Study on Serotype and Apx Toxins Type of Actinobacillus pleuropneumoniae Strains Isolated from Shandong Province

Transcription

1 2005,38(11): Scientia Agricultura Sinica Apx : 85 APP PCR APX 20 5 APP APP PCR APP 4 (Apx) APP Apx 5 Apx 7 20 APP APP 99.5 ~100 APP Apx 5 APP PCR : Study on Serotype and Apx Toxins Type of Actinobacillus pleuropneumoniae Strains Isolated from Shandong Province DIAO You-xiang DING Jia-bo JIANG Shi-jin CHEN Ben-long CUI Zhi-zhong (College of Animal Science and Technology, Shandong Agricultural University, Taian ) Abstract: Twenty field strains of Actinobacillus pleuropneumoniae (APP) were isolated from lung, tonsils and trachea in 85 pigs with sever pleuropneumonia in different districts of Shandong Province. Slide agglutination test and PCR were used to determine their serotype and Apx toxins type, respectively. The results of slideagglutination test indicated that there were 5 serotypes among the 20 field strains, serotype 7(6/20) and serotype 5 (5/20) were the dominant, the other serotypes were serotype 3(4/20), serotype 4(3/20) and serotype 8(2/20). The PCR results indicated that there were four kinds of Apx toxins in the 20 field strains among them serotype 3, 4, 8 contain, and serotype 5 contains, and, serotype 7 contains and, and existed in all the 20 field strains. The results of Apx sequence analysis indicated that the homogeneity of Apx gene was 99.5% 100% in different serotype APP if they had the same type of Apx. The pathogenicity was different when mice inoculated with APP which contain different Apx, serotype 5 APP was very virulent, for it contains ApxI and. This study has established the foundation for control Porcine infectious pleuropneumonia in immune prevention, subunit vaccine and PCR diagnosis based on gene. Key words: Actinobacillus pleuropneumoniae; Porcine infectious Pleuropneumonia; Serotype; Apx toxin type (porcine infectious pleuro- pleuropneumoniae; APP ) pneumonia) (Actinobacillus yxdiao@163.com Tel/Fax: zzcui@sdau.edu.cn

2 [1] PCR (Eppendorf ) NAD Biorad DNA NAD ( ) TaqDNA (5 NAD l -1 ) NTP MgCl 2 10 buffer 12 NAD 5 a b [2] 12 APP APP ( f4 H226 HS86 HS8 HS7 HS1 HS2 HS57 HS111 HS114 HS115 HS116) 3 6 [3] APP SDTA1.99 SDWf1.01 SDLY1.01 Actinbacillus SDJN2.02 SDHZ1.00 pleuropneumoniae-rtx [4] APP ApxI Apx APP 12 5 Apx APP mmol L -1 NAD 5% LB 37 4 Apx h r/min 10 min Apx /ml 0.3% Apx [5] h APP APP Apx APP Apx APP PCR GenBank 1 Apx 1 Apx PCR Table 1 Primers used in PCR to amplify specific fragments from Apx genes of the isolated APP Apx Apx gene Sequence (sense antisense) 5 ATGGCTAACTCTCAGCTCGA 3 5 CACTAACTAAAGCTGCTACC 3 5 GGGAGACTCTTTTATGTC 3 5 GGTTGTTACAGAAGCATC 3 5 GCATGTTAGCCGACTTA 3 5 CAACTAATGCACCTGCCA 3 5 CCGGCAACGACAGTAAGATT 3 5 TTTTAACGGCGGGCAAT 3 Primer location bp Size of amplified products

3 11 Apx TG1 DNA star mmol L -1 NAD 5% LB h r/min 10 min /ml ml 5 mmol L -1 2 NAD 5% LB 10% CO h LB 24 h 0.5 mm ; 3 4 d 3 4 mm 5 mmol L -1 NAD 5% LB h r/min min /ml 0.3% h µm µm APP mmol L -1 NAD 10% 20 CO [7] V-P DNA M.R 5 mmol L -1 NAD LB LB 2 PCR 50 l PCR 37.5 µl 5 µl Mg ++ buffer 4 µl 2 mmol L -1 NTP 5 µmol L µl aq 0.5 µl DNA 0.5 µl 94 5 min 94 1 min 58 1 min 30 s 72 1 min 40 s min NAD PCR % % % % 3 PCR PCR % 2.5 Apx DNA DNA PCR PCR APP Apx PCR pmd-18-t 2 Apx PCR 1

4 APP Apx Table 2 The relationships between App serotypes and Apx toxin types Serotype Apx Type of Apx 3 Serotype 3 4 Serotype 4 5 Serotype 5 ApxI 7 Serotype 7 8 Serotype 8 M Marker (DL2 000) M: Marker (DL2 000); 1-4, , and were serotype 3, 4, 5, 7 and 8 of Actinobacillus pleuropneumoniae isolated strains respectively; 21 and 22 was serotype 7 and serotype 5 reference strain of Actinobacillus pleuropneumoniae respectively; 23. Escherichia coli; 24. Samonella typhi ApxI, II, IV PCR Fig. The PCR products of ApxI, II, and IV of different serotypes of Actinobacillus pleuropneumoniae isolated strains 12 h 2.6 DNA star 20 APP h APP 99.5% 100% 2.7 APP

5 11 Apx 2353 APP APP 3 3 APP Table 3 The reactions of mice inoculated with different serotype APP APP APP serotype 3 Serotype 3 4 Serotype 4 5 Serotype5 7 Serotype 7 8 Serotype 8 (h) 24 h ( ) Dying time post APP inoculation The died number in 24 hours Anatomical change 20 2 Liver swelling and lung slight bleeding 20 2 Liver swelling and lung slight bleeding 12 5 Lung severe bleeding and liver swelling 12 3 lung bleeding and Liver swelling various size necrosis node on the surface of liver 20 1 Liver swelling and lung slight bleeding 3 APP 4 Apx APP ApxI ApxII APP ApxII ApxIII Apx APP Apx ApxI Apx 7 12 ApxII % APP [11] % [12] [8] APP K.Min 100 APP APP [9] Apx Apx [10] 17 Apx PCR ELISA 20 7 [13] 5 APP Apx 30% 25% Apx I ApxII APP ApxIII ApxII 5 APP APP ApxII 7 APP APP ApxIII APP 3.2 APP 7 APP

6 [6] : :, Chen T S. Production and Application of Microbial Culture. Beijing: China Agricultural Press, 1995: (in Chinese) [7] : Apx [8]. APP Breeding, 2001, (1): (in Chinese) Translated by Yan Z Y, Wang H L. Short Protocols in Molecular Biology. Beijing: China Science Press, 1999: 39. (in Chinese)., 2001, (1): Zhang L C. Advance in porcine infectious pleuropneumonia. Pig [9] Min K, Chae C. Serotype and apx genotype profiles of Actinbacillus References pleuropneumoniae field isolates in Korea. The Veterinary Record, [1]. ( ). : 1999, 145(9): Translated by Zhao D M, Zhang Z Q, Shen J Z. Diseases of Swine (8th edition). Beijing: China Agricultural University Press, 2000: (in Chinese) [2] Gram T, Ahrens P. Improved diagnostic PCR assay for Actinobacillus pleuropneumoniae based on the nucleotide sequence of an outer membrane lipoprotein. Journal of Clinical Microbiology, 1998, 36: [3] Tascon R L, Vazquez-Bolend J A, Gutierrez-Martin C B, Rodriquez-Barbosa I, Rodriguez-Ferri E F. The RTX haemolysins APX and APX are major virulence factors of the swine pathogen Actinbacillus pleuropneumoniae: evidence from mutational analysis. Molecular Microbiology, 1994, 14 (2 ) : [10],,,.., 2001, 5(31): Lu Z X, Liu J S, Zhao P, Li B Y. Detection of antibodies against Actinbacillus pleuropneumoniae. Chinese Journal of Veterinary Science and Technology, 2001, 5(31): (in Chinese) [11] Frey J, Bosse J T, Chang Y F, Cullen J M, Fenwick B, Gerlach G F, Gygi D, Haesebrouck F, Inzana T J, Jansen R. Actinbacillus pleuropneumoniae-rtx-toxin: uniform designation of haemolysins, cytolysins, pleurotoxin and their genes. Journal of General Microbiology, 1993, 139: [12] Kamp E M, Popma J K, Anakotta J, Smits M A. Identification of haemolytic and cytotoxic proteins of Actinbacillus pleuropneumoniae by use of monoclonal antibodies. Infection and [4]. Immunity, 1991, 59(9): , 2001, (1 ): Wang C L, Yang X F, Liu J. Advances in pathogenicity of major virulence factors of Actinbacillus pleuropneumoniae and there immunogenicity. Advances in Preventive Veterinary Medicine, 2001, (1): (in Chinese) [5] Kamp E M, Popma J K, Anakotta J, Smits M A. Identification of hemolytic and cytotoxic proteins of Actinbacillus pleuropneumoniae [13],,,,,,,. ELISA. 2004, 37(1): Liu J J, He Q G, Chen H C, Wu B, Xu X J, Liu J F, Tang X C, Bei W C. Cloning, expression and establishment of the ELISA detection method of the apx CA gene of Actinbacillus pleuropneumoniae. Scientia Agricultura Sinica, 2004, 37(1): (in Chinese) by use of monoclonal antibodies. Infection and Immunity, 1991, 59 (9): ( )