Zhengquan Gao, Chunxiao Meng, Yi Chung Chen, Faruq Ahmed, Arnold Mangott, Peer M Schenk & Yan Li

Transcription

1 Comparison of astaxanthin accumulation and biosynthesis gene expression of three Haematococcus pluvialis strains upon salinity stress Zhengquan Gao, Chunxiao Meng, Yi Chung Chen, Faruq Ahmed, Arnold Mangott, Peer M Schenk & Yan Li Journal of Applied Phycology ISSN DOI 1.17/s

2 Your article is protected by copyright and all rights are held exclusively by Springer Science +Business Media Dordrecht. This e-offprint is for personal use only and shall not be selfarchived in electronic repositories. If you wish to self-archive your article, please use the accepted manuscript version for posting on your own website. You may further deposit the accepted manuscript version in any repository, provided it is only made publicly available 12 months after official publication or later and provided acknowledgement is given to the original source of publication and a link is inserted to the published article on Springer's website. The link must be accompanied by the following text: "The final publication is available at link.springer.com. 1 23

3 DOI 1.17/s TH CONGRESS OF THE INTERNATIONAL SOCIETY FOR APPLIED PHYCOLOGY Comparison of astaxanthin accumulation and biosynthesis gene expression of three Haematococcus pluvialis strains upon salinity stress Zhengquan Gao & Chunxiao Meng & Yi Chung Chen & Faruq Ahmed & Arnold Mangott & Peer M Schenk & Yan Li Received: 2 July 214 /Revised: 1 December 214 /Accepted: 2 December 214 # Springer Science+Business Media Dordrecht 214 Abstract The green alga Haematococcus pluvialis is able to produce and accumulate large amounts of astaxanthin under stress conditions, but not every strain has such a capability. At present, there is little information on how strains differ for astaxanthin production. In this study, three Australian strains of H. pluvialis (New South Wales (NSW), South Australia (SA) and Queensland (QLD)) were cultured and exposed to.17 M NaCl for 1 days, to compare their molecular profiles for astaxanthin accumulation and carotenogenesis. After 1 days of salinity stress, the astaxanthin contents of strains NSW, SA and QLD increased up to 16.2, 5.6 and 17.7 mg g 1 dry weight (DW), respectively. Astaxanthin accumulation was more efficient in H. pluvialis QLD, followed by strain NSW and then SA. The transcript abundance of seven carotenogenesis genes (ipi-1, ipi-2, psy, lyc, crtr-b, bkt2 and crto) was upregulated with different patterns and incremental expression levels amongst the three strains. The early upregulation of the rate-limiting genes, psy, lyc, bkt2, crtr-b and crto, was more pronounced in the superior astaxanthinaccumulating QLD and NSW strains. Although the increased transcript level of carotenoid genes was not correlated to the Zhengquan Gao and Chunxiao Meng contributed equally to this work Z. Gao: C. Meng : Y. C. Chen : F. Ahmed : P. M. Schenk (*) : Y. Li (*) School of Agriculture and Food Sciences, The University of Queensland, Brisbane, Queensland 472, Australia p.schenk@uq.edu.au yan.li3@jcu.edu.au Z. Gao: C. Meng School of Life Sciences, Shandong University of Technology, Zibo 25549, People s RepublicofChina A. Mangott: Y. Li College of Marine and Environmental Sciences, James Cook University, Townsville 4811, Queensland, Australia different astaxanthin accumulation between the three strains, expression patterns of these genes likely are strain-specific. Overall, H. pluvialis strains QLD and NSW showed good potential to produce high astaxanthin contents, and the former strain displayed a higher productivity upon salinity stress. Keywords Astaxanthin content. Gene expression. NaCl stress. Haematococcus pluvialis. Chlorophyceae Introduction Astaxanthin (3,3 -dihydroxy-β,β-carotene-4,4 -dione) is a high-value keto-carotenoid and has been widely used as a potent antioxidant for human health and also a colouring agent in aquaculture (Borowitzka 1992; Han et al. 213). In nature, the astaxanthin pigment is synthesised by several species of microalgae, plants, bacteria and fungi (Gao et al. 212). The green microalga Haematococcus pluvialis can produce up to 5 % astaxanthin on a per dry weight (DW) basis, which is much higher than any other astaxanthin-producing organisms (Boussiba 2). H. pluvialis has been a research focus for decades; nevertheless, little information has been reported on Australian strains. H. pluvialis has a complex life history, consisting of four distinct morphologically different life stages (micro and macrospores, palmella and aplanospores). The change is dependent on environmental conditions and can also be regulated vice versa (Borowitzka et al. 1991; Boussiba 2). Unfavourable conditions such as high light, high temperatures and/or low nutrient availability can promote red cyst formation and astaxanthin synthesis (Borowitzka et al. 1991; Borowitzka 1992; Kobayashi et al. 1997). This process follows the general carotenoid pathway where astaxanthin is converted from β-carotene and accumulated in cytosolic lipid

4 bodies inside the algal cells, showing red colour (Jin et al. 26; Han et al. 213). Therefore, those red aplanospores normally contain the highest astaxanthin content even that their rigid cell wall is not conducive to the extraction of pigments (Vidhyavathi et al. 28). Regardless of the morphological transformation of the cells, the biosynthetic process of carotenoids is also accompanied by several enzymes which are encoded by carotenogenic genes in H. pluvialis (Fig. 1)(Huang et al.26;vidhyavathi et al. 28, 29). Previous research elucidated the pathway of astaxanthin biosynthesis in H. pluvialis with specific inhibitors, and most of the involved genes have been cloned (Grünewald et al. 2). For example, two genes encoding isopentenyl pyrophosphate isomerase, ipi1 and ipi2, are upregulated at the translational level in H. pluvialis to facilitate synthesis of pyrophosphate from isopentenyl (Jin et al. 26; Sun et al. 1998). Phytoene synthase (psy) catalyses the first committed step in carotenoid biosynthesis to form phytoene which is the precursor molecule for all other carotenoids (Jin et al. 26). Two structurally and functionally similar enzymes, phytoene desaturase (pds) and carotene desaturase (zds), assist with the conversion of the colourless phytoene to red lycopene, but their isomerase mechanism is not well understood in H. pluvialis (Jin et al. 26). Cyclisation of lycopene to β-carotene involves lycopene β-cyclase (lyc) which is crucial for carotenogenesis in H. pluvialis upon environmental stress (Jin et al. 26). In the conversion of β-carotene to astaxanthin, enzymes β-carotene ketolase (bkt2) (Gao et al. 212), β-carotene oxygenase (crto) (synonym: β- carotene ketolase, bkt1)andβ-carotene hydroxylase (or crtr- B) carry out the necessary oxygenation reactions (Lotan and Hirschberg 1995; Vidhyavathi et al. 28). Especially in response to environmental stress conditions, the regulation of these genes in H. pluvialis can be detected at the messenger RNA level (Jin et al. 26). For example, expression of psy and crtr-b genes increases to a high level when H. pluvialis cells are exposed to high light and NaCl, resulting in more astaxanthin accumulation in the cells (Steinbrenner and Linden 21). Since differential expression of carotenoid genes during carotenogenesis indicates their regulation at different stages of carotenoid accumulation (Vidhyavathi et al. 28), studying these genes at a molecular level is a beneficial approach for understanding the different capacity of astaxanthin production between H. pluvialis strains. Given little information on Australian strains of H. pluvialis, it was important to carry out a comparative study between different strains with an attempt to select an optimal strain for a high yield of astaxanthin production. It is well known that astaxanthin production in H. pluvialis can be accelerated under stress conditions (Kamath et al. 28). As salinity stress can effectively induce astaxanthin accumulation in H. pluvialis (Sarada et al. 22a; Steinbrenner and Linden 21), three Australian H. pluvialis strains (New South Wales (NSW), South Australia (SA) and Queensland (QLD)) were cultured and exposed to.17 M sodium chloride (NaCl) in this study. Coupled with measurement of astaxanthin content in algal cells, the transcriptional expression of seven carotenogenic genes (ipi-1, ipi-2, psy, lyc, crtr-b, bkt2 and crto) was profiled to reveal differences in astaxanthin biosynthesis between the three strains. Materials and methods Fig. 1 Astaxanthin biosynthesis pathway in H. pluvialis (modified from Grünewald et al. 2). Enzyme designations: CRTL-B, lycopene β- cyclase; CRTO, β-carotene oxygenase; CRTR-B, β-ring hydroxylase; GGPS, geranylgeranyl diphosphate synthase; IPI, isopentenyl diphosphate isomerase; PDS, phytoene desaturase; PSY, phytoene synthase; ZDS, ζ-carotene desaturase Three strains of H. pluvialis isolated from SA, NSW and QLD were used for this study. Pure cultures were incubated in Bold s Basal Medium (BBM) (Ebrahimian and Kariminia 214) under5μmol photons m 2 s 1 fluorescent light with a diurnal cycle of 12/12 h light/dark at 22±1 C. The cultures were bubbled continuously with filtered air (.22 μm). When reaching the exponential growth phase (approximately at cells ml 1 ), the cultures were centrifuged at 35 g for 5 min and resuspended in fresh BBM medium containing.17 M NaCl (Vidhyavathi et al. 28). The initial cell concentration was adjusted to cells ml 1, and then cultured at the same condition as above for 1 days. Cells

5 (7 ml per sample) were collected on days, 1, 2, 3, 5, 7 and 1. In each sample, half of the volume was used for astaxanthin measurement and the other half was used for RNA extraction. All samples were centrifuged and then stored at 8 C prior to the analyses. Microscopy observation of microalgal morphology On each sampling day, the samples in each culture were observed on an Olympus BX61 microscope and an Olympus DP1 digital camera, aiming for tracking the progress of cell morphology and colour changes of H. pluvialis in the treatments. Astaxanthin quantification For carotenoid extraction, the samples were freeze-dried for 24 h. The carotenoid extraction was based on the method of Fanning et al. (21). The concentrated carotenoid extract was dissolved in 2.5 ml of methanol/dichloromethane (5/5, v/v) for HPLC analysis. The gradient of mobile phases in HPLC analysis was set as follows: min, 8 % phase A and 2 % phase B; 48 min, 2 % Aand8%B;49min,8%Aand2%B;54min,2%A and 8 % B (phase A 92 % methanol/8 % 1 mm ammonium acetate; phase B 1 % methyl tert-butyl ether). A MS scan was undertaken between 53 and 61 mass units in the APCI+ mode (Fu et al. 212) using an Acquity UPLC H- Class system connected to a Quattro Premier triple quad (Micromass MS Technologies, Waters Corporation, USA). Source temperature and probe temperature were 15 and 6 C, respectively, while desolvation and cone gas flow were at 45 and 5 L h 1. The corona, cone and extractor voltages were 5. μa, 3 V and 3 V, respectively. The carotenoids were identified by their specific retention times, UV/ Vis spectra and mass spectra against authentic standards (Lu et al. 29). The concentrations of the identified carotenoids were determined using individual calibration curves. RNA isolation and real-time quantitative reverse transcriptase PCR Total RNAwas extracted using an SV RNA isolation kit (Promega, USA) according to the manufacturer s instructions. The RNA concentration was determined using a NanoDrop@ ND-1 (NanoDrop, USA). First-strand complementary DNA (cdna) was synthesised from total RNA in a 2-μL final volume, using SuperScript III First-Strand Synthesis Kit (Invitrogen, USA). As described in one of our previous studies (Gao et al. 212), the gene-specific primers for astaxanthin-related genes (ipi-1, ipi-2, psy, lyc, crtr-b, bkt2 and crto) (Table 1) were synthesised by Integrated DNA Technologies (Australia) based on gene sequences from NCBI databases (U759.1, JQ , AF , GQ , KC , KC , KC , KC ). 18S ribosomal RNA gene expression was used as the internal control for normalisation. All real-time quantitative reverse transcriptase PCR (qrt-pcr) products were loaded on 384-well plates by an epmotion automated pipetting robot (Eppendorf epmotion 575, Eppendorf). They were quantified on an ABI-79HT System (Applied Biosystems, USA) using SYBR green fluorescence (Applied Biosystems). Each PCR reaction consisted of 5 μl SYBRgreen,1μL of primer mixture (forward and reverse, 3 μm each) and 4 μl of Table 1 Gene-specific primers and annealing temperatures used for qrt-pcr (Gao et al. 212) Primer Primer sequence (5-3 ) Annealing temperature ( C) GenBank ID psyf CGATACCAGACCTTCGACG 55 AF3543 psyr TGCCTTATAGACCACATCCAT X86783 pdsf ACCACGTCGAAGGAATATCG 58 AY1828 pdsr TCTGTCGGGAACAGCCG AF lycf TGGAGCTGCTGCTGTCCCT 61 AY63347 lycr GAAGAAGAGCGTGATGCCGA AF82325 crtr-bf ACACCTCGCACTGGACCCT 62 AF82326 crtr-br GTATAGCGTGATGCCCAGCC X86782 bkt2f CAATCTTGTCAGCATTCCGC 61 U759.1 bkt2r CAGGAAGCTCATCACATCAGA JQ , ipi-1f GCGAGCACGAAATGGACTAC 61 AF ipi-1r GCTGCATCATCTGCCGCA GQ K ipi-2f AGTACCTGGCGCAAAAGCTG 62 C KC1 ipi-2r GTTGGCCCGGATGAATAAGA KC986 crtof ACGTACATGCCCCACAAG KC19672 crtor CAGGTCGAAGTGGTAGCAGGT sF CAAAGCAAGCCTACGCTCT 6 18s R ATACGAATGCCCCCGACT

6 Fig. 2 Microscopic images of SA, NSW and QLD strains of H. pluvialis cells under stress of.17 M NaCl. The rows (from up to down) indicate the photos taken on day 3, 7 and 1; the columns (left to right) represent strains of SA, NSW and QLD. Arrow 1 and arrow 2 represent the dead cells and cell debris released from disintegrated algae cells, respectively. Bars=2 μm cdna (2 μg μl 1 ). The thermal cycles were set as follows: stage 1 95 C for 1 min; stage 2 45 cycles of 95 C for 15 s and 6 C for 1 min; stage 3 1 cycle of 95 C for 2 min, 6 C for 15 s and 95 C for 15 s. Across the three strains, all qrt-pcr assays for a particular gene were conducted in duplicates for the same sample. In order to show increased level of gene transcripts, the results of seven genes after day 1 were shown as fold increase over the initial levels on day. Experimental design The experiment was carried out with replications from three separately grown cultures. All values shown in the figures are expressed as mean SD. Student s t test was used to determine significant differences. Results and discussion Australian H. pluvialis strains displayed salinity tolerance Three Australian H. pluvialis cultures were exposed to salinity stress including.17 M (=1 %) NaCl. All cultures still showed some growth under these conditions, although at a much reduced rate. Based on the mean DW, the three strains, NSW, SA and QLD, grew 1.36, 1.84 and 1.99-fold over 1 days. This is in contrast to other Haematococcus strains that showed cell mortality and no growth in the presence of.6.8 % of NaCl (Harker et al. 1996; Sarada et al. 22a). Such a discrepancy was also found in a strain of H. pluvialis. For example, a German strain of H. pluvialis showed that.6 % of NaCl was recommended as optimum condition for achieving high astaxanthin content (>14 mg g 1 DW) (Sarada et al. 22b), but >1 % of NaCl was lethal to the culture (Sarada et al. 22a). However, a later study on a likely same strain indicated a decline in the total astaxanthin content from 15.7 to 6.8 mg g 1 DW upon exposure to.1 % NaCl in 9 days (Vidhyavathi et al. 28). It is conceived that the different response of the algae to the salinity stress is associated with experimental conditions and/or physiological state of the culture to a large extent. However, Gao et al. (212) have highlighted that H. pluvialis strains may have very different adaptabilities to salinity conditions. Bearing this in mind, the three Australian strains in this study all showed a similar response when exposed to.17 M NaCl. Cell morphological change The cell colour and morphology gradually changed during the trails (Fig. 2). Upon salinity

7 stress, it was found that the strains QLD, NSW and SA started to show some reddish colour from days 1, 1 and 2, respectively. Most of the cells became non-motile in about 2 days. On day 3, there were some visible differences observed between the three strains on cell size and colour appearance. On day 7, more red cells were obtained in the QLD strain, followed by NSW and SA strains. But the QLD strain contained relatively more dead cells and cell debris in the cultures. On day 1, more than 7 % of SA strain cells turned into red cysts, whereas about 95 % and almost 1 % of cells of NSW and QLD strains became red cysts. Meanwhile, all the cultures showed dead cells and disintegrated cells. Astaxanthin accumulation pattern and productivity varied strongly between strains On day, the biochemical profiling detected that the green vegetative cells of strains NSW, SA and QLD contained 1.45,.86 and 3.53 mg g 1 DW of astaxanthin (Fig. 3). On day 1, NSW and QLD displayed the highest content of astaxanthin with 16.2 and 17.7 mg g 1 DW, respectively, whereas SA contained 5.6 mg g 1 DW (Fig. 3). This coincided with the colour appearance between these cultures which showed a less reddish colour in strain SA. As there were still many motile vegetative cells observed under the microscope after 1 days of salinity stress, the astaxanthin content in each strain may increase further after a prolonged stress period. The astaxanthin accumulation was variable between strains. Strain QLD showed an early and steep onset of astaxanthin accumulation in response to salinity stress, increasing from 4.28 to 1.46 mg g 1 DW on day 2. Strain NSW showed a delayed accumulation of astaxanthin with a drastic increase after day 7, but reached the same level as strain QLD on day 1. Both QLD and NSW produced three times more astaxanthin than strain SA, with QLD being capable of producing the pigment faster than strain NSW. Astaxanthin content (mg g -1, DW) NSW SA QLD Day Fig. 3 Total astaxanthin contents in three H. pluvialis strains, NSW, SA and QLD, following salinity stress by.17 M NaCl (error bars show the SD, n=3) Although the total astaxanthin content after 1 days was lowest in strain SA, it started out much lower too. The actual astaxanthin gain over the experimental period was 64.9-fold, over 5- and 1-fold higher than strains NSW and QLD, respectively. Transcript expression of carotenoids biosynthetic genes Studying the relationship between the regulation of carotenogenic genes and astaxanthin accumulation can increase our understanding of the underlying astaxanthin biosynthesis mechanism in Haematococcus (Huang et al. 26). In our study, the transcript levels of seven carotenogenesis genes of the Australian strains were significantly upregulated along with astaxanthin accumulation (Fig. 4). These findings are consistent with previous reports by Vidhyavathi et al. (28) and Li et al. (21). The transcript pattern and induction ratios of the seven genes, however, were different between the three H. pluvialis strains over the 1 days (Fig. 4). Overall, the tested carotenogenesis genes were upregulated earlier in the QLD and NSW strains than in the SA strain. For example, the gene encoding phytoene synthase (psy) was upregulated early in strains QLD and NSW (1.7-fold on day 1 and 1.5-fold on day 2), where in strain SA the induction was delayed. It is conceived that both QLD and NSW likely can produce faster a significant amount of phytoene precursor molecules for carotenoid biosynthesis than strain SA, resulting in increased astaxanthin accumulation. A similar result was also observed for the gene encoding lycopene β- cyclase (lyc) for which both QLD and NSW strains displayed earlier upregulation than strain SA. As a result, synthesising β-carotene can be more pronounced in these two strains. As astaxanthin biosynthesis from β-carotene lies mainly under the control of bkt2, crtr-b and crto transcripts (Han et al. 213; Li et al. 21), the early upregulation of these three genesinstrainsqldandnswinresponsetosalinity(fig.4) was also concomitant to the higher astaxanthin production (Fig. 3). Especially, strain QLD outperformed the other strain. Similar to previous reports (Han et al. 213; Jin et al. 26;Li et al. 28, 21; Steinbrennerand Linden 21), these results provide further evidence that early transcriptional upregulation of psy, lyc, bkt2, crtr-b and crto provide rate-limiting steps for astaxanthin biosynthesis in H. pluvialis. Further differences between the examined Australian strains were also demonstrated by different induction ratios of these genes over 1 days. In both H. pluvialis QLD and SA, the highest transcript level increases of these genes were obtained on day 1, while in strain NSW, not all genes showed this uniform pattern. The highest upregulation of lyc was on day 7 (11.2-fold) and of crto was on day 5 (221.7-fold). Although H. pluvialis SA showed higher induction ratios of ipi-1 and psy, strain QLD showed stronger induction for ipi-2, lyc, bkt, crtr-b and crto. Apart from lyc, other

8 Fig. 4 Induction ratios of carotenoid biosynthetic genes (ipi-1, ipi-2, psy, lyc, crtr-b, bkt2 and crto) in H. pluvialis strains NSW, SA and QLD following salinity stress by.17 M NaCl (error bars show the SD, n=3) Increased expression (fold) ipi-1 NSW SA QLD ipi-2 Increased expression (fold) psy 14 lyc Increased expression (fold) bkt crtr-b Increased expression (fold) crto Day Day carotenogenesis genes in strain NSW were relatively less upregulated compared to strains SA and QLD. However, these different induction ratios did not match the performance of astaxanthin accumulation amongst the three strains. Further investigation (ideally on protein level) would be required to correlate astaxanthin biosynthesis with certain steps of the pathway. For example, it is unclear whether the higher induction ratios of ipi-1 andpsy in H. pluvialis SA are linked to its higher astaxanthin increase (64.9-fold) or whether the maximum induction of lyc and crto in strain NSW on days 5 and 7 was correlated to its fast astaxanthin accumulation after day 7. Similarly, the rapid and early accumulation of astaxanthin in strain QLD between days 2 and 3 did not correspond well to the induction of carotenogenesis genes; the highest induction of these genes was obtained on day 1. In comparison, it seems that the pace of astaxanthin accumulation in the three Australian H. pluvialis strains is more relevant to the early upregulation of the rate-limiting carotenogenesis genes. With regards to the carotenoid gene expression profiles amongst the tested Australian strains, the results showed the following: (1) the commencement of induction of each gene was different between each of the Australian strains, as was also observed for other comparative studies conducted between different strains (e.g. Vidhyavathi et al. 28; Li et al.

9 21); (2) the increment of transcript levels of each gene was different amongst Australian strains. Such a difference was also reported in the comparison between wild-type and an astaxanthin-enhanced mutant of H. pluvialis under the same cultivation conditions (Li et al. 28; 21). But the overexpression of these genes was not well correlated to the astaxanthin production in the three strains assessed. As highlighted subsequently by Borowitzka (1992) and Li et al. (21), the regulation and expression of carotenogenesis genes leading to astaxanthin formation is still not well understood in H. pluvialis. Although NaCl addition favours upregulation of carotenogenic genes, the same genes behaved differently amongst strains. For example, the expression of crtr- B was delayed in a German strain when astaxanthin was increased upon NaCl stress (Vidhyavathi et al. 28). In contrast, a high level of crtr-b transcript was initially present in a Japanese strain of H. pluvialis (NIES-144) after NaCl stress along with astaxanthin accumulation (Steinbrenner and Linden 21). This different gene regulation may be relevant to the different cultivation modes (heterotrophic vs. autotrophic) and stress induction (nutrient sufficient vs. deficient) between studies. Most likely, carotenogenesis is tightly regulated at a posttranslational level and is highly strain-specific. Further enzymatic studies coupled to metabolic profiling of the intermediate compounds would be required to further elucidate regulation of the carotenogenesis pathway in H. pluvialis. Conclusion Three Australian strains of H. pluvialis showed different astaxanthin accumulation patterns upon NaCl stress, and these three strains also demonstrated widely varying expression profiles of seven carotenogenesis genes. Although it is still unclear whether the induction of certain carotenogenesis genes is relevant to the astaxanthin production in H. pluvialis, early upregulation of rate-limiting carotenoid genes likely plays an important role in facilitating astaxanthin accumulation. In comparison, H. pluvialis strains QLD and NSW were optimal for producing astaxanthin under salinity stress and the QLD strain displayed a higher productivity for astaxanthin accumulation. With concerns of abundant light radiation and warm temperature in Australia, however, a further comprehensive study on photo flux and temperature stress is required to continue investigating the differences between H. pluvialis strains NSW, SA and QLD. Acknowledgments Dr. Zhengquan Gao and Dr. Chunxiao Meng were visiting scholars at The University of Queensland supported by the National Natural Science Foundation of China ( , ), the National Natural Science Foundation of Shandong Province (ZR211DM6, ZR211CQ1), the open funds of State Key Laboratory of Agricultural Microbiology (AMLKF213) and the supporting project for young teachers in Shandong University of Technology. The authors are grateful to the James Cook University/MBD Microalgae Research & Development Facility for providing the experimental microalgae strains. This work was financially supported by the James Cook University Miscellaneous Research Fund (273) and Advanced Manufacturing Cooperative Research Centre (AMCRC) grant (no ). References Boussiba S (2) Carotenogenesis in the green alga Haematococcus pluvialis: cellular physiology and stress response. Physiol Plant 18: Borowitzka MA, Huisman JM, Osborn A (1991) Culture of the astaxanthin-producing green alga Haematococcus pluvialis 1. Effects of nutrients on growth and cell type. 3: Borowitzka MA (1992) Comparing carotenogenesis in Dunaliella and Haematococcus: implications for commercial production strategies. In: Villa TG, Abalde J (eds) Profiles on biotechnology. Universidade de Santiago de Compostela, Santiago de Compostela, pp Ebrahimian A, Kariminia H-R, Vosoughi M (214) Lipid production in mixotrophic cultivation of Chlorella vulgaris in a mixture of primary and secondary municipal wastewater. Renew Energ 71:52 58 Fanning KJ, Martin I, Wong L, Keating V, Pun S, O Hare T (21) Screening sweet corn for enhanced zeaxanthin concentration. J Sci Food Agr 9:91 96 Fu W, Magnúsdóttir M, Brynjólfson S, Palsson BO, Paglia G (212) UPLC-UV-MSE analysis for quantification and identification of major carotenoid and chlorophyll species in algae. Anal Bioanal Chem 44: Gao Z, Meng C, Zhang X, Xu D, Miao X, Wang Y, Yang L, Lv H, Chen L, Ye N (212) Induction of salicylic acid (SA) on transcriptional expression of eight carotenoid genes and astaxanthin accumulation in Haematococcus pluvialis. Enzyme Microb Tech 51: Grünewald K, Eckert M, Hirschberg J, Hagen C (2) Phytoene desaturase is localized exclusively in the chloroplast and upregulated at the mrna level during accumulation of secondary carotenoids in Haematococcus pluvialis (Volvocales, Chlorophyceae). Plant Physiol 122: Han D, Li YT, Hu Q (213) Astaxanthin in microalgae: pathways, functions and biotechnological implications. Algae 28: Harker M, Tsavalos AJ, Young AJ (1996) Factors responsible for astaxanthin formation in the chlorophyte Haematococcus pluvialis. Bioresource Technol 55: Huang J-C, Chen F, Sandmann G (26) Stress-related differential expression of multiple β-carotene ketolase genes in the unicellular green alga Haematococcus pluvialis. J Biotech 122: Jin E, Lee CG, Polle JEW (26) Secondary carotenoid accumulation in Haematococcus (Chlorophyceae): biosynthesis, regulation, and biotechnology. J Microbiol Biotechnol 16: Kamath BS, Srikanta BM, Dharmesh SM, Sarada R, Ravishankar GA (28) Ulcer preventive and antioxidative properties of astaxanthin from Haematococcus pluvialis. Eur J Pharmacol 59: Kobayashi M, Kurimura Y, Kakizono T, Nishio N, Tsuji Y (1997) Morphological changes in the life cycle of the green alga Haematococcus pluvialis. J Ferment Bioeng 84:94 97 Li Y, Sommerfeld M, Chen F, Hu Q (28) Consumption of oxygen by astaxanthin biosynthesis: a protective mechanism against oxidative stress in Haematococcus pluvialis (Chlorophyceae). J Plant Physiol 165:

10 Li Y, Sommerfeld M, Chen F, Hu Q (21) Effect of photon flux densities on regulation of carotenogenesis and cell viability of Haematococcus pluvialis (Chlorophyceae). 22: Lotan T, Hirschberg J (1995) Cloning and expression in Escherichia coli of the gene encoding β-c-4-oxygenase, that converts β-carotene to the ketocarotenoid canthaxanthin in Haematococcus pluvialis. FEBS Lett 364: Lu QY, Zhang Y, Wang Y, Wang D, Lee RP, Gao K, Byns R, Heber D (29) California Hass avocado: profiling of carotenoids, tocopherol, fatty acid, and fat content during maturation and from different growing areas. J Agric Food Chem 57: Sarada R, Bhattacharya S, Bhattacharya S, Ravishankar GA (22a) A response surface approach for the production of natural pigment astaxanthin from green alga, Haematococcus pluvialis: effect of sodium acetate, culture age, and sodium chloride. Food Biotechnol 16:17 12 Sarada R, Tripathi U, Ravishankar GA (22b) Influence of stress on astaxanthin production in Haematococcus pluvialis grown under different culture conditions. Process Biochem 37: Steinbrenner J, Linden H (21) Regulation of two carotenoid biosynthesis genes coding for phytoene synthase and carotenoid hydroxylase during stress-induced astaxanthin formation in the green alga Haematococcus pluvialis. Plant Physiol 125: Sun Z, Cunningham FX, Gantt E (1998) Differential expression of two isopentenyl pyrophosphate isomerases and enhanced carotenoid accumulation in a unicellular chlorophyte. Proc Natl Acad Sci U S A95: Vidhyavathi R, Venkatachalam L, Sarada R, Ravishankar GA (28) Regulation of carotenoid biosynthetic genes expression and carotenoid accumulation in the green alga Haematococcus pluvialis under nutrient stress conditions. J Exp Bot 59: Vidhyavathi R, Sarada R, Ravishankar GA (29) Expression of carotenogenic genes and carotenoid production in Haematococcus pluvialis under the influence of carotenoid and fatty acid synthesis inhibitors. Enzyme Microb Tech 45:88 93