Comparison of Groundnut bud necrosis virus isolates based on movement protein (NSm) gene sequences

Transcription

1 Ann. ppl. Biol. (2004), 145: Printed in UK 285 Comprison of Groundnut bud necrosis virus isoltes bsed on movement protein (NSm) gene sequences By MOHD AKRAM 1#, R K JAIN 1 *, VIKAS CHAUDHARY 1, Y S AHLAWAT 1 nd S M PAUL KHURANA 2 1 Unit of Plnt Virology, Division of Plnt Pthology, Indin Agriculturl Reserch Institute, New Delhi , Indi 2 Centrl Potto Reserch Institute, Shiml , Indi (Accepted 6 July 2004; Received 4 Februry 2004) Summry The nucleotide nd mino cid sequences of the movement protein (NSm) genes of five isoltes of Groundnut bud necrosis virus (GBNV) originting from different hosts nd prts of Indi such s cowpe nd tomto from Kerl, groundnut from Tmil Ndu, nd potto from Mdhy Prdesh nd Rjsthn were determined nd compred to the known NSm sequences. Sequence nlysis reveled tht the NSm genes of GBNV isoltes were identicl in length (924 bp encoding 307 mino cids). GBNV isoltes shred mximum identity (98-%) t mino cid levels with Type isolte, while 82-83% nd 34-65% mino cid sequence identities were observed with Wtermelon silver mottle virus nd other Tospoviruses respectively. The NSm genes mong GBNV isoltes originting from different hosts nd loctions ppered highly conserved (93-%), suggesting their common origin. Key words: Groundnut bud necrosis virus, NSm gene, tospovirus Introduction Tospoviruses contin three RNA segments, smll (S), medium (M) nd lrge (L), in qusisphericl ( nm in dimeter) enveloped prticles nd re exclusively vectored by severl thrips species in circultive nd propgtive mnner (Mumford et l., 1996; Moyer, 1999). They hve emerged s serious pthogens ffecting wide rnge of crop plnts in the Indin sub-continent (Vrm et l., 2002). Three distinct Tospoviruses, Groundnut bud necrosis (GBNV) nd Groundnut yellow spot (GYSV) from groundnut nd Wtermelon bud necrosis (WBNV) from wtermelon hve been recognised from prts of Indi on the bsis of nucleocpsid protein (NP) gene properties (Reddy et l., 1992; Jin et l., 1998; Stynryn et l., 1998). Recently, nlysis of the NP gene sequence (locted on the S RNA) ws used to determine the extent of GBNV infection in vrious leguminous (cowpe, mungben nd soyben) nd solnceous (potto nd tomto) hosts (Bht et l., 2002; Jin et l., 2002; Thien et l., 2003; Ummheswrn et l., 2003). In order to further chrcterise the virl genome nd confirm erlier identifictions bsed on the NP gene, the movement protein (NSm) genes (locted on M RNA) from five GBNV isoltes originting from cowpe (Vign unguicult), groundnut (Archis hypoge), potto (Solnum tuberosum) nd tomto (Lycopersicon esculentum) were cloned, sequenced *Corresponding Author E-mil: rkeshjin56@yhoo.co.in 2004 Assocition of Applied Biologists nd compred for nucleotide nd mino cid sequence identity in this study. This study extends the dt presented in Akrm et l. (2003). Mterils nd Methods Sources nd mintennce of virus isoltes Nturlly ffected smples showing chlorotic nd brown necrotic spots on leves in cowpe nd tomto (Kerl), severe necrosis on stem nd leves in potto (Mdhy Prdesh nd Rjsthn) nd chlorotic nd necrotic ring spots on leves nd necrosis on stem nd buds in groundnut (Tmil Ndu) were collected (Tble 1). Assocition of tospovirus with the smples ws first estblished by direct ntigen-coted enzyme-linked immunosorbnt ssy (Clrk & Joseph, 1984) using polyclonl ntiserum directed ginst the NP of Wtermelon silver mottle virus (WSMoV) (Yeh et l., 1996). The virus ws subsequently identified s Groundnut bud necrosis virus (GBNV) on the bsis of NP gene sequences (Jin et l., 2002; Ummheswrn et l., 2003). The virus isoltes were then sp inoculted to cowpe (cv. Pus Koml, dignostic ssy host) plnts using chilled 0.01 M potssium phosphte buffer (ph 7.0) contining 0.1% 2-mercptoethnol. Nucleic cid extrctions nd reverse trnscription -polymerse chin rection Totl RNA from freshly desiccted infected tissues # Present Address: Deprtment of Plnt Pthology, College of Agriculture, C. S. Azd University of Agriculture & Technology, Knpur , Indi

2 286 MOHD AKRAM ET AL. Tble 1. Sources of virus isoltes used in this study nd their rection ginst polyclonl ntiserum directed ginst nucleocpsid protein of Wtermelon silver mottle virus in direct ntigen-coted enzymelinked immunosorbnt ssy Isoltes Host Origin Absorbnce t 405 nm CP Cowpe Kerl (0.01) POMP Potto Mdhy Prdesh (0.12) PORJ Potto Rjsthn (0.12) TO Tomto Kerl (0.10) GNTN Groundnut Tmil Ndu (0.13) Averge bsorbnce of three replictes 1 h fter substrte ddition. Vlues in the prentheses re bsorbnce of helthy plnt extrcts of cowpe, tomto, potto nd groundnut ( mg) ws extrcted using the RNesy kit ccording to the mnufcturer s instructions (Qigen Inc., Chtsworth, CA, USA). RT-PCR ws bsed on the method of Pppu et l. (1993). The primer pir used for mplifiction of NSm genes ws derived from the previously reported NSm gene sequence of GBNV (type isolte; U42555) (Stynryn et l., 1996). The upstrem primer 5' ATGTCTCGCTTDT CTAAHGTB 3' nd downstrem primer 5' TTATATTTCAAGAAGATTATC 3' represented the first nd the lst 21 bses of the coding region of the NSm gene, respectively. Prior to mplifiction, the templte ws incubted t 72 C for 5 min nd snpcooled on wet ice for 2 min. Reverse trnscription- PCR ws performed in n utomted therml cycler (Biometr) using the following prmeters: one cycle t 42 C for 45 min for cdna synthesis, then 40 cycles t 94 C for 30 s, 48 C for 1 min, nd 72 C for 1 min followed by one cycle t 72 C for 60 min. Products were resolved following electrophoresis through 1% grose gel contining ethidium bromide. Cloning, sequencing nd sequence nlyses The product mplified from ech smple ws purified fter electrophoresis using Qix II gel purifiction kit (Qigen Inc., Chtsworth, CA, USA). Purified DNA frgments were ligted into pgem- T Esy vector (Promeg, Mdison, WI, USA) nd competent Escherichi coli cells (DH 5α) were trnsformed by following stndrd moleculr biology procedures (Smbrook & Russell, 2001). Two clones of ech isolte were sequenced in both directions (by the Deprtment of Biochemistry, University of Delhi, Indi). Sequences were compred with published NSm gene sequences of GBNV nd other known Tospoviruses (Tble 2) using BIOEDIT Version Sequence phylogrms were constructed using TREECON Version 1.3b (bootstrp nlysis with 500 replictes) nd unrooted trees were generted. Results GBNV isoltes originting from cowpe ( CP), groundnut (GNTN), potto ( POMP, PORJ), nd tomto (TO) rected with polyclonl ntiserum directed ginst the NP of WSMoV (Tble 1) nd were esily sptrnsmitted to cowpe. Similr symptoms (chlorotic/ necrotic spots or lesions, followed by veinl nd systemic necrosis) were induced by ll isoltes. Tble 2. Sources of movement protein (NSm) gene sequences of Groundnut bud necrosis virus isoltes nd other tospoviruses Virus Isoltes GenBnk Accession no. No. of mino cid Reference CP AY This study POMP AY This study PORJ AY This study TO AY This study GNTN AY This study GNAP b U Stynryn et l., 1996 WSMV U Chu & Yeh, 1998 IYSV AF Silv et l., 2001 INSV M Silv et l., 2001 ZLCV AF Silv et l., 2001 TSWV S Silv et l., 2001 CSNV AF Silv et l., 2001 TCSV AF Silv et l., 2001 GRSV AF Silv et l.,2001 CP = cowpe, POMP = potto Mdhy Prdesh, PORJ = potto Rjsthn, TO = tomto, GNTN = groundnut Tmil Ndu, GNAP = groundnut Andhr Prdesh, GBNV = Groundnut bud necrosis virus, WSMV = Wtermelon silver mottle virus, IYSV = Iris yellow spot virus, INSV = Imptiens necrotic spot virus, ZLCV = Zucchini lethl chlorosis virus, TSWV = Tomto spotted wilt virus, CSNV = Chrysnthemum stem necrosis virus, TCSV = Tomto chlorotic spot virus, GRSV = Groundnut ringspot virus. b Type isolte

3 Movement protein (NSm) gene comprison 287 Cloning nd sequence determintion The NSm genes were cloned following RT-PCR mplifiction of virl RNA from cowpe, groundnut, potto nd tomto, growing t four loctions, s indicted in Tble 1. The complete nucleotide sequences of five NSm genes were determined; no sequence differences were seen between the two clones of ech isolte. Sequences hve been deposited in the Gen Bnk dtbse s detiled in Tble 2. The sequenced region in ll five isoltes hd n open reding frme (ORF) of 924 bses nd could potentilly code for protein of 307 mino cids. Although the conserved D-motif of the 30K superfmily of virus movement proteins (Melcher, 2000) ws present in ll GBNV isoltes, the conserved glycine (G-residue; Melcher, 2000) ws bsent in ll but GNTN (Fig. 1). Fig. 1. CLUSTAL W generted multiple lignment of movement protein (NSm) gene sequences of Groundnut bud necrosis virus isoltes. Asterisks indicte mino cids identicl to GNAP t given position; differences re shown in bold. The D-motif nd the G-residue conserved within the 30K superfmily (Melcher, 2000) re in bold nd underlined.

4 288 MOHD AKRAM ET AL. Sequence comprisons The sequence similrities between tospovirus NSm genes nd the lignment of GBNV NSm mino cid sequences re shown in Tble 3 nd Fig. 1, respectively. In ll, NSm genes of 14 isoltes representing nine Tospoviruses were used for nlysis. The GBNV isoltes showed mximum levels of sequence identity with the corresponding gene sequence of Type isolte ( GNAP). Percent identity rnged from 92-95% nd 98-% t the nucleotide nd mino cid levels respectively (Tble 3). Further, GBNV isoltes shred considerble identity with WSMoV both t the nucleotide (77-79%) nd mino cid sequence levels (82-83%). In contrst, only 50-68% (nucleotide) nd 34-65% (mino cid) sequence identities were observed with other Tospoviruses (Tble 3). The NSm proteins of the GBNV isoltes from this study differed from the Type isolte t eight mino cid positions (Fig. 1). Phenyllnine (mino cid 4) in the Type isolte ws replced by leucine in ll of the GBNV isoltes. In the tomto isolte ( TO), lysine (mino cid ) ws replced by sprgine. In potto isoltes (POMP nd PORJ), isoleucine, rginine nd lnine (mino cids 118, 127 nd 281) were substituted by methionine, lysine nd threonine respectively nd in the groundnut isolte (GNTN), serine, lnine nd sprtic cid (mino cids 213, 288 nd 291) were substituted by glycine, sprtic cid nd sprgine respectively (Fig. 1). Phylogenetic nlysis of the mino cid sequences of the NSm genes showed tht GBNV isoltes formed one cluster long with WSMoV nd IYSV. The remining six tospoviruses, CSNV, GRSV, Tospovirus isoltes CP POMP TO INSV, TCSV, TSWV nd ZLCV formed second cluster (Fig. 2) CSNV 70 GRSV TCSV TSWV INSV ZLCV TO CP 60 GNAP POMP GNTN WSMV IYSV Fig. 2. Cluster dendrogrm showing the reltionships between the deduced mino cid sequences of the movement protein (NSm) gene of Groundnut bud necrosis virus isoltes with those of known Tospoviruses. The dendrogrm ws constructed using the neighbour-joining method with bootstrpping (500 replictes) in TREECON for Windows version 1.3b on sequences ligned using CLUSTAL W 1.7 version. Verticl distnces re rbitrry. Horizontl distnces re proportionl to genetic distnces (br represents 0.1). The number t nodes refer to number of times (in percentges) in which brnching ws supported. The tree ws rooted on the TSWV sequence. Tble 3. Per cent nucleotide (bove digonl line) nd mino cid (below the digonl line) sequence identity of movement protein (NSm) genes between Groundnut bud necrosis virus isoltes nd other Tospoviruses WSMV IYSV INSV ZLCV TSWV CSNV TCSV GRSV GNTN GNAP CP POMP b TO GNTN GNAP c WSMV IYSV INSV ZLCV TSWV CSNV TCSV GRSV Abbrevitions re s in the footnote to Tble 2. b POMP nd PORJ re % identicl t the mino cid level c GNAP is the type isolte

5 Movement protein (NSm) gene comprison 289 Discussion The NSm gene from five GBNV isoltes originting from different hosts nd loctions in Indi were sequenced nd compred to known NSm sequences. The NSm coding region of ll the isoltes ws the sme; 924 bses encoding 307 mino cids. This is in contrst to the considerble heterogeneity ( mino cids) observed between the NSm proteins of other Tospovirus species (Silv et l., 2001). Sequence nlysis of the NP genes of the Indin GBNV isoltes (Bht et l., 2002; Jin et l., 2002; Thien et l., 2003; Ummheswrn et l., 2003) showed them to be highly conserved nd similr conservtion ws seen in the NSm genes nlysed in this study. Our dt show tht GBNV isoltes originting from different hosts nd loctions in Indi re highly similr nd re indistinguishble on the bsis of their NP nd NSm gene sequences. However, comprison of other genes on the three virl RNA species could llow the isoltes to be distinguished. The sequence conservtion within the NP nd NSm genes my fcilitte the use of pthogen derived resistnce strtegies to generte virus resistnt trnsgenic plnts (Prins & Goldbch, 1998; Rudolph et l., 2003). Acknowledgements The uthors thnk the World Bnk for finncil support to the Ntionl Agriculturl Technology Project on Humn Resource Development for Advnced Reserch in Plnt Virology t IARI, New Delhi, Indi. We thnk Dr S D Yeh, Ntionl Chung Hsing University, Tichung City, Tiwn for ntiserum to WSMoV. References Akrm M, Jin R K, Chudhry V, Ahlwt Y S, Pul Khurn S M Chrcteriztion of the movement protein (NSm) gene of Groundnut bud necrosis virus from cowpe nd potto. Indin Phytopthology 56: Bht A I, Jin R K, Vrm A, Ll S K Nucleocpsid protein gene sequence studies suggest tht soyben bud blight is cused by strin of Groundnut bud necrosis virus. Current Science 82: Chu F H, Yeh S D Comprison of mbisense M RNA of wtermelon silver mottle virus with other tospoviruses. Phytopthology 88: Clrk M F, Joseph M B Enzyme immunosorbent ssys in plnt virology. In Methods in Virology, Vol. II, pp Eds K Mrmorosch nd H Koprowski. New York: Acdemic Press. Jin R K, Pppu H R, Pppu S S, Krishnreddy M, Vni A Wtermelon bud necrosis Tospovirus from Indi is distinct virus species belonging to serogroup IV. Archives of Virology 143: Jin R K, Ummheswrn K, Bht A I, Thien H X, Ahlwt Y S Necrosis disese on cowpe, mungben nd tomto is cused by Groundnut bud necrosis virus. Indin Phytopthology 55:354. Melcher U The 30 K superfmily of virl movement proteins. Journl of Generl Virology 81: Moyer J W Tospoviruses (Bunyviride). In Encyclopedi of Virology, pp Eds R G Webster nd A Grnoff. New York: Acdemic Press. Mumford R A, Brker I, Wood K R The biology of the tospoviruses. Annls of Applied Biology 128: Pppu S S, Brnd R, Pppu H R, Rybicki E P, Gough K H, Frenkel M J, Niblett C L A polymerse chin rection method dopted for selective mplifiction nd cloning of 3'-sequences of potyvirl genomes: ppliction to Dsheen mosic virus. Journl of Virologicl Methods 41:9-20. Prins M, Goldbch R The emerging problem of tospovirus infection nd non conventionl methods of control. Trends in Microbiology 6: Reddy D V R, Rtn A S, Sudrshn M R, Poul F, Kirnkumr I Serologicl reltionships nd purifiction of bud necrosis virus, Tospovirus occurring in penut (Archis hypoge L.) in Indi. Annls of Applied Biology 120: Rudolph C, Schreier P H, Jochim F U Peptidemedited brod-spectrum plnt resistnce to tospoviruses. Proceedings of the Ntionl Acdemy of Sciences of the United Sttes of Americ : Smbrook J, Russell D W Moleculr Cloning: A Lbortory Mnul, 3rd Edn. New York: Cold Spring Hrbor Lbortory Press. Stynryn T, Gowd S, Lkshminryn R K, Mitchell S E, Dwson D E, Reddy D V R Penut yellow spot virus is member of serogroup V of Tospovirus genus bsed on smll (S) RNA sequence nd orgniztion. Archives of Virology 143: Stynryn T, Mitchell S E, Reddy D V R, Kresovich S, Jrret R, Nidu R A, Gowd S, Demski J W The complete nucleotide sequence nd genome orgniztion of the M RNA segment of penut bud necrosis tospovirus nd comprison with other tospoviruses. Journl of Generl Virology 77: Silv M S, Mrtins C R F, Bezerr I C, Ngt T, de Avil A C, Resende R O Sequence diversity of NS m movement protein of tospoviruses. Archives of Virology 146: Thien H X, Bht A I, Jin R K Mungben necrosis is cused by strin of Groundnut bud necrosis virus. Indin Phytopthology 56: Ummheswrn K, Jin R K, Bht A I, Ahlwt Y S Biologicl nd nucleocpsid protein gene chrcteriztion suggest tht tomto tospovirus is strin of Groundnut bud necrosis virus. Indin Phytopthology 56: Vrm A, Jin R K, Bht A I Virus resistnt trnsgenic plnts for environmentlly sfe mngement of virl diseses. Indin Journl of Biotechnology 1: Yeh S D, Cho C H, Cheng Y H, Chen C C Serologicl comprison of four distinct tospoviruses by polyclonl ntibodies to purified nucleocpsid proteins. Act Horticulture 431: