Increased amounts of the influenza virus nucleoprotein do not promote higher levels of viral genome replication

Transcription

1 Journal of General Virology (2004), 85, DOI /vir Increased amounts of the influenza virus nucleoprotein do not promote higher levels of viral genome replication Anne E. Mullin,3 Rosa M. Dalton, Maria Joao Amorim, Debra Elton and Paul Digard Correspondence Paul Digard Received 11 August 2004 Accepted 15 September 2004 Division of Virology, Department of Pathology, University of Cambridge, Tennis Court Road, Cambridge CB2 1QP, UK Influenza virus genome replication requires the virus-encoded nucleoprotein (NP), partly because it is necessary to encapsidate the viral genomic RNA () and antigenomic crna segments into ribonucleoproteins (RNPs). However, there is also evidence that NP actively regulates viral RNA synthesis and there is a long-standing hypothesis that increased concentrations of NP in the cell are responsible for a switch from genome transcription to replication. Here, this hypothesis is tested in a recombinant setting and in the context of virus infection. In a plasmid-based system for reconstituting active viral RNPs in cells, titration of increasing amounts of NP did not promote higher levels of genome replication relative to transcription, but in fact caused the opposite effect. An approximately fourfold reduction in the ratio of genomic and antigenomic RNAs to mrna was seen across an 80-fold range of NP plasmid concentrations. When cells were transfected with the same amounts of NP plasmid to establish a concentration gradient of NP prior to virus superinfection, no change in the ratio of crna to mrna was seen for segments 5 and 7, or for the ratio of segment 5 to mrna. A slight reduction in the ratio of segment 7 to mrna was seen. These findings do not support the simple hypothesis that increased intracellular concentrations of NP promote influenza virus genome replication. INTRODUCTION The influenza A virus genome consists of eight singlestranded, negative-sense viral genomic RNA () segments that associate with the viral polymerase complex (PB1, PB2 and PA) and nucleoprotein (NP) to form ribonucleoproteins (RNPs) (reviewed by Portela & Digard, 2002). After entry into the nucleus of an infected cell (Herz et al., 1981), these segments act as templates to direct the synthesis of two types of positive-sense RNA (reviewed by Elton et al., 2002). First, mrna is synthesized through a primer-dependent process in which 59-capped RNA fragments of nt are cleaved from host-cell pre-mrnas and used to prime virus transcription (Plotch et al., 1981). These transcripts are polyadenylated at their 39 ends when the viral polymerase stutters over a polyuridine stretch that is found nt from the 59 end of the (Hay et al., 1977a; Robertson et al., 1981; Poon et al., 1998). The resulting transcripts, containing 59 and 39 modifications, are imperfect copies of their templates. As such, they cannot serve as substrates to replicate further molecules. Replication of the viral genome is achieved 3Present address: British Columbia Research Institute, 950 West 28th Avenue, Rm 318, Vancouver BC, Canada, V5Z 4H4. through primer-independent synthesis of a full-length, positive-sense replicative intermediate, crna, that is not polyadenylated (Hay et al., 1982). Whilst the molecular details of viral mrna synthesis have been described relatively well, the mechanisms by which crna is synthesized and the balance between viral transcription and genome replication is regulated remain unclear (reviewed by Elton et al., 2002). In vitro lysis of purified virus releases transcriptionally competent RNPs that, given the appropriate substrates, synthesize capped and polyadenylated mrnas (Plotch & Krug, 1977; Plotch et al., 1981). However, the same RNPs do not synthesize crna except in the context of an infected cell and then only after a round of mrna transcription and subsequent protein expression (Hay et al., 1977b; Skorko et al., 1991). Whilst it is possible that cellular factors are neccesary to render the input RNPs competent for replication and candidate proteins have been identified (Momose et al., 2001, 2002), definitive proof of such a mechanism is lacking. However, it is well-established that the viral NP is essential for genome synthesis. Several NP temperature-sensitive (ts) mutants have been isolated that are defective for replicative transcription at the nonpermissive temperature (reviewed by Portela & Digard, G 2004 SGM Printed in Great Britain 3689

2 A. E. Mullin and others 2002) and some deliberate NP mutations affect genome replication and mrna transcription differentially (Mena et al., 1999). Furthermore, several studies have shown that, in contrast to detergent-disrupted virus, nuclear extracts from infected cells catalyse both viral mrna synthesis and genome replication (Beaton & Krug, 1984; del Rio et al., 1985; Takeuchi et al., 1987). Depletion of the fraction of NP that is not already bound into RNPs from these extracts abolishes both c- and synthesis (Beaton & Krug, 1986; Shapiro & Krug, 1988). Nevertheless, the reasons that NP is required for genome replication remain uncertain. Both v- and crna are encapsidated to form functional RNPs (Pons, 1971; Hay et al., 1977b), so this provides part of the explanation (Shapiro & Krug, 1988). Functional analysis of two ts NP mutants that are specifically defective for genome replication supports this hypothesis, because both mutants lose the ability to bind RNA at the non-permissive temperature (Medcalf et al., 1999). However, NP may also play a direct regulatory role in controlling genome replication. Such a role would be particularly likely for positivestrand RNA synthesis, where two types of RNA, differing in their mode of transcription initiation and termination, are made from the same template. One possibility is that newly synthesized NP alters the structure of the RNA promoter sequences found at the termini of each genome segment, thereby biasing the polymerase towards replicative transcription (Hsu et al., 1987; Fodor et al., 1994; Klumpp et al., 1997). Alternatively, NP might exert such an effect by direct protein protein interactions with the PB1 and/or PB2 subunits of the RNA polymerase (Biswas et al., 1998; Medcalf et al., 1999; Poole et al., 2004). Irrespective of the possible mechanisms by which NP may control viral replicative transcription, there is a longstanding hypothesis that its intracellular concentration is important. It is proposed that, at low NP levels, mrna transcription is favoured, but as translation of these messages proceeds and NP concentration rises, the balance of RNA synthesis tips towards genome replication. Experimental evidence supporting this scheme has been found in non-segmented, negative-strand virus systems (Blumberg et al., 1981; Arnheiter et al., 1985). Although the absence of functional NP clearly precludes genome replication, this hypothesis has not been tested directly for influenza virus. Here, we show that, contrary to this hypothesis, variation of intracellular NP levels in a purely recombinant setting and in the context of virus infection does not lead to higher levels of replicative transcription, but instead causes a slight decrease in genomic RNA accumulation. METHODS Cells, virus, plasmids and antibodies. Human embryonic kidney 293T cells were cultured in Dulbecco s modified Eagle s medium supplemented with L-glutamine, penicillin, streptomycin and 10 % fetal calf serum (FCS). Influenza virus strain A/PR/8/34 (PR8) was propagated in 10-day-old embryonated eggs as described previously (Elton et al., 2001). Infections were carried out at an m.o.i. of 5. Plasmids pcdna-pb2, -PB1 and -PA were created by ligation of fragments excised from papr102, papr206 and papr303 (Young et al., 1983) with BamHI, HindIII or EcoRI, respectively, into similarly linearized pcdna3. Construction of plasmid pcdna-np is described elsewhere (Carrasco et al., 2004). ppoli(2)ns.cat.rt, containing an antisense chloramphenicol acetyltransferase (CAT) gene flanked by the non-coding sequences of influenza A/WSN/33 virus segment 8, under control of a human RNA polymerase I promoter (Pol-I) and upstream of a hepatitis d ribozyme sequence, was generously provided by Ervin Fodor (University of Oxford) and is described elsewhere (Pleschka et al., 1996; Fodor et al., 2002). A positive-sense CAT reporter [ppol-i(+)ns.cat] was constructed similarly by PCR amplification from ppoli(2)ns.cat.rt using primers PD211 (59-GCATGCTC- TTCTATTAGCAAAAGCAGGGTGAC-39) and PD212 (59-GCATG- CTCTTCGGCCAGTAGAAACAAGGGTG-39). PCR products were digested with SapI and ligated into the vector ppoli.sapi.rib, kindly provided by Ervin Fodor. Plasmids pt7(+)ns.cat and pt7(2)ns.cat contained positive- and negative-sense CAT gene sequences flanked by non-coding sequences from influenza A virus segment 8, under control of a T7 promoter in a puc19 background. The sequences were amplified from the appropriate ppol-i.ns.cat constructs by PCR using primers PD237 (59-GCGCAAGCTTA- ATACGACTCACTATAAGTAGAAACAAGGGTG-39) and PD238 (59-GGCTCTAGACGCTCGAGAGCAAAAGCAGGGTGAC-39) for pt7(2)ns.cat and PD213 (59-GCGCAAGCTTAATACGACTCA- CTATAAGCAAAAGCAGGGTGAC-39) and PD214 (59-GGCTCTA- GACGCTCGAGAGTAGAAACAAGGGTG-39) for pt7(+)ns.cat. The products were digested by HindIII and XbaI and cloned into similarly digested puc19. Digestion of these plasmids with HgaI allowed T7 in vitro transcription of an RNA with the correct 39 and 59 termini. Rabbit polyclonal antisera to influenza A virus RNP have been described previously (Mahy et al., 1977). Anti-PR8 PB2 sera were prepared by immunizing rabbits with the fusion protein MBP PB2-C (Poole et al., 2004). Antiserum against human Nup62 was purchased from Transduction Laboratories, anti-rabbit IgG antibody conjugated to fluorescein isothiocyanate from DAKO A/S and Alexa 594- conjugated anti-mouse IgG antibodies from Molecular Probes. Influenza virus gene-expression assay cells per 35 mm well in 1 ml complete medium were transfected in suspension with plasmid DNA by using cationic liposomes (Lipofectin; Gibco-BRL). To reconstitute RNPs, 0?25 mg each of pcdna-pb1, -PB2 and -PA and 50 ng of either ppol-i(+)ns.cat or ppol-i(2)ns.cat were transfected with varying amounts of pcdna-np. The total amount of DNA in each transfection mix was normalized by the addition of pcdna3 vector. Optimal amounts of plasmids other than pcdna- NP were established by separate titration experiments (data not shown). Following incubation at 37 uc for 3 days, CAT accumulation was quantified by a commercial ELISA (Roche Diagnostics). Primer-extension analysis of viral RNA. Total cellular RNA was isolated by using a commercial kit (SV Total RNA Isolation System; Promega) according to the manufacturer s instructions. After spectrophotometric quantification and normalization, RNA (1?5 mg) was reverse-transcribed by using avian myeloblastosis virus reverse transcriptase (Promega) and 0?4 pmol each of the appropriate DNA oligonucleotides that had been 59 end-labelled with [c- 32 P]ATP. Following 30 min incubation at 42 uc, samples were heated to 90 uc for 10 min and separated by 6 % urea-page. Radiolabelled products were detected by autoradiography and quantified by densitometry using NIH Image software ( The oligonucleotides used were 59-GGCGATTCAGGTTCATCATGC- CG-39 (for detection of -sense CAT transcripts), 59-ATGT- TCTTTACGATGCGATTGGG-39 (positive-sense CAT transcripts), 59-CGTCCAATTCCACCAATC-39 (positive-sense segment 5), 3690 Journal of General Virology 85

3 Influenza virus NP and genome replication 59-GTCTTCGAGCTCTCGGACG-39 (segment 5 ), 59-TCAA- GTCTCGGTGCGATCTCG-39 (positive-sense segment 7) and 59- ACCGTCGCTTTAAATACGG-39 (segment 7 ). The predicted size of primer-extension product for each oligonucleotide was validated by comparison with matching DNA sequencing ladders (CAT; see Results section, segments 5 and 7; data not shown). Primers were designed so that the reverse-transcription products from m-, c- and were distinguishable by gel electrophoresis. Preliminary experiments established that simultaneous detection of positive- and negative-sense RNA species gave equivalent results to separate reactions carried out with individual primers (data not shown). (a) (i) crna 12 ng pcdna-np V NP Protein analyses. For Western blots, cell lysates were separated by 10 % SDS-PAGE and transferred to nitrocellulose. Blots were probed with primary followed by secondary antibodies conjugated to horseradish peroxidase (DAKO) and developed by chemiluminescence (ECL reagent; Amersham Biosciences). For immunofluorescence, subconfluent cells on glass coverslips were fixed with PBS containing 4 % formaldehyde for 20 min and washed in PBS containing 2 % FCS. Cells were permeabilized with 0?2 % Triton X-100 before incubation with primary antibodies, followed by fluorophore-conjugated secondary antibodies in PBS/FCS. Coverslips were mounted in Citifluor (Agar Scientific) and examined under a Leica TCS NT confocal microscope. RESULTS Effect of NP concentration on RNA synthesis by recombinant RNPs To test the hypothesis that an increase in NP expression causes a switch from genome transcription to replication, we first utilized a recombinant system that recreates functional influenza virus RNPs by transfecting cells with plasmids that separately express the three polymerase proteins, NP and a model v- or crna segment containing a CAT gene (Huang et al., 1990; Fodor et al., 2002). 293T cells were transfected with plasmid mixtures containing increasing amounts of the pcdna-np plasmid and constant amounts of pcdna-pb1, -PB2 and -PA and plasmids that expressed CAT v- or crna. After 3 days, cell lysates were analysed by Western blotting with anti-np serum to determine whether the amount of NP expressed in the cells was proportional to the amount of transfected pcdna-np. No reactivity was detected in samples from cells that were not transfected with pcdna-np (Fig. 1a, lanes 7). Otherwise, a polypeptide with the same electrophoretic mobility as NP from purified virus was detected (at the exposure shown) from all cells transfected with >111 ng pcdna-np (Fig. 1a, lanes 4 6, 8). NP accumulation increased in proportion to the dose of plasmid and was essentially the same whether the genome segment supplied was crna- or -sense (Fig. 1a). Furthermore, the expression levels of other RNP components were largely unaffected by co-expression of increasing amounts of NP, except at the very highest doses (3 mg) of pcdna-np (PB2, Fig. 1b; PB1, data not shown). We also compared the amounts of NP expressed in the recombinant system with that of authentic virus infection, finding that NP was detected in similar amounts in lysates from cells transfected (ii) (b) (c) V _PB V trans h p.i. _ + M with 250 ng pcdna-np and from infected cells harvested between 4 and 8 h post-infection (p.i.) (Fig. 1c, compare lane 3 with lanes 5 7). Therefore, the recombinant system for reconstituting RNPs in cells permits the expression of a wide range of NP concentrations that, in the middle of the range, are comparable to those found in infected cells. Next, we examined the effect of NP levels on virus-directed gene expression in the transfection system by quantifying CAT accumulation as a marker of mrna transcription. CAT expression was detected above the background level that was seen in the absence of NP even with the lowest NP NP PB2 Fig. 1. Accumulation of viral proteins in transfected and infected cells. (a, b) Cells were transfected with plasmids expressing the three P proteins, a model crna [a(i)] or [a(ii), b] and the indicated amounts of pcdna-np. Lysates were prepared at 3 days post-transfection and analysed by SDS- PAGE and Western blotting with antisera against (a) NP or (b) PB2. (c) NP Western blot analysis was carried out on cells that had been transfected (+) or mock-transfected ( ) with 250 ng pcdna-np and harvested at 72 h, or mock-infected (M) or infected with virus and harvested at the indicated times p.i. Analysis of parallel samples by immunofluorescence indicated that approximately one-third of cells were transfected successfully and that virtually all cells were infected (data not shown). Samples of purified virus (V) were analysed in parallel to provide markers for NP and PB

4 A. E. Mullin and others dose of NP plasmid, irrespective of whether the model genome segment supplied was positive-sense (therefore requiring genome replication before mrna transcription) or negative-sense (allowing direct transcription) (Fig. 2a). Transfection of higher amounts of pcdna-np initially caused a steep rise in CAT accumulation, which reached a plateau with plasmid doses of around 0?3 1?0 mg per transfection for reactions primed with either v- or crna molecules. Further increases in the amount of NP plasmid transfected caused a decrease in viral gene expression with input model viral genomes of both senses (Fig. 2a). The hypothesis that increased levels of NP promote genome replication suggests that the decrease in virus gene expression observed at high concentrations of NP could have resulted from an increase in c- and/or synthesis, at the expense of transcription. To test this, we first validated an assay to examine virus-specific RNA synthesis directly. Total RNA was extracted from cells transfected with plasmids expressing the -sense CAT segment and the three P proteins, but with or without pcdna-np. Positive-sense CAT RNA was then analysed by a reverse transcriptase primer-extension assay. No products were observed from cells that were not transfected with the NP plasmid (Fig. 3a, lane 7), but two classes of primer-extended transcripts were seen from RNA from cells expressing all four RNP polypeptides. These were a smaller unique species and a larger heterogeneous family of at least four or five products, differing by 1 nt (Fig. 3a, lane 4). The unique transcript co-migrated with a primer-extension product that was produced from a synthetic crna molecule transcribed in vitro from plasmid pt7(+)ns.cat (compare lanes 1 and 4). Furthermore, reference to a DNA sequencing ladder derived from pt7(+)ns.cat using the same oligonucleotide as the primer-extension reaction (lanes 4 and T, G, C, A) showed that the smaller product was the predicted size for the 59 end of crna. The primerextension products were seen to be some 9 13 nt longer than the shorter species, consistent with the presence of host-cell pre-mrna-derived, 59-capped RNA extensions (Plotch et al., 1981). Thus, the 59 ends of the two classes of positive-sense CAT RNA detected by this system are consistent with their formation from crna and mrna. To test this further, we examined the 39 ends of the transcripts by poly(a) selection. Again, no products were detected from RNA from cells lacking an NP gene (Fig. 3a, lanes 5 and 6). Of the CAT-specific transcripts detected from cells containing functional viral RNPs, the larger products were mostly present in the poly(a) fraction (lane 2), whereas the smaller species was not polyadenylated (lane 3), confirming their identities as mrna- and crna-derived products, respectively. Densitometric quantification of replicate experiments indicated that the crna-derived species represented approximately 5 10 % of the total positive-sense RNA (data not shown), in agreement with values measured for infected cells (Hay et al., 1977b; Barrett et al., 1979; Herz et al., 1981). Similar primer-extension analyses carried out with a primer complementary to negative-sense CAT RNA confirmed its ability to detect (data not shown, but see Fig. 3b). Fig. 2. Quantitative analysis of the effect of NP titration on viral gene expression and c- and synthesis. Cells were transfected with plasmids expressing the three P proteins, a model crna (#) or (&) segment containing a CAT gene and the plotted amounts of pcdna-np. Samples were harvested at 72 h post-transfection. (a) CAT polypeptide accumulation was quantified by ELISA and calculated as a percentage of the maximum value after subtraction of the background seen in the absence of NP. Means±SD of three (crna) or four () experiments are plotted. (b, c) CAT-specific RNA extracted from parallel transfections was detected by radiolabelled primer extension and urea-page (see Fig. 3) and quantified (in arbitrary units) by densitometry of exposed X-ray film. Ratios of crna (b) and (c) to mrna for each amount of transfected pcdna-np are plotted Journal of General Virology 85

5 Influenza virus NP and genome replication (a) (b) crna NS+CAT sequence C 3P-NP 3P + _ T + _ T NP: V 0 0 C T7 Promoter 5' crna TTATACGACTCACTATAAGCAAAAGCAGGGT mrna crna T G C A Fig. 3. Analysis of viral RNA synthesis by reconstituted RNPs. RNA isolated from cells transfected with plasmids expressing the three P proteins, a model CAT (a, b) or crna (b; as labelled) and increasing amounts of pcdna-np [250 ng (a); ng (b)] was analysed by primer extension using radiolabelled oligonucleotides specific for (a) positive-sense CAT transcripts or (b) positive- and negative-sense transcripts. Radiolabelled products were separated by urea-page and detected by autoradiography. Primer-extension products resulting from the indicated CAT RNA species are labelled. (a) Total (T) RNA or RNA separated into poly(a)-positive (+) and -negative ( ) fractions was analysed, as was a synthetic CAT crna (C) that was in vitro-transcribed from plasmid pt7(+)ns.cat. A sequencing reaction derived from the same plasmid and oligonucleotide was also included on the gel (lanes TGCA). The derived sequence is indicated on the left. (b) Synthetic CAT crna (C) and [V; derived from plasmid pt7( )NS.CAT] were also subjected to primer extension as positive controls. Next, we examined the viral RNA species synthesized by recombinant RNPs across a range of NP concentrations, using both oligonucleotides to simultaneously detect m-, c- and. When NP was omitted from the transfection mix, the only detectable product was in the case of cells transfected with ppol-i(2)ns.cat, or crna for cells transfected with ppol-i(+)ns.cat (Fig. 3b, lanes 2 and 9, respectively), probably representing detection of Pol-Itranscribed virus-like RNA from the input plasmids. However, transfection of even the smallest amount of NP plasmid tested resulted in viral transcription and replication, producing detectable c-, v- and mrna (Fig. 3b, lanes 3 and 10). In broad agreement with the data obtained for CAT polypeptide accumulation, further increases in the amount of transfected NP plasmid quickly led to maximal levels of mrna synthesis that then reached a plateau or declined slightly with the highest doses of NP (Fig. 3b, lanes 4 8 and 11 15). Similarly, maximal amounts of v- and crna were produced at relatively low doses of NP plasmid (37 ng; Fig. 3b, lanes 4 and 11). However, synthesis of v- and crna then declined with higher doses of NP, to barely detectable levels at the highest concentration of plasmid tested (3 mg; Fig. 3b, lanes 8 and 15). Overall, visual inspection of the data did not favour the hypothesis that increasing concentrations of NP are associated with higher levels of genome replication; indeed, the converse appeared to be true. Confirming this, quantification of RNA levels by densitometry and plotting the ratios of crna to mrna against amount of transfected pcdna- NP revealed a shift towards synthesis of mrna, with an overall fourfold decrease in the ratio of crna to mrna with increased pcdna-np, regardless of polarity of the input viral segment (Fig. 2b). The ratio of to mrna reflected a similar fivefold trend in favour of transcription with increasing amounts of NP, again irrespective of the polarity of model viral segment introduced. The change in ratio of replicative to transcriptional products was progressive across the entire NP titration and did not occur solely at the highest doses of NP plasmid. This argues for a direct effect of increased NP concentration, rather than an indirect effect of decreased polymerase concentration. Nevertheless, it is possible that decreased expression of the polymerase at very high levels of NP also contributes to decreased genome replication. Quantification of three replicate experiments showed the same magnitude decrease in replicative synthesis compared with transcription with increased amounts of NP plasmid (data not shown). Therefore, in a recombinant setting, increased expression of NP does not promote viral genome replication, but instead leads to a transcriptional bias. It has been demonstrated previously that, when NP is expressed by itself, higher levels of expression bias it towards cytoplasmic accumulation (Digard et al., 1999; Elton et al., 2001). To determine whether the same trend was apparent in cells producing functional RNPs, parallel samples from each transfection were examined by indirect immunofluorescence for NP and Nup62, a component of the nuclear pore complex. No NP staining was detected in control cells [Fig. 4a(i)]. When pcdna-np-transfected

6 A. E. Mullin and others (a) _ pcdna-np 11 ng (b) (i) (ii) Transfected cells (%) (iii) 111 ng (iv) 3000 ng pcdna-np (ng) Fig. 4. Effect of expression levels on the cellular localization of NP. Cells transfected with plasmids expressing the three P proteins, a model CAT and the indicated amounts of pcdna-np were fixed at 72 h and analysed by confocal microscopy after staining for NP (green) and Nup62 (red). Note that Nup62 staining delineates the nuclear periphery and that 293T cells have large nuclei and relatively little cytoplasm. (a) Single optical sections through the midline of cells are shown. Photomultiplier tube settings were adjusted for individual samples, so the apparent intensity of NP staining cannot be compared between images. Bars, 10 mm. (b) At least 100 transfected cells per transfection were scored for predominantly nuclear (empty bars) or cytoplasmic (filled bars) NP staining and the percentage in each category was plotted. cells were examined 1 day post-transfection, the majority of NP was found in the nucleus at all plasmid doses tested (data not shown). At 3 days post-transfection, cells transfected with the lowest dose of NP plasmid (11 ng) showed a mixture of nuclear and cytoplasmic staining [Fig. 4a(ii)]. When replicate experiments were stained and scored for NP localization, it was found that, on average, approximately half of the transfected cells still contained nuclear NP (Fig. 4b). As the amount of transfected plasmid was raised, fewer cells contained nuclear NP until, at the very highest dose, the protein was almost exclusively cytoplasmic [Fig. 4a(iii and iv) and b]. Similar results were obtained when experiments were carried out by using a plasmid expressing CAT crna (data not shown). Therefore, NP exhibits the same dose-dependent localization pattern when expressed alone or with, PB1, PA and PB2: a shift from nuclear to cytoplasmic localization with increased NP expression. In light of the preceding experiments, this suggests that a reduction in synthesis of replicative RNA types may correlate with increased or earlier cytoplasmic localization of NP. Effect of prior NP expression on viral RNA synthesis Next, we tested whether increased levels of NP influenced genome replication in the context of virus infection. Cells were transfected with varying amounts of pcdna-np as before, incubated overnight to establish a concentration gradient of the protein and then superinfected with influenza virus and viral RNA synthesis was analysed. Pilot experiments where cells were doubly transfected with plasmids expressing NP and green fluorescent protein, infected with virus and viral gene expression was monitored by immunofluorescent staining for NS1 confirmed that prior expression of NP in a cell did not inhibit subsequent influenza virus infection (data not shown). In addition, because RNA synthesis in infected cells follows a regulated pattern in which the three classes of transcript are made at distinct times (Hay et al., 1977b; Barrett et al., 1979; Smith & Hay, 1982; Shapiro et al., 1987), we first examined normal viral RNA synthesis in our system to establish the optimal time point at which to analyse the effect of supplying extra NP. When the RNA products from segment 7 (encoding M1 and M2; representative of the late class of influenza virus genes) were analysed, mrna accumulation peaked at 4 h p.i. and then declined (Fig. 5a, lane 2). In this particular experiment, crna accumulation also reached a maximum at 4 h p.i., although, in other experiments, there was little difference visible between its levels at 2?5 and 4 h p.i. (data not shown). In contrast, accumulation increased steadily throughout the time-course, reaching a maximum at 8 h p.i. (Fig. 5a, lane 4). No significant primerextension products were observed from RNA taken from mock-infected cells (Fig. 5a, lane 5). Similar kinetics (with the time points used here) were observed for the RNA products of segment 5, encoding NP, a representative early gene (data not shown). Thus, the virus cell combination used here behaves similarly to that expected from previous analyses of viral RNA synthesis (Hay et al., 1977b; Barrett et al., 1979; Smith & Hay, 1982; Shapiro et al., 1987) Journal of General Virology 85

7 Influenza virus NP and genome replication (a) (b) (c) h p.i.: M NP: 0 M NP: 0 M pc-np mrna mrna crna mrna crna Segment 7 Segment 7 Segment 5 Fig. 5. Analysis of viral RNA synthesis in infected cells. RNA isolated from cells infected or mock-infected (M) was subjected to primer extension using radiolabelled oligonucleotides complementary to positive- or negative-sense segment 7 (a, b) or segment 5 (c) RNAs. In panel (c), the results of separate primer-extension reactions for positive- and negative-sense RNAs are shown. Radiolabelled products were separated by urea-page and detected by autoradiography. Primer-extension products resulting from the indicated RNA species are labelled. Open arrowheads indicate background products arising from cross-hybridization with cellular RNA species. (a) Time-course analysis of RNA isolated at the indicated times p.i. (b, c) Cells were transfected with increasing amounts of pcdna-np ( ng) 16 h prior to virus infection or, in one case ( ), left untransfected. RNA was isolated at 6 h p.i. Therefore, we transfected cells with varying amounts of pcdna-np and superinfected them with influenza virus after overnight incubation to allow expression of NP. RNA was isolated at 6 h p.i. (when, ordinarily, accumulation would be submaximal) and analysed by primer extension. One minor background primer-extension product was seen after reverse transcription of RNA from mock-infected cells using oligonucleotides specific for segment 7, whereas m-, c- and species were all detected from infected, but untransfected cells (Fig. 5b, lanes 7 and 8). The amounts of these products were not altered substantially by mock transfection of the cells (lane 1), nor was any clear trend observable following transfection of increasing amounts of pcdna-np (lanes 2 6). When segment 5-specific RNAs were analysed, a primer-extension product that presumably resulted from cross-hybridization with a cellular RNA was observed from all samples, independent of their prior transfection or infection (Fig. 5c). The only novel primer-extension product observed from pcdna-np transfected, but mock-infected cells corresponded to that predicted for plasmid-derived NP mrna (Fig. 5c, lane 8), whereas RNA from infected, but mock-transfected cells gave products that were diagnostic of v-, c-, and mrna (lane 1). Transfection of increasing amounts of pcdna-np led to the detection of increasing amounts of the plasmid-derived mrna species, confirming successful expression of exogenous NP mrna in the cells (Fig. 5c, lanes 2 7). However, no significant alteration in the accumulation of virus-transcribed RNA species was seen. Densitometric quantification of the ratios of the replicative RNA species to mrna from replicate experiments confirmed that the relative amount of crna from segments 5 and 7 was unaltered by prior expression of NP in the cell (Fig. 6). The ratio of segment 5 to mrna was similarly insensitive to pcdna-np transfection, whereas that of segment 7 showed an overall slight decrease (of around one-third; statistically significant at the level of P<0?02, as assessed by Student s t-test, for plasmid doses of ng) after transfection of even the smallest amount of NP plasmid (Fig. 6). However, no further decrease in the ratio of to mrna was seen with increased expression of NP. In addition, no signficant changes to viral RNA synthesis were seen when the accumulation of segment 5 or 7 species was examined at 4 h p.i. (data not shown). Overall, we find no evidence that increased levels of NP promote the synthesis of replicative RNA products in infected cells. DISCUSSION A hallmark of the replication cycle of negative-sense RNA viruses is the synthesis of shorter than unit-length mrnas from a genomic RNP. Genomes are replicated via a fulllength, positive-sense antigenome strand that also forms an RNP. In all cases analysed, the encapsidating NP is an essential component of this process. The hypothesis, first formulated for a non-segmented virus (Leppert et al., 1979; Blumberg et al., 1981; Arnheiter et al., 1985), that increasing

8 A. E. Mullin and others increases in NP expression (at levels still well below that encountered in infected cells) did indeed promote increased accumulation of c- and, but also of mrna. However, further increases in NP expression inhibited genome and antigenome accumulation. Furthermore, when the ratio of these replicative species to viral mrna was considered, a consistently negative correlation between the amount of NP and the relative amount of genome replication compared with transcription was seen, even for the lowest concentrations of NP. Fig. 6. Quantitative analysis of the effect of prior NP expression on viral RNA synthesis. Segment 5 (filled symbols) and segment 7 (open symbols)-specific RNA extracted from cells transfected with the indicated amount of pcdna-np and superinfected with virus was detected by radiolabelled primer extension and urea-page (see Fig. 5) and quantified (in arbitrary units) by densitometry of exposed X-ray film. Mean ratios±sd from three independent experiments of crna (circles) and (squares) to mrna for each amount of transfected pcdna-np are plotted. Asterisks indicate values that are significantly different (Student s t-test, P<0?02) from the untreated sample. concentrations of this NP serve to switch polymerase activity from transcription to replication has been considered to be plausible in all systems. However, where this hypothesis has been tested directly, it has not been supported. When the N or N and P proteins of respiratory syncytial virus were titrated into a transfection-based minigenome replication system, no bias towards genome replication was seen at higher protein concentrations (Fearns et al., 1997). Similarly, no significant alteration to the balance between transcription and replication was seen when analogous experiments were carried out using transfected components of the arenavirus lymphocytic choriomenigitis virus (Pinschewer et al., 2003). Here, we tested the hypothesis that the concentration of the influenza virus NP influences the balance between transcription and replication of the virus genome. This was found not to be the case, either in a purely recombinant setting where RNPs were recreated in plasmid-transfected cells or in the context of virus infection. In the recombinant system, initial Although plasmid-based systems for reconstituting RNPs have been used widely to study influenza virus RNA synthesis, they probably do not reproduce all facets of authentic virus transcription, particularly with regard to its temporal regulation. During virus infection, crna is only synthesized at early times p.i., following which and mrna amplification occurs. Whilst synthesis continues later in infection, mrna transcription peaks and then declines (Fig. 5a; Hay et al., 1977b; Barrett et al., 1979; Smith & Hay, 1982; Shapiro et al., 1987). In contrast, time-course experiments analysing viral RNA synthesis in the recombinant system used here show no evidence of any such synthetic cascade, with the amounts of all three RNA species simply increasing over time (data not shown). However, like authentic virus infection, crna remains a relatively low-abundance species. As such, the system can be considered to be a partially deregulated model of viral transcription, which perhaps lessens the confidence that we can place in our finding that increased concentrations of NP do not stimulate genome replication. However, consistent results were obtained from infected cells that were manipulated to contain varying amounts of NP prior to virus inoculation. No significant alteration was seen in the overall amounts of crna for segments 5 and 7, or segment 5. Prior expression of NP did cause a slight alteration in the ratio of segment 7 to mrna but, as with the recombinant CAT segment, this was a decrease, rather than an increase. The infection system relies on transfection of the cells with an NP-expressing plasmid before subsequent virus infection. Although virtually every cell would be expected to be infected, the same would not be true of transfection, leading to a background of virus transcription taking place in the absence of extra NP. Accordingly, we monitored transfection efficiencies by immunofluorescence to establish the size of this background, finding that approximately one-third of cells were transfected successfully (data not shown). Statistical analysis of the densitometry data suggests that an overall twofold change in the ratio of genome or antigenomic RNAs to mrna would be detected reliably, because the less than twofold change in ratio of segment 7 to mrna was partially statistically significant. Therefore, for a constant amount of mrna, a fourfold change in v- or crna accumulation would be required in the transfected cells to achieve an overall twofold increase in the ratio of genomic or antigenomic RNA species to mrna. As the only change seen was a minor decrease in the relative amount of segment 7, we can exclude 3696 Journal of General Virology 85

9 Influenza virus NP and genome replication any major (greater than fourfold) stimulatory effect of increased NP expression on virus genome replication. If the relative rate of genome replication is not directly proportional to the intracellular concentration of NP, then what explains the clear necessity for NP for replicative RNA synthesis? One model is that other factors (e.g. the polymerase and/or cellular factors) regulate RNA synthesis, keeping mrna as the predominant positive-sense RNA. NP is nonetheless an essential cofactor, because of a requirement for co-transcriptional encapsidation of nascent c- and segments. This model is consistent with the heterogeneous size of short products that are synthesized by infected-cell extracts depleted of NP (Shapiro & Krug, 1988) and the finding that ts NP mutants that are specifically defective for replicative transcription lose RNAbinding activity at the elevated temperature (Medcalf et al., 1999). It is also consistent with the observation that NP is not required in vitro for unprimed transcription initiation (Lee et al., 2002). Indeed, these findings and our current data are consistent with a recent study (published while this manuscript was under review) that suggests that there is no switch mechanism regulating crna synthesis and that the requirement for protein synthesis during genome replication reflects degradation of naked crna that is not protected by encapsidation into an RNP (Vreede et al., 2004). On the other hand, identification of NP mutations that affect v- and crna synthesis differentially is highly suggestive of a direct regulatory role for the protein (Thierry & Danos, 1982; Markushin & Ghendon, 1984; Mena et al., 1999). This regulation could be exerted through NP polymerase interactions (Biswas et al., 1998; Mena et al., 1999; Medcalf et al., 1999; Poole et al., 2004) or through NP-mediated modification of the panhandle promoter structure (Fodor et al., 1994; Klumpp et al., 1997; Lee et al., 2003). To be consistent with the findings reported here, one would have to postulate that only small amounts of NP are required to enable replicative synthesis and that some other factor prevents crna synthesis from rising above 5 10 % of positive-sense transcription. ACKNOWLEDGEMENTS We thank Ervin Fodor for discussion and reagents. This work was supported by grants from the Royal Society, Wellcome Trust (nos and ) and Medical Research Council (no. G ) to P. D. A. E. M. was partially supported by a grant from the Cambridge Commonwealth Trust and the Gywnneth Pretty studentship from the Department of Pathology. M. J. A. is supported by the Gulbenkian PhD programme in Biomedicine and the Fundação para a Ciência e a Tecnologia, Portugal. REFERENCES Arnheiter, H., Davis, N. L., Wertz, G., Schubert, M. & Lazzarini, R. A. (1985). Role of the nucleocapsid protein in regulating vesicular stomatitis virus RNA synthesis. Cell 41, Barrett, T., Wolstenholme, A. J. & Mahy, B. W. J. (1979). Transcription and replication of influenza virus RNA. Virology 98, Beaton, A. R. & Krug, R. M. (1984). Synthesis of the templates for influenza virion RNA replication in vitro. Proc Natl Acad Sci U S A 81, Beaton, A. R. & Krug, R. M. (1986). Transcription antitermination during influenza viral template RNA synthesis requires the nucleocapsid protein and the absence of a 59 capped end. Proc Natl Acad SciUSA83, Biswas, S. K., Boutz, P. L. & Nayak, D. P. (1998). Influenza virus nucleoprotein interacts with influenza virus polymerase proteins. J Virol 72, Blumberg, B. M., Leppert, M. & Kolakofsky, D. (1981). Interaction of VSV leader RNA and nucleocapsid protein may control VSV genome replication. Cell 23, Carrasco, M., Amorim, M. J. & Digard, P. (2004). Lipid raftdependent targeting of the influenza A virus nucleoprotein to the apical plasma membrane. Traffic (in press). doi: /j x del Rio, L., Martinez, C., Domingo, E. & Ortín, J. (1985). In vitro synthesis of full-length influenza virus complementary RNA. EMBO J 4, Digard, P., Elton, D., Bishop, K., Medcalf, E., Weeds, A. & Pope, B. (1999). Modulation of nuclear localization of the influenza virus nucleoprotein through interaction with actin filaments. J Virol 73, Elton, D., Simpson-Holley, M., Archer, K., Medcalf, L., Hallam, R., McCauley, J. & Digard, P. (2001). Interaction of the influenza virus nucleoprotein with the cellular CRM1-mediated nuclear export pathway. J Virol 75, Elton, D., Tiley, L. & Digard, P. (2002). Molecular mechanisms of influenza virus transcription. Recent Res Dev Virol 4, Fearns, R., Peeples, M. E. & Collins, P. L. (1997). Increased expression of the N protein of respiratory syncytial virus stimulates minigenome replication but does not alter the balance between the synthesis of mrna and antigenome. Virology 236, Fodor, E., Pritlove, D. C. & Brownlee, G. G. (1994). The influenza virus panhandle is involved in the initiation of transcription. J Virol 68, Fodor, E., Crow, M., Mingay, L. J., Deng, T., Sharps, J., Fechter, P. & Brownlee, G. G. (2002). A single amino acid mutation in the PA subunit of the influenza virus RNA polymerase inhibits endonucleolytic cleavage of capped RNAs. J Virol 76, Hay, A. J., Abraham, G., Skehel, J. J., Smith, J. C. & Fellner, P. (1977a). Influenza virus messenger RNAs are incomplete transcripts of the genome RNAs. Nucleic Acids Res 4, Hay, A. J., Lomniczi, B., Bellamy, A. R. & Skehel, J. J. (1977b). Transcription of the influenza virus genome. Virology 83, Hay, A. J., Skehel, J. J. & McCauley, J. (1982). Characterization of influenza virus RNA complete transcripts. Virology 116, Herz, C., Stavnezer, E., Krug, R. M. & Gurney, T., Jr (1981). Influenza virus, an RNA virus, synthesizes its messenger RNA in the nucleus of infected cells. Cell 26, Hsu, M.-T., Parvin, J. D., Gupta, S., Krystal, M. & Palese, P. (1987). Genomic RNAs of influenza viruses are held in a circular conformation in virions and in infected cells by a terminal panhandle. Proc Natl Acad Sci U S A 84, Huang, T.-S., Palese, P. & Krystal, M. (1990). Determination of influenza virus proteins required for genome replication. J Virol 64, Klumpp, K., Ruigrok, R. W. H. & Baudin, F. (1997). Roles of the influenza virus polymerase and nucleoprotein in forming a functional RNP structure. EMBO J 16,

10 A. E. Mullin and others Lee, M. T. M., Bishop, K., Medcalf, L., Elton, D., Digard, P. & Tiley, L. (2002). Definition of the minimal viral components required for the initiation of unprimed RNA synthesis by influenza virus RNA polymerase. Nucleic Acids Res 30, Lee, M.-T. M., Klumpp, K., Digard, P. & Tiley, L. (2003). Activation of influenza virus RNA polymerase by the 59 and 39 terminal duplex of genomic RNA. Nucleic Acids Res 31, Leppert, M., Rittenhouse, L., Perrault, J., Summers, D. F. & Kolakofsky, D. (1979). Plus and minus strand leader RNAs in negative strand virus-infected cells. Cell 18, Mahy, B. W. J., Carroll, A. R., Brownson, J. M. T. & McGeoch, D. J. (1977). Block to influenza virus replication in cells preirradiated with ultraviolet light. Virology 83, Markushin, S. G. & Ghendon, Y. Z. (1984). Studies of fowl plague virus temperature-sensitive mutants with defects in synthesis of virion RNA. J Gen Virol 65, Medcalf, L., Poole, E., Elton, D. & Digard, P. (1999). Temperaturesensitive lesions in two influenza A viruses defective for replicative transcription disrupt RNA binding by the nucleoprotein. J Virol 73, Mena, I., Jambrina, E., Albo, C., Perales, B., Ortín, J., Arrese, M., Vallejo, D. & Portela, A. (1999). Mutational analysis of influenza A virus nucleoprotein: identification of mutations that affect RNA replication. J Virol 73, Momose, F., Basler, C. F., O Neill, R. E., Iwamatsu, A., Palese, P. & Nagata, K. (2001). Cellular splicing factor RAF-2p48/NPI-5/BAT1/ UAP56 interacts with the influenza virus nucleoprotein and enhances viral RNA synthesis. J Virol 75, Momose, F., Naito, T., Yano, K., Sugimoto, S., Morikawa, Y. & Nagata, K. (2002). Identification of Hsp90 as a stimulatory host factor involved in influenza virus RNA synthesis. J Biol Chem 277, Pinschewer, D. D., Perez, M. & de la Torre, J. C. (2003). Role of the virus nucleoprotein in the regulation of lymphocytic choriomeningitis virus transcription and RNA replication. J Virol 77, Pleschka, S., Jaskunas, S. R., Engelhardt, O. G., Zürcher, T., Palese, P. & García-Sastre, A. (1996). A plasmid-based reverse genetics system for influenza A virus. J Virol 70, Plotch, S. J. & Krug, R. M. (1977). Influenza virion transcriptase: synthesis in vitro of large, polyadenylic acid-containing complementary RNA. J Virol 21, Plotch, S. J., Bouloy, M., Ulmanen, I. & Krug, R. M. (1981). A unique cap(m 7 GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs to generate the primers that initiate viral RNA transcription. Cell 23, Pons, M. W. (1971). Isolation of influenza virus ribonucleoprotein from infected cells. Demonstration of the presence of negativestranded RNA in viral RNP. Virology 46, Poole, E., Elton, D., Medcalf, L. & Digard, P. (2004). Functional domains of the influenza A virus PB2 protein: identification of NP- and PB1-binding sites. Virology 321, Poon, L. L. M., Pritlove, D. C., Sharps, J. & Brownlee, G. G. (1998). The RNA polymerase of influenza virus, bound to the 59 end of virion RNA, acts in cis to polyadenylate mrna. J Virol 72, Portela, A. & Digard, P. (2002). The influenza virus nucleoprotein: a multifunctional RNA-binding protein pivotal to virus replication. J Gen Virol 83, Robertson, J. S., Schubert, M. & Lazzarini, R. A. (1981). Polyadenylation sites for influenza virus mrna. J Virol 38, Shapiro, G. I. & Krug, R. M. (1988). Influenza virus RNA replication in vitro: synthesis of viral template RNAs and virion RNAs in the absence of an added primer. J Virol 62, Shapiro, G. I., Gurney, T. & Krug, R. M. (1987). Influenza virus gene expression: control mechanisms at early and late times of infection and nuclear-cytoplasmic transport of virus-specific RNAs. J Virol 61, Skorko, R., Summers, D. F. & Galarza, J. M. (1991). Influenza A virus in vitro transcription: roles of NS 1 and NP proteins in regulating RNA synthesis. Virology 180, Smith, G. L. & Hay, A. J. (1982). Replication of the influenza virus genome. Virology 118, Takeuchi, K., Nagata, K. & Ishihama, A. (1987). In vitro synthesis of influenza viral RNA: characterization of an isolated nuclear system that supports transcription of influenza viral RNA. J Biochem (Tokyo) 101, Thierry, F. & Danos, O. (1982). Use of specific single stranded DNA probes cloned in M13 to study the RNA synthesis of four temperature-sensitve mutants of HK/68 influenza virus. Nucleic Acids Res 10, Vreede, F. T., Jung, T. E. & Brownlee, G. G. (2004). Model suggesting that replication of influenza virus is regulated by stabilization of replicative intermediates. J Virol 78, Young, J. F., Desselberger, U., Graves, P., Palese, P., Shatzman, A. & Rosenberg, M. (1983). Cloning and expression of influenza virus genes. In The Origin of Pandemic Influenza Viruses, pp Edited by W. G. Laver. Amsterdam: Elsevier Journal of General Virology 85