Mycoplasma pneumoniae 23S rrna Gene Mutations and Mechanisms of Macrolide Resistance

Transcription

1 Mycoplasma pneumoniae 23S rrna Gene Mutations and Mechanisms of Macrolide Resistance Yun Ye, MS,* Suliang Li, MS, Yajun Li, PhD, Tianshun Ren, MS, and Kaige Liu, PhD ABSTRACT Objective: Resistant strains of Mycoplasma pneumoniae lead to antibiotic inefficacy. The relationship between M pneumoniae 23S rrna (GenBank: X ) gene mutations and macrolide resistance phenotype has not been fully established, to our knowledge. In this study, we isolated and cultured macrolide-resistant strains of M pneumoniae and tested them for 23S rrna gene mutations. Methods: Throat swab samples from patients (n = 800) with community-acquired respiratory tract infections were isolated by nested PCR for the molecular identification of clinical isolates. An in vitro drug sensitivity test was performed on clinical isolates for macrolide antibiotic efficacy. The minimum inhibitory concentration (MIC) was used to select resistant strains. Resistant strains of 23S rrna were sequenced and compared with the sequences of standard macrolidesensitive M129 strains by comparative sequence analysis, focusing the analysis on mutations linked to the drug-resistance phenotype. M pneumoniae is responsible for respiratory-tract infections in children and adolescents, and is one of the main pathogens that causes pneumonia and pulmonary complications. 1,2,3 M pneumoniae lack a peptidoglycan cell wall; thus, beta-lactam antibiotics, such as penicillin and cephalosporins, are ineffective. Instead, antibiotics that inhibit bacterial protein synthesis, such as macrolides and fluoroquinolones, are effective. 4 Since children are in a growth and development phase, 14-ring DOI: /LMYEY7P26RHWRRUL Abbreviations PCR, polymerase chain reaction, PPLO, pleuropneumonialike organism; MIC, minimal inhibitory concentration; EDTA, ethylenediaminetetraacetic acid; bp, base pairs Clinical Laboratory, Affiliated Hospital of Xi an Medical University, Xi an China *To whom correspondence should be addressed. yeyun236@163.com Results: One hundred M pneumoniae strains were isolated, of which 82 strains were macrolide sensitive and 18 strains were resistant. Mutations were identified in 16 of the 18 macrolide-resistant strains. The following mutations were detected: A2063G, A2064G, C2617G, and A2067G. Of these mutations, A2063G exhibited 14-ring macrolide resistance, A2064G exhibited 14- and 16-ring macrolide resistance, C2617G demonstrated 14- and 15-ring macrolide resistance, and A2067G demonstrated josamycin resistance. Conclusion: M pneumoniae resistance to macrolide antibiotics is a serious clinical issue: our results indicate that 23S rrna mutations are associated with drug resistance. By analysis of the 23S rrna mutation and resistance phenotype, our understanding of the clinical drug resistance of M pneumoniae can aid in the rational selection and application of antibiotics for optimal therapeutic treatments. Keywords: Mycoplasma pneumoniae, gene mutation, macrolide, microbial sensitivity tests erythromycin and 15-ring azithromycin are the preferred antibiotics because they have minimal effects on human development. In recent years many countries, including China, have reported the emergence of resistant strains of M pneumoniae, 5,6 resulting in the failure of antibiotic therapy. Isolated cultures of M pneumoniae are difficult to analyze, in part because the doubling time is quite long. Few studies have investigated the mechanisms by which resistant M pneumoniae strains develop. Therefore, a better understanding of M pneumoniae resistance may greatly improve disease-treatment options. 23S rrna mutations cause ribosome conformational changes that alter the macrolide antibiotic binding site, which may result in antibiotic resistance. Mutations in 23S rrna have been previously reported 7 to confer resistance to strains of M pneumoniae. The relationship between M pneumoniae 23S rrna gene mutations and the macrolide resistance phenotype, however, is not well understood. In this study, we isolated and cultured M pneumoniae resistant strains and detected 23S rrna mutations using nested polymerase chain reaction (PCR) and DNA Winter 2013 Volume 44, Number 1 Lab Medicine 63

2 sequencing, focusing the analysis on mutations that could confer the drug-resistance phenotype. Materials and Methods Isolation of M pneumoniae Specimens Clinical specimens were obtained from patients with symptoms of community-acquired respiratory tract infections who had been admitted to the Affiliated Hospital of Xi an Medical University in China between June 2008 and February A total of 800 throat swab specimens (from 500 boys and 300 girls) were collected from children ranging from age 1 to 12 years. Sterilized swabs were used to collect posterior-wall secretions from the children. The swabs were inoculated in the M pneumoniae medium and incubated at 37ºC. The positive control was an antibioticfree growth control and the negative control was an M pneumoniae free control. Indicators of M pneumoniae growth included glucose fermentation and acid production (indicated by a drop in ph). The positive control was used for comparison. M pneumoniae Medium The medium was composed of 70 ml pleuropneumonialike organism (PPLO) broth supplemented with 20 ml of newborn calf serum (20% final; Econazole Biological Co, Zhengzhou, China), 5 ml of 50% yeast extract (2.5% final; Guangdong Jiangmen Center For Biotechnology Development Co, Ltd, Jiangmen, China), 2.5 ml of 20% glucose (0.5% final; Guangdong Jiangmen Center For Biotechnology Development Co, Ltd, Jiangmen, China), 500 μl of 1% phenol red (0.005% final; SINOPHARM Group, Ltd, Beijing, China), 1 ml of 2.5% thallium acetate (0.025% final), 0.5 ml of 200,000 units per ml potassium penicillin (100,000 units final), and 0.5 ml of 20,000 μg per ml cefotaxime (10,000 μg final; Shenzhen Zhijun Pharmaceutical Co, Ltd, Shenzhen, China), in a total volume of 100 ml. M pneumonia was identified by a change in the color of the broth from red to yellow. The M pneumoniae strain M129 (ATCC 29342D) was used as a control and was purchased from the Pediatric Research Institute of Capital Medical University, Beijing, China. Application of In Vitro Drug Sensitivity Test The MIC of macrolide antibiotics was determined by a broth microdilution method using PPLO broth, based on the method established by the National Committee for Clinical Laboratory Standards. 8,10 M pneumoniae liquid media with dilutions of drug standards from 256 to mg per L (pharmaceutical and biological products) were added combined with an equal volume of M pneumoniae bacilli (concentration, color change unit (CCU)/L) and placed in a CO 2 incubator at 37ºC for 5-14 days until the color changed in the antibiotic-free growth control. The MIC was defined as the lowest concentration of each antibiotic that failed to elicit a color change when the antimicrobial-free control plate demonstrated growth of the organism. If the MIC value was at least 4-fold higher than the MIC values of the standard strains, the strain was classified as being resistant. 23S rrna Gene Analysis DNA Extraction From Clinical Isolates We transferred 20 μl of inoculated broth into a 1.5-mL centrifugal tube and centrifuged it at 12,000 rpm for 10 minutes. After removal of the supernatant, the sediment was suspended in 200 μl of Tris(hydroxymethyl) aminomethane-ethylenediaminetetraacetic acid (Tris-EDTA) 10mM Tris-HCl, 1 mm EDTA (ph, 8.0), and 1% (V/V) Triton X-100 (Sigma-Aldrich Co, Ltd, St. Louis, MO). The tube was placed in a boiling-water bath at 100ºC for 10 minutes to extract the DNA. 23S rrna Nested PCR and DNA Sequencing The 23S rrna sequence in resistant strains was identified by nested PCR and DNA sequencing. The M pneumoniae 23S rrna nucleic acid sequence (GenBank: X ) from the GenBank database was entered into the free Primer software, version 5.0, to design the primers for nested PCR amplification. The fragment was amplified using the primers shown in Table 1. The forward primer Mp-1 F and reverse primer Mp-1 R (15 pmol of each) and TaqDNA polymerase (1 U) were added to a total reaction volume of 20 μl, in which the template solution (5 μl) was added. Thermal cycling parameters were 94ºC at 2 minutes for denaturation, 94ºC for 45 seconds, 55ºC for 1 minute, and 72ºC for 80 seconds, for a total of 30 cycles, with a final 1-cycle extension of 72ºC for 5 minutes. The 290-bp amplicand (2 μl) was used as the template for a second amplification. Mp-2 F and Mp-2 R were used as the primers; the second amplification was completed under the same conditions described. The final amplicand was 244 base pairs (bp). The amplified products were examined by gel electrophoresis (Figure 1). For the specimens that tested positive by electrophoresis, 10 μl of the specimen was sequencedusing the DYEnamic ET Terminator Cycle 64 Lab Medicine Winter 2013 Volume 44, Number 1

3 Table 1. Primers Used in Testing Primer Name Sequence (5'-3') Position Product Size (bp) M pneumonia-1 F GGTCCTAAGGTAGCGAAATT M pneumonia-1 R CAGTTACCAATTAGAACAGC NA M pneumonia-2 F CCTAGTCGGGTAAATTCCGT M pneumonia-2 R CCAAGGGTAGTATTCCACCT NA Abbreviations: F, forward; R, right. sequencing kit (Shanghai Sangon Biological Engineering Technology and Service Co, Ltd). The nucleotide were determined with an Applied Biosystems Inc 3730 XL sequencer (Life Technologies Corporation, Carlsbad, CA), and the results were compared to the National Center for Biotechnology Information logged standard strain M129 M pneumoniae (ATCC 29342D). 11,12 Results Of a total of 800 throat-swab specimens that were isolated and cultured, M pneumoniae was identified in 100 isolates, for a positive rate of 12.5%. Samples were confirmed to be M pneumoniae by nested PCR. The 100 M pneumoniae strains and M129 controls were subject to drug sensitivity tests. The MICs in this study were determined for erythromycin, clarithromycin, telithromycin, roxithromycin (14-ring macrolide), josamycin, Table 2. Minimal Inhibitory Concentrations of the 82 Sensitive Strains Minimal Inhibitory Concentration (MIC; μg/ml) a Antibiotic Range MIC 50 MIC 90 M129 Erythromycin Clarithromycin Azithromycin Josamycin Midecamycin Telithromycin Spiramycin Roxithromycin a MIC 50 and MIC 90 indicate the minimum concentrations at which 50% and 90%, respectively, are inhibited. midecamycin, midecamycin (16-ring macrolide), and azithromycin (15- ring macrolide). We found that 82 strains were sensitive and 18 were resistant (18% resistance; Table 2). As shown in Figure 1, the target band appeared by nested PCR amplification in all cases. As shown in Figure 2, of the 18 resistant strains, A2063G, A2064G, C2617G, and A2067G mutations were observed in 16 of them. Of note, no mutations were identified in 2 of the resistant strains. We randomly selected 10 sensitive strains for sequencing and did not find mutations in any of these strains. The A2063G and C2617G mutations showed 14- ring macrolide resistance, the A2064G mutation showed 14- and 16-ring macrolide resistance, and the A2067G mutation demonstrated josamycin resistance (Table 3). Discussion Macrolide-resistant M pneumoniae present therapeutic challenges, and the mechanisms of the resistance are unclear Our study focused on the role of target mutations in resistant strains. 17 The most significant findings of this study were the identification of 18 mutations in M pneumoniae strains that associated with macrolide resistance that may be used for antibiotic development to increase treatment efficacy against these resistant strains. Mycoplasma can produce clinical manifestations that vary from mild to severe upper respiratory tract infections to fatal pneumonia. Also, M pneumoniae infections are capable of causing extrapulmonary complications, such as meningoencephalitis, myocarditis, pericarditis, autoimmune hemolytic anemia, and nephritis. 18,19 M pneumoniae is not endemic in children, but still accounts for approximately 10% to 20% of pneumonia cases, with a prevalence as high as 30% each year. M pneumoniae is the common pathogen in children aged 5 years and older; Winter 2013 Volume 44, Number 1 Lab Medicine 65

4 Figure M Corresponding target band (244 base pairs) by nested polymerase chain reaction amplification. Lanes 1 through 3 show partially resistant strains; M indicates the molecular weight marker. Figure 2 Multiple alignment of the 23S rrna genes of Mycoplasma pneumonia M129 and the 18 macrolide-resistant M pneumonia strains. Partial sequences from position 2051 through 2071 and 2610 through 2630 are shown. The positions 2063, 2064, 2067, and 2617 are underlined. Strains 5 and 14 showed no mutations. 244bp M GCAACGGGACGGAAAGACCCC GTTGGTCCCTATCTATTGTGC G G... 3 G G G G. 8 G G G.. 11 G G G G G.. 17 G G also, the occurrence in infants and young children is not uncommon. Mycoplasma can account for incidence rates of 50% or more in older children. M pneumoniae infection has become a significant clinical issue in pediatric patients in recent years due to the increased prevalence of antibiotic-resistant strains. 20,21 Macrolide antibiotics are the treatment of choice in children with M pneumoniae infection due to the structural characteristics of the drug that limit the adverse effects on growth and development observed with the use of other antibiotics. In recent years, however, an increasing number 66 Lab Medicine Winter 2013 Volume 44, Number 1

5 Table 3. In Vitro Antimicrobial Activity of 8 Agents Against Macrolide-Resistant Mycoplasma Pneumonia Strains MIC (μg/ml) Strain Age, y ERY CLA AZM JOS MID TEL SPI ROX Mutation A2063G A2063G A2064G C2617G None A2063G C2617G A2063G A2067G A2063G A2064G A2063G A2063G None A2063G A2064G A2063G A2063G Abbreviations: ERY, erythromycin; CLA, clarithromycin; AZM, azithromycin; JOS, josamycin; MID, midecamycin; TEL, telithromycin; SPI, spiramycin; ROX, roxithromycin. a n = 18. of drug-resistant strains have been isolated. Okazaki et al 22 reported that increasing numbers of the mycoplasma infections have been caused by macrolide-resistance strains. Pereyre and colleagues 5 first reported antibioticresistant strains of M pneumonia-resistant Morozumi et al 23 identified several strains of macrolide resistant M pneumoniae and found that resistant strains of this infectious agent were appearing faster when observed with other bacterial species, concluding that M pneumoniae resistance to macrolide antibiotics was rapidly becoming a very serious clinical concern. Macrolide antibiotics function by inhibiting bacterial protein synthesis, targeting the large bacterial 50S ribosomal subunit that binds peptides GGT in the output channels, and mechanically obstructing nascent chain extension, thereby preventing protein synthesis. 24 The binding sites have been localized to the center of the 23S rrna V ring, namely, the A2063 and A2064 sites. 4,5 Of interest, 16 resistant strains identified in our study showed point mutations at amino acid positions 2063, 2064, 2617, and 2067 but not in any other region. Of these mutations, A2063G exhibited 14-ring macrolide resistance, A2064G exhibited 14- and 16-ring macrolide resistance, and A2067G demonstrated josamycin resistance. The relationship of 3 mutations and the drugresistance phenotype is consistent with the findings of previous studies. 8,12 The mutation C2617G, however, has not been previously reported, to our knowledge. The C2617G mutation demonstrated 14- and 15-ring macrolide resistance. In the 2 resistant strains that showed no mutations, other mechanisms are likely to confer macrolide resistance, including the possible decrease in antibiotic intracellular concentration by active efflux and antibiotic inactivation (enzymatic modification of antibiotics). 25 All resistant strains were sensitive to telithromycin, which widens the antibacterial range and provides an additional drug to select when antibiotic resistance is encountered. M pneumoniae infection is usually a self-limited disease in that bacterial growth can stop automatically without producing severe sequelae. 26 This may explain why the samples taken from the children showed a low positive culture rate. Our results, therefore, may not reflect the actual occurrence of macrolide resistance. In summary, we isolated and identified 18 pairs of macrolide-resistant strains of M pneumoniae and identified the mutations of the 23S rrna in these isolates. The identification of 23S rrna mutation associated with a resistance phenotype increases our previous Winter 2013 Volume 44, Number 1 Lab Medicine 67

6 understanding of the clinical drug resistance of M pneumoniae and also provides potential insights into antibiotic resistance in other bacterial species. LM Acknowledgments This study was supported by funds from the Affiliated Hospital of Xi an Medical College, China (XYFY-09-20). We express our gratitude to the study participants and research personnel for their involvement in this study and thank the following individuals for their valuable assistance: Ming Xie, PhD; Kai Wen, MS; and Yang Ji, MS. We thank Medjaden Bioscience Limited, Hong Kong, for assisting in the preparation of this manuscript. References To read this article online, scan the QR code, ascpjournals.org/content/44/1/63. full.pdf+html 1. Schmidt-Ioanas M, Bender M, Roth A, et al. Serologic early diagnosis of pneumonia caused by Mycoplasma pneumoniae [in German]. Dtsch Med Wochenschr. 2006;131(12): Harris JA, Kolokathis A, Campbell M, Cassell GH, Hammerschlag MR. Safety and efficacy of azithromycin in the treatment of community-acquired pneumonia in children. Pediatr Infect Dis J. 1998;17(10): Matsuoka M, Narita M, Okazaki N, et al. Characterization and molecular analysis of macrolide-resistant Mycoplasma pneumoniae clinical isolates obtained in Japan. Antimicrob Agents Chemother. 2004;48(12): Bébéar CM, Pereyre S. Mechanisms of drug resistance in Mycoplasma pneumonia. Curr Drug Targets Infect Discord. 2005;5(3): Pereyre S, Charron A, Renaudin H, Bébéar C, Bébéar CM. First report of macrolide-resistant strains and description of a novel nucleotide sequence variation in the P1 adhesin gene in Mycoplasma pneumoniae clinical strains isolated in France over 12 years. J Clin Microbiol. 2007;45(11): Matsuoka M, Narita M, Okazaki N, et al. Characterization and molecular analysis of macrolide-resistant Mycoplasma pneumoniae clinical isolates obtained in Japan. Antimicrob Agents Chemother. 2004;48(12): Morozumi M, Hasegawa K, Kobayashi R, et al. Emergence of macrolide-resistant Mycoplasma pneumoniae with a 23S rrna gene mutation. Antimicrob Agents Chemother. 2005;49(6): Pereyre S, Guyot C, Renaudin H, Charron A, Bébéar C, Bébéar CM. In vitro selection and characterization of resistance to macrolides and related antibiotics in Mycoplasma pneumoniae. Antimicrob Agents Chemother. 2004;48(2): Takahata M, Shimakura M, Hori R, et al. In vitro and in vivo efficacies of T-3811ME (BMS ) against Mycoplasma pneumoniae. Antimicrob Agents Chemother. 2001;45(1): Li RK, Elie CM, Clayton GE, Ciblak MA. Comparison of a new colorimetric assay with the NCCLS broth microdilution method (M-27A) for antifungal drug MIC determination. J Clin Microbiol. 2000;38(6): Matsuoka M, Narita M, Okazaki N, et al. Characterization and molecular analysis of macrolide-resistant Mycoplasma pneumoniae clinical isolates obtained in Japan. Antimicrob Agents Chemother. 2004;48(12): Okazaki N, Narita M, Yamada S, et al. Characteristics of macrolideresistant Mycoplasma pneumoniae strains isolated from patients and induced with erythromycin in vitro. Microbiol Immunol. 2001;45: Niitu Y, Hasegawa S, Suetake T, Kubota H, Kobatsu S, Horikawa M. Resistance of Mycoplasma pneumoniae to erythromycin and other antibiotics. J Pediatr. 1970;76(3): Poehlsgaard J, Douthwaite S. Macrolide antibiotic interaction and resistance on the bacterial ribosome. Curr Opin Investig Drugs. 2003;4(2): Rosato A, Vicarini H, Bonnefoy A, Chantot J-F, Leclercq R. A new ketolide, HMR 3004, active against streptococci inducibly resistant to erythromycin. Antimicrob Agents Chemother. 1998;42(6): Stopler T, Branski D. Resistance of Mycoplasma pneumoniae to macrolides, lincomycin and streptogramin B. J Antimicrob Chemother. 1986;18(3): Lucier TS, Heitzman K, Liu S-K, Hu P-C. Transition mutations in the 23S rrna of erythromycin-resistant isolates of Mycoplasma pneumoniae. Antimicrob Agents Chemother. 1995;39(12): Harwick HJ, Kalmanson GM, Guze LB. Human diseases associated with Mycoplasms With an appendix on simple culture techniques. Calif Med. 1972;116(5): Denny FW, Clyde WA Jr, Glezen WP. Mycoplasma pneumoniae disease: clinical spectrum, pathophysiology, epidemiology, and control. J Infect Dis. 1971;123(1): Adam D. Clinical use of the new macrolides, azalides, and streptogramins in pediatrics. J Chemother. 1992;4(6): Matsubara K, Morozumi M, Okada T, et al. A comparative clinical study of macrolide-sensitive and macrolide-resistant Mycoplasma pneumoniae infections in pediatric patients. J Infect Chemother. 2009;15(6): Okazaki N, Ohya H, Sasaki T. Mycoplasma pneumoniae isolated from patients with respiratory infection in Kanagawa Prefecture in : emergence of macrolide-resistant strains. Jpn J Infect Dis. 2007;60(5): Morozumi M, Iwata S, Hasegawa K, et al. Increased macrolide resistance of Mycoplasma pneumoniae in pediatric patients with community-acquired pneumonia. Antimicrob Agents Chemother. 2008;52(1): Wilson DN, Harms JM, Nierhaus KH, et al. Species-specific antibiotic-ribosome interactions: implications for drug development. Biol Chem. 2005;386(12): Ungureanu V. Macrolides, lincosamides, streptogramines (MLS): mechanisms of action and resistance [in Romanian]. Bacteriol Virusol Parazitol Epidemiol. 2010;55(2): Wang RS, Wang SY, Hsieh KS, et al. Necrotizing pneumonitis caused by Mycoplasma pneumoniae in pediatric patients: report of five cases and review of literature. Pediatr Infect Dis J. 2004;23(6): Lab Medicine Winter 2013 Volume 44, Number 1