Supporting Online Material, Zubieta et al., MS#

Transcription

1 Supporting Online Material, Zubieta et al., MS# SOM, p. 1 Materials and Methods Subjects. Volunteers were right-handed, non-smokers who had no personal history of medical, psychiatric illness, substance abuse or dependence and no family history of inheritable illnesses. Volunteers were not taking psychotropic medications or hormone treatments and did not exercise in excess of 1 hour three times a week. Women had not used hormonal birth control for at least 6 months, had regular menstrual cycles, and were scanned during the follicular phase of their menstrual cycles (2 9 days after the onset of menses), ascertained by plasma levels of estradiol and progesterone immediately prior to scanning. To further standardize the hormonal milieu of the women volunteers, the presence of ovulatory cycles prior to scanning was also determined by a progesterone level of >3 ng/ml during the luteal phase of the preceding menstrual cycle. Subjects were instructed not to drink alcohol for at least 24 hours and not to exercise or eat prior to the study. All studies were conducted in the morning, between 8 and 11 AM. Written informed consent was obtained in all cases. All the procedures employed were approved by the University of Michigan Investigational Review Board for Human Subject Use and the Radiation Safety Committee. Genotyping. COMT val 158 met genotypes were determined by restriction fragment length polymorphism. A 109-base-pair polymerase chain reaction (PCR) product was generated in 30 cycles with an annealing temperature of 54ºC by using the primers Comt1 nt ' CTCATCACCATCGAGATCAA and Comt2 nt ' CCAGGTCTGACAACGGGTCA. The val and met alleles were discriminated by digesting the PCR product with N1aIII at 37ºC for 4 hours, followed by 4.5% agarose gel electrophoresis. The val/val homozygotes (86 and 23 base pairs), met/met homozygotes (68 and 18 base pairs) and met/val heterozygotes (86, 68, 23, and 18 base pairs) were visualized by ethidium bromide staining. Pain model. Pain and saline control conditions were introduced 20 min after radiotracer administration, in a blind, randomized design (half the volunteers receiving pain first, and half saline control). A steady state of muscle pain was maintained from 20 to 40 min post-radiotracer administration by a computer-controlled system through the infusion of small amounts of medication-grade hypertonic saline (5%) into the masseter muscle. In this model of sustained deep somatic pain, the intensity of the painful stimulus is controlled by using feedback from subjects every 15 s to adjust the rate of infusion of hypertonic saline, as described in detail elsewhere (S2, S3). Briefly, a standard 150-µl bolus of hypertonic saline is administered over 15 s to establish the initial step response of the system. An electronic version of a 10-cm visual analog scale (VAS) placed in front of the scanner gantry is then used by the subject to rate pain intensity once every 15 s. This signal is fed back to the computer via an analog-digital board, which then adjusts the infusion rate so that pain is maintained at VAS intensity ratings of for the duration of the challenge. This results in an average VAS rating of about 40 for the entire study. Subjects are informed that the lower end on the scale denotes "no pain," while the upper bound represents the "most intense pain imaginable." The control condition consisted of isotonic saline infused at the average rate required to achieve 40 VAS ratings, and was applied in the masseter muscle opposite to where pain was induced. The location of the algesic and control infusions (right-left) was also randomized and counterbalanced. The sensory and pain-specific affective qualities of the painful stimulus were rated at the time of completion of each PET scan with the McGill Pain Questionnaire (MPQ) (S4). The internal emotional state of the volunteers was rated at the same time with the Positive and Negative Affectivity Scale (PANAS) (S5). 1

2 SOM, p. 2 Neuroimaging methods. MRI scans were acquired in all subjects on a 1.5 Tesla scanner (Signa, General Electric, Milwaukee, WI). Acquisition sequences were axial SPGR IR-Prep MR (TE = 5.5, TR = 14, TI = 300, flip angle = 20 o, NEX = 1, 124 contiguous images, 1.5 mm-thickness), followed by axial T2 and proton density images (TR = 4000, TE = 20 and 100, respectively, NEX= 1, 62 contiguous images, 3 mm thick). PET scans were acquired with a Siemens ECAT Exact scanner in three-dimensional mode with septa retracted. Participants were positioned in the PET scanner gantry, and two intravenous (antecubital) lines were placed. A light forehead restraint was used to eliminate intrascan head movement. [ 11 C]carfentanil was synthesized at high specific activity (>2000 Ci/mmol) by the reaction of [ 11 C]methyliodide and a nonmethyl precursor as previously described (S6), with minor modifications to improve its synthetic yield (S7); mci ( MBq) were administered to each subject for each of the two PET scans. The two administrations were separated by 2 hours to allow for tracer decay. The total mass of carfentanil injected was ± µg/kg per scan, ensuring that the compound was administered in tracer quantities, i.e., subpharmacological doses. Receptor occupancy by carfentanil was calculated to be between 0.2% and 0.6% for brain regions with low, intermediate and high µ-opioid receptor concentrations, based on the mass of carfentanil administered and the known concentration of µ- opioid receptors in the postmortem human brain (S8, S9). The mass of carfentanil administered did not differ between men and women, or between saline control and pain scans within each group. Fifty-five percent of the [ 11 C]carfentanil dose was administered as a bolus, and the remainder as a continuous infusion using a computer-controlled pump to achieve steady-state tracer levels. Nineteen sets of scans were acquired over 70 min with an increasing duration (30 s up to 10 min). Images were reconstructed using filtered back-projection with a Hanning 0.5 filter, and included both measured attenuation and scatter corrections. Dynamic images were coregistered to each other and the intercommisural line using automated computer routines (S10). Image data were then transformed on a voxel-by-voxel basis into two sets of parametric maps: (a) a tracer transport measure (K 1 ratio), and (b) a receptor-related measure (DVR), the latter using data obtained from 20 to 70 min post-tracer administration for saline control and pain studies. To avoid the need for arterial blood sampling, the tracer transport and binding measures were calculated using a modified Logan graphical analysis (S11), using the occipital cortex (an area devoid of µ-opioid receptors) as the reference region. With the tracer administration protocol employed, the Logan plot becomes linear by 5-7 min after the start of radiotracer administration, with its slope being the distribution volume ratio (DVR), a measure equal to the (Bmax/Kd) + 1 for this receptor site and radiotracer. Bmax/Kd (or DVR-1) is the receptor related measure (µ-opioid receptor availability, or binding potential). K 1 and DVR images for each experimental period and MR images were co-registered to each other and to the International Consortium for Brain Mapping (ICBM) stereotactic atlas orientation (S12). Statistical parametric maps of differences between conditions (control - pain) were generated by anatomically standardizing the T1-SPGR MRI of each subject to the ICBM stereotactic atlas coordinates, with subsequent application of this transformation to the µ-opioid receptor binding maps (S12). The accuracy of coregistration and non-linear warping algorithms was confirmed for each subject individually by comparing the transformed MRI and PET images to each other and the ICBM atlas template. Prior to nonlinear warping, image data were flipped so that the side of the painful challenge (induced on the right or the left masseter muscle) was located on the same side of the image for all subjects. Image data are therefore presented as ipsilateral or 2

3 SOM, p. 3 contralateral to the painful stimulus, regardless of the actual location (right-left). Differences between conditions and groups were then mapped into stereotactic space using t maps of statistical significance with SPM 99 and Matlab software, with a general linear model and correction for multiple comparisons (S13). No global normalization was applied to the data, and therefore the calculations presented are based on absolute Bmax/Kd estimates. Only regions with specific µ-opioid receptor binding were included in the analyses (voxels with DVR values >1.2 times the mean global image value for µ-opioid receptor images as calculated with SMP'99). To compensate for small residual anatomic variations across subjects and to improve signal to noise ratios, a three-dimensional Gaussian filter (FWHM 6 mm) was applied to each scan. One-way ANOVA was calculated for the main effect of genotype (met/met, val/met, val/val), followed by a linear correlation model in which the level of COMT function was entered as the main effect (met/met, low, 1, val/met, intermediate, 0, val/val, high, 1). Comparisons between homozygous and matched heterozygous volunteers were then performed using post-hoc, twosample t-tests, calculated for each voxel using the smoothed pooled variance across voxels (S14). Areas of significant differences were detected using a statistical threshold that controls a Type-I error rate at P = 0.05 for multiple comparisons (z score = 4.3, F = 12.2 for ANOVA for the studies presented), at a final resolution of about mm. These statistical thresholds are estimated using the Euler characteristic (S15) based on the number of voxels in the gray matter and image smoothness (S16). In one case (Table 1), Z scores were also deemed significant as they reached statistical thresholds after correction for the size of the cluster under consideration (S17). Numerical differences between groups and data for the graphs in Figure 1 were extracted from the image data by averaging the values of voxels contained in an area of significant differences, down to a threshold of P =

4 SOM, p. 4 Fig. S1. Correlations between COMT met 158 val genotype and µ-opioid system activation in response to sustained pain. Ventral pallidum and amygdala. Association between COMT activity conferred by met 158 val genotypes and µ-opioid system activation in response to the pain stressor. Shown are the mean ± S.D. values for the % change in the magnitude of µ-opioid system activation in the ventral pallidum ipsilateral to the painful challenge and the contralateral amygdala (with some contribution of the adjacent anterior temporal cortex). The localization in stereotactic coordinates and corresponding z values for these and additional correlations reaching statistically signficance thresholds are described in the legend of Figure 1 in the main text. 4

5 SOM, p. 5 Table S1. Localization and magnitude of activation of µ-opioid receptor mediated neurotransmission as a function of val 158 met genotypes. Data represent the localization (ICBM coordinates) and magnitude of differences in µ-opioid system activation by endogenous opioid peptides during pain between groups in post hoc analyses. Lower µ-opioid system activation was observed in the met/met group (n = 4), compared with its matched heterozygous control group (n = 11). Higher magnitudes of µ-opioid system activation were observed in the val/val group (n = 3), compared with its heterozygous control group (n = 9). Cluster size is expressed in 1 3 mm voxels. Effect size %Diff. refers to the percent average difference in the magnitude of µ-system activation during pain, between genotype groups. Z scores refer to the comparison (saline control minus pain, met/val) minus (saline control minus pain, met/met). P values shown are corrected for multiple comparisons using peak analysis (S1). NAC/VP/HYPOTHA refers to a large area in which the significant differences were centered in the ventral pallidum, but extended anteriorly to the nucleus accumbens and medially into the hypothalamus, not allowing for a clear differentiation of its regional boundaries. VP/Subthalamus refers to an area in which statistical significance included the boundaries between the ventral pallidum and the adjacent subthalamic nucleus. C, contralateral to the side of pain. I, ipsilateral to the side of pain. Coordinates Cluster Effect (x,y,z) size size Regions (mm) (voxels) %Diff. Z score P Met/Met < Met/Val NAC / VP / HYPOTHA (C) 8, 0, < * VP / Subthalamus (I) 10, 2, * Nucleus Accumbens (I) 12, 12, Amygdala (C) 28, 4, < 0.05 * Amygdala (I) 22, 1, < 0.01 * Val/Val > Met/Val Dorsal Anterior Cingulate (C) 3, 4, * Anterior Thalamus (C) 6, 2, < * Cerebellar Vermis 1, 49, * *Significantly different after correction for multiple comparisons, two sample, two-tailed t-tests. Significantly different after correction for multiple comparisons and correction for cluster size using the Statistical Parametric Mapping package (SPM'99) (S1) (P < 0.001). 5

6 SOM, p. 6 Table S2. Psychophysiological responses to intensity-controlled sustained pain: Correlations with COMT activity. Data show the mean ± S.D. of demographics and variables related to the painful challenge as a function of COMT activity (high, val/val; intermediate, met/val; low met/met, coded as +1, 0 and 1 for the correlation analysis). Acute Pain (15 s) VAS intensity: average visual analog intensity ratings of pain in response to a standard (150 µl) infusion of hypertonic saline over 15 s at the initiation of the challenge. Sustained Pain (0 20 min) VAS Intensity: average visual analog intensity ratings of pain over the entire study. The average infusion rate of hypertonic saline (µl/min) to achieve the target pain intensity (0 20 min) was also divided into early (0 10 min) and later stages of pain (10 20 min), due to the possible differential contribution of µ-opioid mechanisms to various stages of pain. PANAS Negative Affect (Pain - Control) refers to the difference in PANAS negative affect ratings between pain and control conditions. Rating - Stimulus Ratio reflects the relationship between MPQ and PANAS ratings and the average infusion rate of intramuscular hypertonic saline (in µl) necessary to achieve the target pain intensity ( 100). COMT Enzyme Activity High Intermediate Low Genotype Val/Val Met/Val Met/Met (n = 3) (n =22) (n = 4) r Age 24.7 ± ± ± 3.3 Education (years) 17.3 ± ± ± 3.2 Acute Pain (15 s) VAS Intensity 50.0 ± ± ± Sustained Pain (0 20 min) VAS Intensity 34.2 ± ± ± Average Infusion rate (µl/min) 0 20 min ± ± ± min 72.3 ± ± ± min ± ± ± * MPQ Sensory 12.3 ± ± ± MPQ Affective 0.3 ± ± ± MPQ Total 19.0 ± ± ± PANAS Negative Affect (Pain) 1.7 ± ± ± PANAS Negative Affect (Pain - Control) 0.3 ± ± ± * Rating - Stimulus Ratio MPQ Sensory 11.1 ± ± ± MPQ Affective 0.3 ± ± ± MPQ Total 17.8 ± ± ± PANAS Negative Affect (Pain) 2.1 ± ± ± * PANAS Negative Affect (Pain - Control) 0.7 ± ± ± *Significant correlations with COMT activity conferred by the COMT val 158 met genotypes. Spearman rank correlations, P < Trend correlations, P between 0.05 and

7 Methods References S1. J. K. Zubieta et al., J. Neurosci. 22, 5100 (2002). SOM, p. 7 S2. X. Zhang, J. A. Ashton-Miller, C. S. Stohler, IEEE Trans. Biomed. Eng. 40, 344 (1993). S3. C. S. Stohler, C. Kowalski, Pain 79, 165 (1999). S4. R. Melzack, J. Katz, in Handbook of Pain Assessment, R. Melzack, Ed. (Guilford Press, New York, 2000), pp S5. D. Watson, L. A. Clark, A. Tellegen, J. Personal Soc. Psychol. 54, 1063 (1988). S6. R. F. Dannals et al., Int. J. Appl. Radiat. Isot. 36, 303 (1985). S7. D. Jewett, Nucl. Med. Biol. 28, 733 (2001). S8. R. Gross-Isseroff, K. Dillon, M. Israeli, A. Biegon, Brain Res. 530, 312 (1990). S9. A. Gabilondo, J. Meana, J. Garcia-Sevilla, Brain Res. 682, 245 (1995). S10. S. Minoshima et al., J. Nucl. Med. 34, 322 (1993). S11. J. Logan et al., J. Cereb. Blood Flow Metab. 16, 834 (1996). S12. C. R. Meyer et al., Med. Image Anal. 1,195 (1997). S13. K. J. Friston et al., Human Brain Mapp. 2, 189 (1995). S14. K. J. Worsley, A. Evans, S. Marrett, P. Neelin, J. Cereb. Blood Flow Metab. 12, 900 (1992). S15. K. J. Worsley, Adv. Appl. Prob. 26, 13 (1994). S16. K. J. Friston, C. D. Frith, P. F. Liddle, R. S. J. Frackowiak, J. Cereb. Blood Flow Metab. 11, 690 (1991). S17. K. J. Friston et al., Human Brain Mapp. 1, 210 (1994). 7