GCD3033:Cell Biology. Plasma Membrane Dynamics

Transcription

1 Plasma Membrane Dynamics

2 Membrane Structure I) Lipid Bilayer A) Membrane Lipids B) Membrane Flexibility & Composition C) Phospholipids II) Membrane Proteins A) association with membranes B) membrane solubilization C) membrane protein structure D) cell cortex E) carbohydrate cell surface coating III) ITK - sequence analysis II

3 I) Lipid Bilayer Cell membranes act as selective barriers.

4 I) Lipid Bilayer The plasma membrane is involved in cell communication, import and export of molecules, and cell growth and motility.

5 I) Lipid Bilayer A cell membrane can be viewed in a number of ways.

6 I) Lipid Bilayer Hydrophilic Molecules: A hydrophilic molecule attracts water molecules.

7 I) Lipid Bilayer Hydrophobic Molecules: A hydrophobic molecule tends to avoid water.

8 I) Lipid Bilayer Phosphatidylcholine is the most common phospholipid in cell membranes.

9 I) Lipid Bilayer Different types of membrane lipids are all amphipathic (hydrophilic and hydrophobic parts). Fat molecules are hydrophobic, unlike phospholipids.

10 I) Lipid Bilayer Amphipathic phospholipids form a bilayer in water.

11 I) Lipid Bilayer Phospholipid bilayers spontaneously close in on themselves to form sealed compartments.

12 I) Lipid Bilayer If margarine made of vegetable oil, why is it solid? Soft Margarine Hard Margarine Vegetable Oil

13 I) Lipid Bilayer Fats Saturated Monounsaturated Polyunsaturated Canola Oil 6% 62% 32% Soft Margarine 20% 47% 33% Hard Margarine 80% 14% 6% Butter 66% 30% 4% O OH O OH O OH O OH

14 I) Lipid Bilayer Membrane phospholipids are motile.

15 I) Lipid Bilayer Cholesterol tends to stiffen cell membranes

16 I) Lipid Bilayer Cholesterol tends to stiffen cell membranes

17 I) Lipid Bilayer Membrane Topology: Membranes retain their orientation during transfer between cell compartments.

18 I) Lipid Bilayer Lipid Production: Newly synthesized phospholipids are added to the cytosolic side of the ER membrane and then transferred to the other half of the bilayer by enzymes.

19 I) Lipid Bilayer Lipid Bilayer Asymmetry: phospholipids and glycolipids are distributed asymmetrically in the lipid bilayer of a eukaryotic plasma membrane.

20 II) Membrane Proteins Integral membrane proteins: plasma membrane proteins have a variety of functions.

21 II) Membrane Proteins Membrane proteins can associate with the lipid bilayer in different ways.

22 II) Membrane Proteins The backbone of a polypeptide chain is hydrophilic. A transmembrane polypeptide chain usually crosses the lipid bilayer as an α helix.

23 II) Membrane Proteins Integral membrane proteins can form channels A transmembrane hydrophilic pore can be formed by multiple amphipathic α helices. Bacterial porin proteins form water-filled channels in the outer membrane.

24 I) Lipid Bilayer What chemical does dish soap and toothpaste have in common?

25 II) Membrane Proteins Membrane Protein Solubilization: SDS and Triton X-100 are two commonly used detergents.

26 II) Membrane Proteins Membrane Proteins & Cell Shape: Human red blood cells have a characteristic flattened biconcave shape, as seen in this scanning electron micrograph.

27 II) Membrane Proteins Membrane Proteins & Cell Shape: A spectrin meshwork forms the cell cortex in human red blood cells.

28 II) Membrane Proteins Fluid Mosaic Model of the Membrane: Formation of mouse-human hybrid cells shows that some plasma membrane proteins can move laterally in the lipid bilayer.

29 II) Membrane Proteins Protein Partitioning: The lateral mobility of plasma membrane proteins can be restricted in several ways.

30 II) Membrane Proteins Protein Partitioning: Membrane proteins are restricted to particular domains of the plasma membrane of epithelial cells in the gut.

31 II) Membrane Proteins Protein Modification by Carbohydrates (sugars): Eukaryotic cells are coated with sugars.

32 II) Membrane Proteins Carbohydrate Recognition: The recognition of the cell-surface carbohydrate on neutrophils is the first stage of their migration out of the blood at sites of infection.

33 The Inner Life of The Cell (Harvard University)

34 ITK: Sequence Analysis II Objectives Use only sequence (nucleotide or amino acid) to determine factor identify Determine the molecular weight the encoding protein Exercise A human nucleotide and amino acid sequence of an unidentified gene will be provided. The online BLAST tool will be used to determine the identity of the gene or protein.

35 ITK: Sequence Analysis II Task 1) Determine the identity of the following nucleotide sequence using the nucleotide BLAST (BLASTn) tool. A) nucleotide sequence: gagccacaaagatgatagcccagacctccctaaattgaaaccagaccccaatactttgtgtgatgagtttaaggcag atgaaaagaagttttggggaaaatacctatacgaaattgctagaagacatccctacttttatgcaccagaactccttta ctatgctaataaatataatggagtttttcaagaatgctgccaagctgaagataaaggtgcctgcctgctaccaaagatt gaaactatgagagaaaaagtactgacttcatctgccagacagagactcaggtgtg QUESTION: What is the identity of the corresponding gene that contains the nucleotide sequence above? B) Once a result is obtained, click the Sequence ID link corresponding to the gene with the lowest E value. The E value is the probability that a match is random. The example above results in an E value of 1X10-148, an exceedingly small number indicating that the match is not random. C) Scroll part way down the page and copy the translation of the encoded protein.

36 ITK: Sequence Analysis II Task 2) Determine the molecular weight of the full-length protein identified above. To do so, one can use the ExPASy molecular weight prediction tool Compute pi/mw. A) Copy the translated amino acid sequence from above and paste it into the open box of the Compute pi/mw page. Select Average for the Resolution setting. The program will generate the molecular weight (Mw) of the protein in Daltons (Da). QUESTION: What is the molecular weight of the encoded protein?

37 ITK: Sequence Analysis II Task 3) Determine the identify fo the following amino acid sequence using a protein BLAST (BLASTp). A) amino acid sequence: RHVRFDGTDYGSLLSQQMGM QUESTION: What is the identity of the corresponding gene that contains the amino acid sequence above? B) Once a result is obtained, click the Sequence ID link corresponding to the gene with the lowest E value. C) Scroll down to the bottom of the page and copy the the entire amino acid sequence. Note that the only sequence information provided is amino acid sequence without nucleotide sequence. This results when one performs an amino acid BLAST.

38 ITK: Sequence Analysis II Task 4) Determine the molecular weight of the full-length protein identified above using Compute pi/mw. QUESTION: What is the molecular weight of the encoded protein?