yahoo.co.in 1 OBJECTIVES Determination of persistence and photolysis

More information

Vitamin D Metabolite Analysis in Biological Samples Using Agilent Captiva EMR Lipid

Vitamin D Metabolite Analysis in Biological Samples Using Agilent Captiva EMR Lipid Vitamin D Metabolite Analysis in Biological Samples Using Agilent Captiva EMR Lipid Application Note Clinical Research Authors Derick Lucas and Limian Zhao Agilent Technologies, Inc. Abstract Lipids from

More information

LCMS-8030 Application Report. Steroids: Testosterone, Progesterone, Estradiol, Ethinylestradiol

LCMS-8030 Application Report. Steroids: Testosterone, Progesterone, Estradiol, Ethinylestradiol LCMS-8030 Application Report Steroids: Testosterone, Progesterone, Estradiol, Ethinylestradiol Summary: Sensitivity was tested for four steroids on the LCMS-8030 triple quadrupole mass spectrometer coupled

More information

Quantification of PtdInsP 3 molecular species in cells and tissues by mass spectrometry

Quantification of PtdInsP 3 molecular species in cells and tissues by mass spectrometry Nature Methods Quantification of PtdInsP 3 molecular species in cells and tissues by mass spectrometry Jonathan Clark, Karen E Anderson, Veronique Juvin, Trevor S Smith, Fredrik Karpe, Michael J Wakelam,

More information

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at

Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at Fig. S1. Dose-response effects of acute administration of the β3 adrenoceptor agonists CL316243, BRL37344, ICI215,001, ZD7114, ZD2079 and CGP12177 at doses of 0.1, 0.5 and 1 mg/kg on cumulative food intake

More information

Extraction of a Comprehensive Steroid Panel from Human Serum Using ISOLUTE. SLE+ Prior to LC/MS-MS Analysis

Extraction of a Comprehensive Steroid Panel from Human Serum Using ISOLUTE. SLE+ Prior to LC/MS-MS Analysis Application Note AN890 Extraction of a Comprehensive Steroid Panel from Human Serum Using ISOLUTE SLE+ Page Extraction of a Comprehensive Steroid Panel from Human Serum Using ISOLUTE SLE+ Prior to LC/MS-MS

More information

A Novel Solution for Vitamin K₁ and K₂ Analysis in Human Plasma by LC-MS/MS

A Novel Solution for Vitamin K₁ and K₂ Analysis in Human Plasma by LC-MS/MS A Novel Solution for Vitamin K₁ and K₂ Analysis in Human Plasma by LC-MS/MS By Shun-Hsin Liang and Frances Carroll Abstract Vitamin K₁ and K₂ analysis is typically complex and time-consuming because these

More information

UPLC-MS/MS Analysis of Azole Antifungals in Serum for Clinical Research

UPLC-MS/MS Analysis of Azole Antifungals in Serum for Clinical Research Stephen Balloch and Gareth Hammond Waters Corporation, Wilmslow, UK APPLICATION BENEFITS Analytical selectivity afforded by mass selective detection Wide linear measuring range Simple, inexpensive sample

More information

Extraction of 25-hydroxy Vitamin D from Serum Using ISOLUTE. PLD+ Prior to LC-MS/MS Analysis

Extraction of 25-hydroxy Vitamin D from Serum Using ISOLUTE. PLD+ Prior to LC-MS/MS Analysis Application Note AN842.V. Extraction of 25-hydroxy Vitamin D from Serum Using ISOLUTE PLD+ Prior to LC-MS/MS Analysis Page Extraction of 25-hydroxy Vitamin D from Serum Using ISOLUTE PLD+ Prior to LC-MS/MS

More information

Application Note. Author. Abstract. Introduction. Food Safety

Application Note. Author. Abstract. Introduction. Food Safety Determination of β2-agonists in Pork with SPE eanup and LC-MS/MS Detection Using Agilent BondElut PCX Solid-Phase Extraction Cartridges, Agilent Poroshell 120 column and Liquid Chromatography-Tandem Mass

More information

Authors. Abstract. Introduction. Environmental

Authors. Abstract. Introduction. Environmental Determination of Ultratrace Amitrol in Water Samples by in situ Derivatization-Solid Phase Extraction-Liquid Chromatography-Mass Selective Detector Application Environmental Authors Gerd Vanhoenacker,

More information

Simple Method (IS-MRM) to Monitor Lysophospholipids and Phospholipids During LC-MS Method Development via In-Source CID

Simple Method (IS-MRM) to Monitor Lysophospholipids and Phospholipids During LC-MS Method Development via In-Source CID Simple Method (IS-MRM) to Monitor Lysophospholipids and Phospholipids During LC-MS Method Development via In-Source CID James Little, Eastman Chemical Company, Kingsport, TN Overview Phospholipids and

More information

Key Advantages of Comprehensive Cannabis Analysis

Key Advantages of Comprehensive Cannabis Analysis Comprehensive Cannabis Analysis: Pesticides, Aflatoxins, Terpenes, and High Linear Dynamic Range Potency from One Extract Using One Column and One Solvent System Robert Di Lorenzo 1, Diana Tran 2, KC Hyland

More information

Core E Analysis of Neutral Lipids from Human Plasma June 4, 2010 Thomas J. Leiker and Robert M. Barkley

Core E Analysis of Neutral Lipids from Human Plasma June 4, 2010 Thomas J. Leiker and Robert M. Barkley Core E Analysis of Neutral Lipids from Human Plasma June 4, 2010 Thomas J. Leiker and Robert M. Barkley This protocol describes the extraction and direct measurement of cholesterol esters (CEs) and triacylglycerols

More information

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents

Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Enrichment of Phospholipids from Biological Matrices with Zirconium Oxide-Modified Silica Sorbents Xiaoning Lu, Jennifer E. Claus, and David S. Bell Supelco, Div. of Sigma-Aldrich Bellefonte, PA 16823

More information

Detection, Confirmation, and Quantification of Chloramphenicol in Honey, Shrimp and Chicken Using the Agilent 6410 LC/MS Triple Quadrupole

Detection, Confirmation, and Quantification of Chloramphenicol in Honey, Shrimp and Chicken Using the Agilent 6410 LC/MS Triple Quadrupole Detection, Confirmation, and Quantification of Chloramphenicol in Honey, Shrimp and Chicken Using the Agilent LC/MS Triple Quadrupole Application Food Safety Authors Yanyan Fang Agilent Technologies (Shanghai),

More information

Oxysterol Derivatization MaxSpec Kit

Oxysterol Derivatization MaxSpec Kit Oxysterol Derivatization MaxSpec Kit Item No. 601540 www.caymanchem.com Customer Service 800.364.9897 Technical Support 888.526.5351 1180 E. Ellsworth Rd Ann Arbor, MI USA TABLE OF CONTENTS GENERAL INFORMATION

More information

Determination of Amantadine Residues in Chicken by LCMS-8040

Determination of Amantadine Residues in Chicken by LCMS-8040 Liquid Chromatography Mass Spectrometry Determination of Amantadine Residues in Chicken by LCMS-8040 A method for the determination of amantadine in chicken was established using Shimadzu Triple Quadrupole

More information

O O H. Robert S. Plumb and Paul D. Rainville Waters Corporation, Milford, MA, U.S. INTRODUCTION EXPERIMENTAL. LC /MS conditions

O O H. Robert S. Plumb and Paul D. Rainville Waters Corporation, Milford, MA, U.S. INTRODUCTION EXPERIMENTAL. LC /MS conditions Simplifying Qual/Quan Analysis in Discovery DMPK using UPLC and Xevo TQ MS Robert S. Plumb and Paul D. Rainville Waters Corporation, Milford, MA, U.S. INTRODUCTION The determination of the drug metabolism

More information

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR

Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Supplementary Table 1. Primer Sequences Used for Quantitative Real-Time PCR Gene Forward Primer (5-3 ) Reverse Primer (5-3 ) cadl CTTGGGGGCGCGTCT CTGTTCTTTTGTGCCGTTTCG cyl-coenzyme Dehydrogenase, very

More information

All stocks and calibration levels were prepared in water: methanol (50:50) v/v to cover range of all steroid concentrations (refer Table 1).

All stocks and calibration levels were prepared in water: methanol (50:50) v/v to cover range of all steroid concentrations (refer Table 1). Application LCMS-8040 Simultaneous determination of 11 steroids and Vitamin D2/D3 in human serum using LC/MS/MS - Introduction Quantification of endogenous hormonal steroids and their precursors is essential

More information

Comprehensive Study of SLE as a Sample. Preparation Tool for Bioanalysis

Comprehensive Study of SLE as a Sample. Preparation Tool for Bioanalysis Comprehensive Study of SLE as a Sample Preparation Tool for Bioanalysis Wan Wang, Warren Chen, Jerry Wang Bonna-Agela Technologies 179 Southern Street, West TEDA, Tianjin, China Abstract A simple, fast,

More information

Determination of Aflatoxins in Food by LC/MS/MS. Application. Authors. Abstract. Experimental. Introduction. Food Safety

Determination of Aflatoxins in Food by LC/MS/MS. Application. Authors. Abstract. Experimental. Introduction. Food Safety Determination of Aflatoxins in Food by LC/MS/MS Application Food Safety Authors Masahiko Takino Agilent Technologies 9-1 Takakura-Cho Hachiouji-Shi, Tokyo Japan Toshitsugu Tanaka Kobe Institute of Health

More information

MS/MS as an LC Detector for the Screening of Drugs and Their Metabolites in Race Horse Urine

MS/MS as an LC Detector for the Screening of Drugs and Their Metabolites in Race Horse Urine Application Note: 346 MS/MS as an LC Detector for the Screening of Drugs and Their Metabolites in Race Horse Urine Gargi Choudhary and Diane Cho, Thermo Fisher Scientific, San Jose, CA Wayne Skinner and

More information

Sample Concentration and Analysis of Human Hormones in Drinking Water

Sample Concentration and Analysis of Human Hormones in Drinking Water Sample Concentration and Analysis of Human Hormones in Drinking Water Carl Fisher Applications Chemist Ion Chromatography/Sample Preparation Thermo Fisher Scientific March 1, 215 1 The world leader in

More information

Dry eye disease commonly known as atopic keratoconjunctivitis is an autoimmune disease of

Dry eye disease commonly known as atopic keratoconjunctivitis is an autoimmune disease of 4.1. Introduction Dry eye disease commonly known as atopic keratoconjunctivitis is an autoimmune disease of eyes. The disease is characterized by lesser or some time no-significant production of tear;

More information

Dr. Erin E. Chambers Waters Corporation. Presented by Dr. Diego Rodriguez Cabaleiro Waters Europe Waters Corporation 1

Dr. Erin E. Chambers Waters Corporation. Presented by Dr. Diego Rodriguez Cabaleiro Waters Europe Waters Corporation 1 Development of an SPE-LC/MS/MS Assay for the Simultaneous Quantification of Amyloid Beta Peptides in Cerebrospinal Fluid in Support of Alzheimer s Research Dr. Erin E. Chambers Waters Corporation Presented

More information

SUPPLEMENTARY MATERIAL

SUPPLEMENTARY MATERIAL SUPPLEMENTARY MATERIAL Artepillin C, is it a good marker for quality control of Brazilian Green Propolis? Cui-ping Zhang 1, Xiao-ge Shen 1, Jia-wei Chen 1, Xia-sen Jiang 1, Kai Wang 2, Fu-liang Hu 1 *

More information

LC/MS/MS Separation of Cholesterol and Related Sterols in Plasma on an Agilent InfinityLab Poroshell 120 EC C18 Column

LC/MS/MS Separation of Cholesterol and Related Sterols in Plasma on an Agilent InfinityLab Poroshell 120 EC C18 Column Application Note Clinical Research LC/MS/MS Separation of Cholesterol and Related Sterols in Plasma on an Agilent InfinityLab Poroshell EC C8 Column Authors Rongjie Fu and Zhiming Zhang Agilent Technologies

More information

Lipidomic Analysis by UPLC-QTOF MS

Lipidomic Analysis by UPLC-QTOF MS Lipidomic Analysis by UPLC-QTOF MS Version: 1 Edited by: Oliver Fiehn Summary Reagents and Materials Protocol Summary:Lipidomic analysis by UPLC-QTOF mass spectrometry Reagents and Materials: Reagent/Material

More information

Integration of steroids analysis in serum using LC-MS/MS with full-automated sample preparation

Integration of steroids analysis in serum using LC-MS/MS with full-automated sample preparation PO-CON69E Integration of steroids analysis in serum using LC-MS/MS with full-automated sample preparation MSACL 6 EU Stéphane Moreau, Daisuke Kawakami, Toshikazu Minohata Shimadzu Europe GmbH, Duisburg,

More information

Rapid Analysis of Water-Soluble Vitamins in Infant Formula by Standard-Addition

Rapid Analysis of Water-Soluble Vitamins in Infant Formula by Standard-Addition Rapid Analysis of Water-Soluble Vitamins in Infant Formula by Standard-Addition Evelyn Goh Waters Pacific, Singapore APPLICATION BENEFITS This method allows for the simultaneous analysis of 12 water-soluble

More information

SUPPORTING INFORMATION FOR: CONCENTRATIONS OF POLYBROMINATED DIPHENYL ETHERS, HEXABROMOCYCLODODECANES AND TETRABROMOBISPHENOL-A IN BREAST MILK FROM

SUPPORTING INFORMATION FOR: CONCENTRATIONS OF POLYBROMINATED DIPHENYL ETHERS, HEXABROMOCYCLODODECANES AND TETRABROMOBISPHENOL-A IN BREAST MILK FROM SUPPORTING INFORMATION FOR: CONCENTRATIONS OF POLYBROMINATED DIPHENYL ETHERS, HEXABROMOCYCLODODECANES AND TETRABROMOBISPHENOL-A IN BREAST MILK FROM UNITED KINGDOM WOMEN DO NOT DECREASE OVER TWELVE MONTHS

More information

Development of a Bioanalytical Method for Quantification of Amyloid Beta Peptides in Cerebrospinal Fluid

Development of a Bioanalytical Method for Quantification of Amyloid Beta Peptides in Cerebrospinal Fluid Development of a Bioanalytical Method for Quantification of Amyloid Beta Peptides in Cerebrospinal Fluid Joanne ( 乔安妮 ) Mather Senior Scientist Waters Corporation Data courtesy of Erin Chambers and Mary

More information

Step 3: muscle, nasal sprays and drops or used as topical

Step 3: muscle, nasal sprays and drops or used as topical Extraction of Corticosteroids using 96-well Supported Liquid Extraction (SLE) and LC-MS/MS Analysis Lee Williams, Matthew Cleeve, elen Lodder, Steve Jordan, Richard Calverley & Joanna Smith Biotage GB

More information

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr

SUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA

More information

Relative Quantitation of Human Polymorphonuclear Leukocyte Cell Membrane GPEtn Lipids

Relative Quantitation of Human Polymorphonuclear Leukocyte Cell Membrane GPEtn Lipids Relative Quantitation of Human Polymorphonuclear Leukocyte Cell Membrane GPEtn Lipids Using the QTRAP System with mtraq Reagents Karin A. Zemski-Berry 1, John M. Hevko 2, and Robert C. Murphy 1 1 Department

More information

Application Note. Abstract. Authors. Pharmaceutical

Application Note. Abstract. Authors. Pharmaceutical Analysis of xycodone and Its Metabolites-oroxycodone, xymorphone, and oroxymorphone in Plasma by LC/MS with an Agilent ZRBAX StableBond SB-C18 LC Column Application ote Pharmaceutical Authors Linda L.

More information

Fast and simultaneous analysis of ethanol metabolites and barbiturates using the QTRAP 4500 LC-MS/MS system

Fast and simultaneous analysis of ethanol metabolites and barbiturates using the QTRAP 4500 LC-MS/MS system Fast and simultaneous analysis of ethanol metabolites and barbiturates using the QTRAP 4500 LC-MS/MS system Xiang He 1, Adrian Taylor 2 and Alexandre Wang 1 1 SCIEX, Redwood City, USA. 2 SCIEX, Concord,

More information

Analytical Method for 2, 4, 5-T (Targeted to Agricultural, Animal and Fishery Products)

Analytical Method for 2, 4, 5-T (Targeted to Agricultural, Animal and Fishery Products) Analytical Method for 2, 4, 5-T (Targeted to Agricultural, Animal and Fishery Products) The target compound to be determined is 2, 4, 5-T. 1. Instrument Liquid Chromatograph-tandem mass spectrometer (LC-MS/MS)

More information

Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2008

Supplementary Material (ESI) for Chemical Communications This journal is (c) The Royal Society of Chemistry 2008 Experimental Details Unless otherwise noted, all chemicals were purchased from Sigma-Aldrich Chemical Company and were used as received. 2-DOS and neamine were kindly provided by Dr. F. Huang. Paromamine

More information

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies

Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG

More information

LC/MS Method for Comprehensive Analysis of Plasma Lipids

LC/MS Method for Comprehensive Analysis of Plasma Lipids Application Note omics LC/MS Method for Comprehensive Analysis of Plasma s Authors Tomas Cajka and Oliver Fiehn West Coast Metabolomics Center, University of California Davis, 451 Health Sciences Drive,

More information

Title: Pharmacokinetics of daikenchuto, a traditional Japanese medicine (Kampo) after. single oral administration to healthy Japanese volunteers

Title: Pharmacokinetics of daikenchuto, a traditional Japanese medicine (Kampo) after. single oral administration to healthy Japanese volunteers Title: Pharmacokinetics of daikenchuto, a traditional Japanese medicine (Kampo) after single oral administration to healthy Japanese volunteers Authors: Masaya Munekage, Hiroyuki Kitagawa, Kengo Ichikawa,

More information

Simultaneous Quantitative Analysis of Total Catecholamines and Metanephrines in Urine Using 500 MG CLEAN UP CCX2 and LC-MS/MS

Simultaneous Quantitative Analysis of Total Catecholamines and Metanephrines in Urine Using 500 MG CLEAN UP CCX2 and LC-MS/MS Simultaneous Quantitative Analysis of Total Catecholamines and Metanephrines in Urine Using 500 MG CLEAN UP CCX2 and LC-MS/MS UCT Part Numbers: CUCCX256 - Clean-Up CCX2 (C8 + Carboxylic Acid) 500mg/6mL

More information

Detection of Low Level of Chloramphenicol in Milk and Honey with MIP SPE and LC-MS-MS

Detection of Low Level of Chloramphenicol in Milk and Honey with MIP SPE and LC-MS-MS Detection of Low Level of Chloramphenicol in Milk and Honey with MIP SPE and LC-MS-MS Olga Shimelis, An Trinh, and Michael Ye Supelco, Div. of Sigma-Aldrich, Bellefonte, PA T407125 Introduction Molecularly

More information

Quantitative Analysis of Drugs of Abuse in Urine using UHPLC Coupled to Accurate Mass AxION 2 TOF Mass Spectrometer

Quantitative Analysis of Drugs of Abuse in Urine using UHPLC Coupled to Accurate Mass AxION 2 TOF Mass Spectrometer application Note Liquid Chromatography/ Mass Spectrometry Authors Sharanya Reddy Blas Cerda PerkinElmer, Inc. Shelton, CT USA Quantitative Analysis of Drugs of Abuse in Urine using UHPLC Coupled to Accurate

More information

Simultaneous Quantitative Analysis of Total Catecholamines and Metanephrines in Urine Using CLEAN UP CCX2 and LC-MS/MS

Simultaneous Quantitative Analysis of Total Catecholamines and Metanephrines in Urine Using CLEAN UP CCX2 and LC-MS/MS Simultaneous Quantitative Analysis of Total Catecholamines and Metanephrines in Urine Using CLEAN UP CCX2 and LC-MS/MS UCT Part Numbers CUCCX256 Clean Up CCX2 (C8 + Carboxylic Acid) 500mg / 6mL SPE Cartridge

More information

LC/MS/MS Analysis of Metabolites of Synthetic Cannabinoids JWH-018 and JWH-073 in Urine

LC/MS/MS Analysis of Metabolites of Synthetic Cannabinoids JWH-018 and JWH-073 in Urine Abstract A liquid chromatographic method was developed to resolve a comprehensive set of metabolites of JWH-018 and JWH-073. In addition to the chromatographic analysis method, an extraction method was

More information

Profiling of Endogenous Metabolites Using Time-of-Flight LC/MS with Ion Pair Reverse Phase Chromatography

Profiling of Endogenous Metabolites Using Time-of-Flight LC/MS with Ion Pair Reverse Phase Chromatography Profiling of Endogenous Metabolites Using Time-of-Flight LC/MS with Ion Pair Reverse Phase Chromatography Application Note Metabolomics Author Yuqin Dai Agilent Technologies, Inc. 31 Stevens Creek Blvd,

More information

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.

Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus

More information

Analysis of anti-epileptic drugs in human serum using an Agilent Ultivo LC/TQ

Analysis of anti-epileptic drugs in human serum using an Agilent Ultivo LC/TQ Application Note Clinical Research Analysis of anti-epileptic drugs in human serum using an Agilent Ultivo LC/TQ Authors Jennifer Hitchcock 1, Lauren Frick 2, Peter Stone 1, and Vaughn Miller 2 1 Agilent

More information

UPLC/MS Monitoring of Water-Soluble Vitamin Bs in Cell Culture Media in Minutes

UPLC/MS Monitoring of Water-Soluble Vitamin Bs in Cell Culture Media in Minutes UPLC/MS Monitoring of Water-Soluble Vitamin Bs in Cell Culture Media in Minutes Catalin E. Doneanu, Weibin Chen, and Jeffrey R. Mazzeo Waters Corporation, Milford, MA, U.S. A P P L I C AT ION B E N E F

More information

SUPPLEMENTARY DATA. Materials and Methods

SUPPLEMENTARY DATA. Materials and Methods SUPPLEMENTARY DATA Materials and Methods HPLC-UV of phospholipid classes and HETE isomer determination. Fractionation of platelet lipid classes was undertaken on a Spherisorb S5W 150 x 4.6 mm column (Waters

More information

Measuring Phytosterols in Health Supplements by LC/MS. Marcus Miller and William Schnute Thermo Fisher Scientific, San Jose, CA, USA

Measuring Phytosterols in Health Supplements by LC/MS. Marcus Miller and William Schnute Thermo Fisher Scientific, San Jose, CA, USA Measuring Phytosterols in Health Supplements by LC/MS Marcus Miller and William Schnute Thermo Fisher Scientific, San Jose, CA, USA Overview Purpose: Develop a method for the extraction of phytosterols

More information

Simultaneous Analysis of Intact Human Insulin and Five Analogs in Human Plasma Using μelution SPE and a CORTECS UPLC Column

Simultaneous Analysis of Intact Human Insulin and Five Analogs in Human Plasma Using μelution SPE and a CORTECS UPLC Column Simultaneous Analysis of Intact Human Insulin and Five Analogs in Human Plasma Using μelution SPE and a CORTECS UPLC Column Erin E. Chambers and Kenneth J. Fountain Waters Corporation, Milford, MA, USA

More information

Determination of Tetracyclines in Chicken by Solid-Phase Extraction and High-Performance Liquid Chromatography

Determination of Tetracyclines in Chicken by Solid-Phase Extraction and High-Performance Liquid Chromatography Determination of Tetracyclines in Chicken by Solid-Phase Extraction and High-Performance Liquid Chromatography Application ote Food Safety Authors Chen-Hao Zhai and Yun Zou Agilent Technologies Co. Ltd.

More information

Extraction of Synthetic and Naturally Occurring Cannabinoids in Urine Using SPE and LC-MS/MS

Extraction of Synthetic and Naturally Occurring Cannabinoids in Urine Using SPE and LC-MS/MS Extraction of Synthetic and Naturally Occurring Cannabinoids in Urine Using SPE and LC-MS/MS UCT Part Numbers SSHLD063 Styre Screen HLD 60 mg, 6 ml column SPHPHO6001-5 Select ph Buffer Pouches 100 mm Phosphate

More information

Summary Chapter 8 CHAPTER 8. Summary. Page 173

Summary Chapter 8 CHAPTER 8. Summary. Page 173 CHAPTER 8 Summary Page 173 Chapter 2: Liquid Chromatography/Tandem Mass Spectrometry Method for Quantitative Estimation of PEG 400 and its Applications A rapid sensitive and selective MRM based method

More information

Practical application of UPLC MS/MS for targeted metabolite analysis

Practical application of UPLC MS/MS for targeted metabolite analysis 2013 Missouri Life Sciences Week Workshop Practical application of UPLC MS/MS for targeted metabolite analysis Abraham J.K. Koo Biochemistry www.biochem.missouri.edu What is Metabolomics? Metabolomics

More information

Application of LC/Electrospray Ion Trap Mass Spectrometry for Identification and Quantification of Pesticides in Complex Matrices

Application of LC/Electrospray Ion Trap Mass Spectrometry for Identification and Quantification of Pesticides in Complex Matrices Application ote #LCMS-2 esquire series Application of LC/Electrospray Ion Trap Mass Spectrometry for Identification and Quantification of Pesticides in Complex Matrices Introduction The simple monitoring

More information

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat

control kda ATGL ATGLi HSL 82 GAPDH * ** *** WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi WT/cTg WT/cTg ATGLi AKO/cTg AKO/cTg ATGLi iwat gwat ibat body weight (g) tissue weights (mg) ATGL protein expression (relative to GAPDH) HSL protein expression (relative to GAPDH) ### # # kda ATGL 55 HSL 82 GAPDH 37 2.5 2. 1.5 1..5 2. 1.5 1..5.. Supplementary

More information

Identification of Steroids in Water by Ion Trap LC/MS/MS Application

Identification of Steroids in Water by Ion Trap LC/MS/MS Application Identification of Steroids in Water by Ion Trap LC/MS/MS Application Environmental Author Paul Zavitsanos and Christine Miller Agilent Technologies, Inc. Centerville Road Wilmington, DE 9- USA Abstract

More information

application Natural Food Colorants Analysis of Natural Food Colorants by Electrospray and Atmospheric Pressure Chemical Ionization LC/MS

application Natural Food Colorants Analysis of Natural Food Colorants by Electrospray and Atmospheric Pressure Chemical Ionization LC/MS application LC/MS Natural Food Colorants Analysis of Natural Food Colorants by Electrospray and Atmospheric Pressure Chemical Ionization LC/MS Introduction Many kinds of natural colors are used in beverages,

More information

High Throughput Extraction of Opiates from Urine and Analysis by GC/MS or LC/MS/MS)

High Throughput Extraction of Opiates from Urine and Analysis by GC/MS or LC/MS/MS) High Throughput Extraction of Opiates from Urine and Analysis by GC/MS or LC/MS/MS) Michael Rummel, Matthew Trass, Michael Campognone, and Sky Countryman Phenomenex, Inc., 411 Madrid Avenue, Torrance,

More information

Detection of Cotinine and 3- hydroxycotine in Smokers Urine

Detection of Cotinine and 3- hydroxycotine in Smokers Urine Detection of Cotinine and 3- hydroxycotine in Smokers Urine Behavioural and Situational Research Group School of Medicine, University of Tasmania Version number: 2 Effective date: 01/12/2015 Review due:

More information

Analysis of Vitamins Using an SFC/UHPLC Hybrid System with a Triple Quadrupole LC/MS for Quantification

Analysis of Vitamins Using an SFC/UHPLC Hybrid System with a Triple Quadrupole LC/MS for Quantification Application ote Food Testing and Agriculture Analysis of Vitamins Using an SF/UPL ybrid System with a Triple Quadrupole L/MS for Quantification ounts 4.6.4...8.6.4....4.6.8...4.6.8 Acquisition time (min

More information

Determination of Bath Salts (Pyrovalerone Analogs) in Biological Samples

Determination of Bath Salts (Pyrovalerone Analogs) in Biological Samples Determination of Bath Salts (Pyrovalerone Analogs) in Biological Samples Application Note Forensic Toxicology Authors Joe Crifasi Saint Louis University Forensic Toxicology Laboratory Saint Louis, Mo.

More information

Mass Spectrometry. Actual Instrumentation

Mass Spectrometry. Actual Instrumentation Mass Spectrometry Actual Instrumentation August 2017 See also http://www.uni-bielefeld.de/chemie/analytik/ms f additional infmation 1. MALDI TOF MASS SPECTROMETRY ON THE ULTRAFLEX 2 2. ESI MASS SPECTROMETRY

More information

Surviving Matrix Effects Experiments. Grace van der Gugten St. Paul s Hospital, Vancouver, BC, Canada

Surviving Matrix Effects Experiments. Grace van der Gugten St. Paul s Hospital, Vancouver, BC, Canada Surviving Matrix Effects Experiments Grace van der Gugten St. Paul s Hospital, Vancouver, BC, Canada gvandergugten@providencehealth.bc.ca Outline What are matrix effects Post Column Infusion Phospholipid

More information

New Solvent Grade Targeted for Trace Analysis by UHPLC-MS

New Solvent Grade Targeted for Trace Analysis by UHPLC-MS New Solvent Grade Targeted for Trace Analysis by UHPLC-MS Subhra Bhattacharya, Deva H. Puranam, and Stephen C. Roemer Thermo Fisher Scientific Fisher Chemical, One Reagent Lane, Fair Lawn, NJ Material

More information

Supplementary Information

Supplementary Information Supplementary Information Molecular imaging of brain localization of liposomes in mice using MALDI mass spectrometry Annabelle Fülöp 1,2, Denis A. Sammour 1,2, Katrin Erich 1,2, Johanna von Gerichten 4,

More information

Determination of Gamma-Hydroxy-Butyrate (GHB) in Biological Samples

Determination of Gamma-Hydroxy-Butyrate (GHB) in Biological Samples Determination of Gamma-Hydroxy-Butyrate (GHB) in Biological Samples Application Note Forensic Toxicology Authors Joe Crifasi Saint Louis University Forensic Toxicology Laboratory Saint Louis, MO, USA Ron

More information

4.5 Minute Analysis of Benzodiazepines in Urine and Whole Blood Using LC/MS/MS and an Ultra Biphenyl Column

4.5 Minute Analysis of Benzodiazepines in Urine and Whole Blood Using LC/MS/MS and an Ultra Biphenyl Column Clinical, Forensic & Toxicology Applications 4.5 Minute Analysis of Benzodiazepines in Urine and Whole Blood Using LC/MS/MS and an Ultra Biphenyl Column By Amanda Rigdon Abstract A rapid, sensitive method

More information

Application Note LCMS-108 Quantitation of benzodiazepines and Z-drugs in serum with the EVOQ TM LC triple quadrupole mass spectrometer

Application Note LCMS-108 Quantitation of benzodiazepines and Z-drugs in serum with the EVOQ TM LC triple quadrupole mass spectrometer Application Note LCMS-108 Quantitation of benzodiazepines and Z-drugs in serum with the EVOQ TM LC triple quadrupole mass spectrometer Abstract This study demonstrates a sensitive, rapid and reliable research

More information

PosterREPRINT SIMULTANEOUS QUANTIFICATION OF PSYCHOTHERAPEUTIC DRUGS IN HUMAN PLASMA BY TANDEM MASS SPECTROMETRY

PosterREPRINT SIMULTANEOUS QUANTIFICATION OF PSYCHOTHERAPEUTIC DRUGS IN HUMAN PLASMA BY TANDEM MASS SPECTROMETRY OVERVIEW A simple and rapid LC-MS/MS method has been developed which allows the simultaneous quantification of a panel of commonly prescribed psychotherapeutic drugs in human plasma and whole blood. INTRODUCTION

More information

LC-MS/MS Method for the Determination of 21 Opiates and Opiate Derivatives in Urine

LC-MS/MS Method for the Determination of 21 Opiates and Opiate Derivatives in Urine LC-MS/MS Method for the Determination of 21 Opiates and Opiate Derivatives in Urine J. Jones, S. Westwood, T. Liddicoat, L. Pereira, T. Edge Thermo Fisher Scientific, Manor Park, Runcorn, UK Overview Purpose:

More information

Comparison of Biotage Extrahera vs. Manual Sample Processing Using a Vacuum Manifold

Comparison of Biotage Extrahera vs. Manual Sample Processing Using a Vacuum Manifold Technical Note PPS366 Extraction of 25-OH Vitamin D from Plasma Using ISOLUTE SLE+ Page 1 Comparison of Biotage vs. Sample Processing Using a Vacuum Manifold Extraction of 25-OH Vitamin D from Plasma Using

More information

Neosolaniol. [Methods listed in the Feed Analysis Standards]

Neosolaniol. [Methods listed in the Feed Analysis Standards] Neosolaniol [Methods listed in the Feed Analysis Standards] 1 Simultaneous analysis of mycotoxins by liquid chromatography/ tandem mass spectrometry [Feed Analysis Standards, Chapter 5, Section 1 9.1 ]

More information