Infectious clones of novel lineage 1 and lineage 2 West Nile. virus strains WNV-TX02 and WNV-Madagascar

Transcription

1 JVI Accepts, published online ahead of print on 9 May 2012 J. Virol. doi: /jvi Copyright 2012, American Society for Microbiology. All Rights Reserved Infectious clones of novel lineage 1 and lineage 2 West Nile virus strains WNV-TX02 and WNV-Madagascar Mehul S. Suthar 1, Margaret M. Brassil 1, Gabriele Blahnik 1, Michael Gale, Jr. 1, Department of Immunology, 2 Department of Microbiology, University of Washington School of Medicine, Seattle, WA 98195, USA. Running Title: Lineage 1 and 2 infectious clones Corresponding Author: Dr. Michael Gale Jr. mgale@u.washington.edu Mailing Address: University of Washington School of Medicine, Department of Immunology, H466 HSC 1959 N.E. Pacific Seattle, WA , USA Phone: (206) Fax: (206)

2 ABSTRACT We report the generation of West Nile virus (WNV) infectious clones for the pathogenic lineage 1 Texas-HC2002 and nonpathogenic lineage 2 Madagascar-AnMg798 strains. The infectious clones exhibited similar biological properties as compared to the parental virus isolates. We generated chimeric viruses and found that viral factors within the structural and nonstructural regions of WNV-TX contribute to control of type I interferon defenses. These infectious clones provide new reagents to study flavivirus immune regulation and pathogenesis. Downloaded from on April 20, 2018 by guest 2

3 INTRODUCTION, RESULTS, AND DISCUSSION West Nile virus (WNV) is a neurotropic flavivirus that constitutes the leading cause of mosquito-borne and epidemic encephalitis in humans in the United States (1). WNV is a member of the family Flaviviridae and carries a single-stranded positive-sense RNA genome of approximately 11 kb in length consisting of a single open reading frame that is translated as a polyprotein to generate ten viral proteins. Lineage 1 WNV strains represent emerging viruses that associate with outbreaks of encephalitis and meningitis in Europe, the Middle East, and now in North America, whereas lineage 2 strains are typically nonpathogenic, nonemergent and geographically confined to the African subcontinent and Madagascar (3-4, 12). More recently, lineage 1 WNV associated infections have shifted from causing disease in young children, elderly, and the immunocompromised to afflicting healthy young adults, indicating that virulence occurs independently of immune senescence or immune deficiencies associated with aging (6-7). Pathogenic lineage 2 WNV variants have recently emerged in Europe, causing significant WNV-induced disease in humans (17). The increase in virulence of lineage 1 and 2 strains, coupled with a lack of a vaccine or therapeutic agents continues to present WNV as a significant public health threat. The host innate immune response is the first line of defense during virus infection and is responsible for deterring virus replication and spread within the host. Lineage 1 WNV-TX, but not lineage 2 WNV-MAD, has been shown to inhibit type I IFN-induced phosphorylation of STAT1 and STAT2 by blocking the activity of the IFN receptor-associated kinase, Tyk2 (9). We found that WNV-TX also blocks an IKK-dependent phosphorylation event on STAT1, resulting in a temporal regulation of STAT1 phosphorylation and subsequent expression of interferonstimulated genes that are essential for controlling WNV infection (18). However, studies to identify specific viral determinants that regulate WNV inhibition of IFN-mediated signaling have been hindered by the lack of appropriate reagents. 3

4 To facilitate viral genetic studies of WNV/host interactions that control infection and immunity, we generated a novel infectious clone (i.c.) of WNV-TX (strain TX 2002-HC) and a clone of WNV-MAD (strain Madagascar-AgMg798) (9). The design of each i.c. is based on the two-plasmid reverse genetics system first described by Kinney et al. (10). In this system, the structural and nonstructural genes are broken into two plasmids (pab and pcg, respectively). This system allows for overcoming limitations imposed by genetic instability during plasmid propagation in bacterial hosts, problems due to difficult low-yield plasmid preparations, as well as limitations due to a lack of restriction sites for cdna insertion in single-plasmid cloning schemes. To generate the infectious clones, we replaced the coding sequences of NY99 strain with either WNV-TX or WNV-MAD in the respective plasmids. The sequence of the viral RNA 5 UTR is conserved among WNV-NY99, WNV-TX, and WNV-MAD. The 3 UTR sequence of the viral RNA is conserved between WNV-NY99 and WNV-TX, but not WNV-MAD (73.4% sequence similarity (9)). For generating the WNV-TX i.c., three amino acid coding changes within the sequence of WNV-NY99 (strain ) were replaced with WNV-TX (Table 1). The WNV-MAD i.c. was synthesized (Genscript, Piscataway, NJ) with nucleotides (nt) (encoding the structural genes) inserted in a puc19 vector (Genscript) and nt (with the 3 UTR (nt ) from WNV-TX) in a pcci vector (Genscript). To allow for full-length clone assembly, a unique NgoMIV restriction site was engineered (nt A2496C, A2498G) that did not alter the NS1 amino acid coding sequence. Infectious WNV-TX and WNV-MAD RNA was successfully prepared from their respective two-plasmid infectious clones, introduced in BHK-21 cells by electroporation, and viral supernatants recovered and aliquoted as the primary working stocks for phenotypic analysis (as described in Kinney et. al (10)) The newly generated cdna cloned infectious viruses were evaluated to determine whether they retained similar biological properties as their parental virus isolates. To accurately determine viral fitness, virus replication was compared between the parental passaged virus 4

5 isolates (herein referred to as parental) and clonal virus generated from the respective i.c. by evaluating replication in innate immune response-defective (BHK-21) and response-competent (A549) cell lines. One-step (MOI 5.0 based on virus tittering on BHK-21 cells; Figure 1A-B) and multi-step (MOI 0.01; Figure 1C-D) growth curves from infected BHK-21 cells, which have a defect in IFN production (2, 5), were similar between the clonal and parental viruses. Of note, in the one-step growth curve (Figure 1A), the parental WNV-TX displayed significantly higher viral titers at early times post-infection, likely due to the fact that the parental WNV-TX stock has accumulated cell culture adaptations during amplification of the working stock (11). In addition, the WNV-TX i.c. virus displayed similar particle-to-pfu ratios as compared to the parental virus, while WNV-MAD i.c. virus displayed a significantly lower particle to PFU ratio as compared to parental WNV-MAD (Figures 1E-F), likely due to the effects of virus passage in cell-culture. Similar to viral growth in BHK-21 cells, parental WNV-TX and WNV-MAD exhibited significantly higher viral titers at early times post-infection in one-step growth curves on A549 cells (interferon-competent; MOI based on tittering on VeroE6 cells) as compared to the infectious cloned virus (Figure 2A-B). Whereas the parental WNV-TX displayed significantly higher viral titers at early times post-infection in a multi-step growth curve (Figure 2C), the parental WNV-MAD exhibited similar viral titers as compared to WNV-MAD i.c. (Figure 2D). WNV-TX i.c. inhibited STAT1 (Y701) and STAT2 (Y689) phosphorylation similar to parental WNV-TX (Figure 2E; (9)). WNV-MAD i.c. displayed only slight inhibition of STAT1 (Y701) phosphorylation, however, no block in STAT2 phosphorylation (Y689) was observed, similar to the parental WNV-MAD (Figure 2F; (9)). These results demonstrate that the infectious cloned virus exhibit similar in vitro biological properties and fitness as their parental viruses Lineage I WNV-TX is virulent in mice whereas lineage 2 WNV-MAD is attenuated, exhibiting no mortality and mild clinical signs to infection (9, 21). WT mice infected with WNV-TX 5

6 i.c. exhibited similar clinical scoring, albeit with reduced mortality, as that of mice infected with the parental WNV-TX (Figure 3A-B). WNV-MAD i.c., in contrast, was completely avirulent in WT mice, exhibiting no clinical signs of pathology and no clinical scores above baseline (Figure 3C) with no morality (Figure 3D). In the absence of type I IFN signaling (Ifnar -/- mice), WNV-TX i.c. displayed nearly identical virulence as compared to parental WNV-TX, while WNV-MAD i.c. displayed increased mortality as compared to parental WNV-MAD. These results confirm that type I IFN signaling is essential in protection against lineage 1 and 2 WNV strains (Figure 3E-F) and validating previous studies that defined WNV control of IFN signaling as a major virulence determinant (9, 19). To identify regions within the WNV-TX genome that contribute to inhibition of IFN signaling, chimeric viruses were generated between the lineage I WNV-TX and lineage 2 WNV- MAD clones (Figure 4A). The structural (Core through E protein) and nonstructural (NS1 through NS5) coding regions were exchanged between the two infectious clones, creating the chimeric WNV-TX/MAD (containing the structural genes of WNV-TX and nonstructural genes of WNV-MAD) and WNV-MAD/TX (containing the structural genes of WNV-MAD and nonstructural genes of WNV-TX). In BHK-21 cells, the chimeric viruses replicated similar to WNV-MAD i.c., with all 3 viruses replicating with significantly reduced levels at early times as compared to WNV-TX i.c. (Figure 4B). Interestingly, while the levels of all 4 viruses were similar by 48 hours post-infection, we observed dramatic differences in plaque forming efficiency between chimeric viruses (Figure 4C). The WT WNV-TX i.c. displayed a large-plaque morphology, whereas WT WNV-MAD i.c. displayed a small-plaque morphology. Chimeric viruses containing either the structural or nonstructural genes from WNV-TX resulted in increased plaque sizes, suggesting that both the structural and NS regions of the viral genome contribute to virus-induced cytopatholgy. In multi-step growth curves performed on A549 cells, the chimeric viruses displayed replication kinetics similar to WT WNV-TX i.c., while WT WNV-MAD i.c. displayed 6

7 comparably reduced replication (Figure 4D). Analysis of type I IFN induction, as measured by activation of interferon regulatory factor-3 (IRF-3) and expression of IFIT1, showed that WNV- TX, WNV-MAD, and the chimeric viruses are strong activators of host innate defenses (Figure 4E). For all the viruses, IRF-3 phosphorylation and IFIT1 protein expression tracked with the synthesis of viral NS3. Introduction of the structural or nonstructural genes from WNV-TX into the WNV-MAD i.c. backbone resulted in inhibition of type I IFN signaling to levels similar to that observed with WT WNV-TX i.c., demonstrating that both structural and NS regions of the WNV- TX genome encode products that suppress IFN signaling (Figure 4F). Similarly, the chimeric viruses showed nearly indistinguishable clinical scoring as compared to the WT WNV-TX i.c. upon infection of WT mice (Figure 4G), while virulence in Ifnar -/- mice was also maintained (Figure 4H). These results demonstrate that the nonstructural and structural genes from the lineage I WNV-TX strain encode viral factors that influence host cell cytopathic effect, inhibition of IFN signaling, and viral pathogenesis. In this study, we describe the generation and characterization of two infectious clones for novel lineage 1 and lineage 2 WNV strains. The infectious clone for WNV-TX and WNV-MAD displayed nearly identical growth kinetics and magnitude as compared to the parental strain, with the exception of slightly enhanced virus replication at early times post-infection. Functionally, the infectious clones were comparable in their capacity to inhibit the IFN signaling pathway as compared to their parental strains. In vivo analysis demonstrated that the infectious cloned viruses displayed more uniform virulence in WT and IFN-receptor knockout mice as compared to the parental virus strains. While there was a general reduction in virulence with the infectious clones in WT mice, these differences can likely be attributed to either virus amplification procedures or genetics differences found within the 3 UTR sequence (in the case of WNV-MAD). Overall, the infectious clones displayed comparable biological properties to that of their parental viruses. 7

8 The lineage 1 WNV-TX antagonizes type I IFN signaling by inhibiting phosphorylation and activation of STAT1 and STAT2 transcription factors (9). Recent studies have also found that WNV-TX also prevents inhibitor of κb kinase ε (IKKε) phosphorylation at serine 708, which is essential in driving a subset of antiviral effector genes (18). Multiple viral factors have been implicated in regulating type I IFN signaling, including the nonstructural proteins NS2A (14-15), NS2B (15), NS3 (15), NS4A (15), NS4B (8, 15-16), NS55 (13) and the structural proteins (8). Recently, the non-coding subgenomic RNA was implicated in evading type IFN signaling, however, further mechanism is required for determine how an RNA product can regulate IFN signaling (20). The use of the WNV-TX and WNV-MAD infectious clones, which differ in their abilities to inhibit type I IFN signaling, provides a platform for identification of novel viral determinants in regulating type I IFN signaling and responses. The viral and host factors governing the outcome of WNV infection have been hindered by the lack of appropriate WNV reagents. These novel infectious clones now provide valuable reagents allowing for comparative infection studies between virulent and avirulent WNV strains. In addition to serving as a platform to identify viral factors associated with pathogenesis, these infectious clones can serve to identify host factors within novel virus/host interactions that control immunity to lineage 1 and lineage 2 WNV infections. Indeed, the avirulent WNV-MAD i.c. may serve as a live-attenuated vaccine strain and allow for future studies to define the immune correlates of protection against flavivirus infection. 8

9 FIGURE LEGENDS Figure 1. WNV-TX i.c. and WNV-MAD i.c. display comparable biological properties as the parental virus isolates. BHK-21 cells were infected in triplicate with an MOI 5.0 (A,B) or 0.01 (C,D) with parental WNV-TX (working stocks derived from single round plaque purification in HEK-293 cells and two rounds of amplification in VeroE6 cells) and WNV-TX i.c. or parental WNV-MAD (working stocks derived from two rounds of amplification in VeroE6 cells) and WNV- MAD i.c. 100 ul of cell culture supernatant were removed at the indicated times post-infection and replaced with fresh cell culture media. Viral burden in the culture supernatants were then determined by plaque assay on BHK-21 cells. (E,F) Particle-to-PFU ratios were determined by triplicate viral RNA extraction from working viral stocks (harvested at 48 hours post-infection) using QIAamp viral RNA extraction kit followed by qrt-pcr with virus-specific primers. Copies of viral RNA were divided by the viral titers determined on BHK-21 cells. Data are representative of three independent experiments. Asterisks denote P < Figure 2. WNV-TX i.c. and WNV-MAD i.c. exhibit comparable replication fitness in interferon-competent cells as compared to their respective parental virus isolates. A549 cells were infected in triplicate with an MOI 5.0 (A,B) or 0.01 (C,D) with parental WNV-TX and WNV-TX i.c. or parental WNV-MAD and WNV-MAD i.c. 100 ul of cell culture supernatant were removed at the indicated times post-infection and replaced with fresh cell culture media. Viral burden in the collected culture supernatants were then determined by plaque assay on VeroE6 cells. (D,E) A549 cells were mock infected or infected (MOI = 5) in triplicate with parental WNV- TX and WNV-TX i.c. or parental WNV-MAD and WNV-MAD i.c. At 6, 12, 24, or 48 hours postinfection, cells were pulse-treated with 1,000 international units (IU) IFN-α (PBL Interferon) for 30 min and whole-cell lysates were collected in modified RIPA buffer (10mM Tris [ph 7.5], 150mM NaCl, 0.5% sodium deoxycholate, and 1% Triton X-100 supplemented with protease 9

10 inhibitor cocktail (Sigma) and phosphatase inhibitor cocktail II (Calbiochem)) and analyzed by immunoblotting to detect STAT1 phosphotyrosine residue 701 (Cell Signaling), total STAT1 (Cell Signaling), STAT2 phosphotyrosine residue 689 (Upstate); total STAT2 (Cell Signaling), WNV NS3 (R&D Systems), and GAPDH (Santa Cruz). Data are representative of three independent experiments. Asterisks denote P < Figure 3. Infectious cloned viruses display comparable in vivo biological properties as the parental virus isolates. Six to twelve week-old C57BL/6 mice were infected with (A) parental WNV-TX (n=24) and WNV-TX i.c. (n=10) or (B) parental WNV-MAD (n=6) and WNV- MAD i.c. (n=6) subcutaneously (s.c.) in the left rear footpad with 100 PFU in a 10 μl inoculum diluted in phosphate buffered saline (PBS) supplemented with 1% heat-inactivated FBS. Mice were monitored daily and scored for clinical signs as follows: 1. ruffled fur and/or hunched body posture; 2. mild hind-limb dysfunction; 3. hind-limb dysfunction in at least 1 limb; 4. severe hindlimb dysfunction in both limbs; 5. paresis of hind limbs; and 6. terminal morbidity. (C,D) Six to twelve week-old C57BL/6 mice were infected in a similar manner to Panels A-B and monitored daily for mortality. (E,F) Six to twelve week-old Ifnar -/- mice (courtesy of Murali-Krishna Kaja) were infected in a similar manner to Panels A-B (WNV-TX n=9; WNV-TX i.c. n=5; WNV-MAD n=6; and WNV-MAD i.c. n=6) and monitored daily for mortality. Experiments were performed in accordance with the University of Washington Institutional Animal Care and Use Committee. As required by the UW animal protocol, infected mice were euthanized during the experiment either when mice dropped below 20% of initial body weight or when mice exhibited severe disease signs. Kaplan-Meier survival curves were analyzed by the log-rank test to determine significance (GraphPad Prism 5). Data are representative of three independent experiments. 10

11 Figure 4. WNV-TX nonstructural and structural genes inhibit type I IFN signaling. (A) Schematic of chimeric viruses. (B) Multi-step growth curve (MOI 0.01) on BHK-21 cells. (C) Plaque assay performed on BHK-21 cells and counterstained on day 3 post-infection with crystal violet. (D) Multi-step growth curve (MOI 0.01) on A549 cells. Data are representative of three independent experiments. Asterisks denote P < (E) A549 cells were mock infected (M) or infected (MOI = 5) with parental and chimeric viruses and whole-cell lysates were collected in modified RIPA buffer and analyzed by immunoblotting with the indicated antibodies (phospho-irf-3 (Cell Signaling), Total IRF-3 (courtesy of Michael David), ISG56 (courtesy of Ganes Sen), and GAPDH). (F) A549 cells were mock infected (M) or infected (MOI = 5) with parental and chimeric viruses pulse treated with 1,000 IU IFN-α 30 min at the indicated times post-infection. (G) Six to twelve week-old C57BL/6 mice were infected with parental (WNV-TX i.c. n=10; WNV-MAD i.c. n=12) and chimeric viruses (WNV-MAD/TX i.c. n=8; WNV-TX/MAD i.c. n=10) s.c. in the left rear footpad with 100 PFU in a 10 μl inoculum. Mice were monitored daily and scored for clinical signs. (H) Six to twelve week-old Ifnar -/- mice (WNV-TX i.c. n=5; WNV- MAD i.c. n=6; WNV-MAD/TX i.c. n=4; WNV-TX/MAD i.c. n=5) were infected in a similar manner to panel G and monitored daily for mortality. Data are representative of two independent experiments. 11

12 ACKNOWLEDGEMENTS We thank Dr. Brian Doehle for helpful discussion. We appreciate support from Richard M. Kinney for providing the WNV-NY99 derived infectious clone. Supported by NIH grants 1F32AI081490, R01AI074973, U19AI083019, U54AI

13 REFERENCES 1. West Nile virus disease and other arboviral diseases--united States, MMWR Morb Mortal Wkly Rep 60: Andzhaparidze, O. G., N. N. Bogomolova, Y. S. Boriskin, M. S. Bektemirova, and I. D. Drynov Comparative study of rabies virus persistence in human and hamster cell lines. Journal of virology 37: Beasley, D. W., L. Li, M. T. Suderman, and A. D. Barrett Mouse neuroinvasive phenotype of West Nile virus strains varies depending upon virus genotype. Virology 296: Berthet, F. X., H. G. Zeller, M. T. Drouet, J. Rauzier, J. P. Digoutte, and V. Deubel Extensive nucleotide changes and deletions within the envelope glycoprotein gene of Euro-African West Nile viruses. J.Gen.Virol. 78 ( Pt 9): Clarke, J. B., and R. E. Spier An investigation into causes of resistance of a cloned line of BHK cells to a strain of foot-and-mouth disease virus. Vet Microbiol 8: Debiasi, R. L., J. A. Parsons, and B. E. Grabert West Nile virus meningoencephalitis in an immunocompetent adolescent. Pediatr.Neurol. 33: Emig, M., and D. J. Apple Severe West Nile virus disease in healthy adults. Clin.Infect.Dis. 38: Evans, J. D., and C. Seeger Differential effects of mutations in NS4B on West Nile virus replication and inhibition of interferon signaling. J.Virol 81: Keller, B. C., B. L. Fredericksen, M. A. Samuel, R. E. Mock, P. W. Mason, M. S. Diamond, and M. Gale, Jr Resistance to alpha/beta interferon is a determinant of west nile virus replication fitness and virulence. J.Virol 80: Kinney, R. M., C. Y. Huang, M. C. Whiteman, R. A. Bowen, S. A. Langevin, B. R. Miller, and A. C. Brault Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol 87: Laassri, M., B. Bidzhieva, J. Speicher, A. G. Pletnev, and K. Chumakov. Microarray hybridization for assessment of the genetic stability of chimeric West Nile/dengue 4 virus. J Med Virol 83: Lanciotti, R. S., G. D. Ebel, V. Deubel, A. J. Kerst, S. Murri, R. Meyer, M. Bowen, N. McKinney, W. E. Morrill, M. B. Crabtree, L. D. Kramer, and J. T. Roehrig Complete genome sequences and phylogenetic analysis of West Nile virus strains isolated from the United States, Europe, and the Middle East. Virology 298: Laurent-Rolle, M., E. F. Boer, K. J. Lubick, J. B. Wolfinbarger, A. B. Carmody, B. Rockx, W. Liu, J. Ashour, W. L. Shupert, M. R. Holbrook, A. D. Barrett, P. W. Mason, M. E. Bloom, A. Garcia-Sastre, A. A. Khromykh, and S. M. Best The 13

14 NS5 protein of the virulent West Nile virus NY99 strain is a potent antagonist of type I interferon-mediated JAK-STAT signaling. Journal of virology 84: Liu, W. J., X. J. Wang, D. C. Clark, M. Lobigs, R. A. Hall, and A. A. Khromykh A single amino acid substitution in the West Nile virus nonstructural protein NS2A disables its ability to inhibit alpha/beta interferon induction and attenuates virus virulence in mice. J.Virol 80: Liu, W. J., X. J. Wang, V. V. Mokhonov, P. Y. Shi, R. Randall, and A. A. Khromykh Inhibition of interferon signaling by the New York 99 strain and Kunjin subtype of West Nile virus involves blockage of STAT1 and STAT2 activation by nonstructural proteins. J.Virol 79: Munoz-Jordan, J. L., M. Laurent-Rolle, J. Ashour, L. Martinez-Sobrido, M. Ashok, W. I. Lipkin, and A. Garcia-Sastre Inhibition of alpha/beta interferon signaling by the NS4B protein of flaviviruses. Journal of virology 79: Papa, A., K. Xanthopoulou, S. Gewehr, and S. Mourelatos. Detection of West Nile virus lineage 2 in mosquitoes during a human outbreak in Greece. Clin Microbiol Infect 17: Perwitasari, O., H. Cho, M. S. Diamond, and M. Gale, Jr. Inhibitor of kappab kinase epsilon (IKK(epsilon)), STAT1, and IFIT2 proteins define novel innate immune effector pathway against West Nile virus infection. J Biol Chem 286: Samuel, M. A., and M. S. Diamond Alpha/beta interferon protects against lethal West Nile virus infection by restricting cellular tropism and enhancing neuronal survival. J.Virol 79: Schuessler, A., A. Funk, H. Lazear, D. Cooper, S. Torres, S. Daffis, B. Jha, Y. Kumagai, O. Takeuchi, P. Hertzog, R. Silverman, S. Akira, D. D. Barton, MS., and A. Khromykh West Nile virus non-coding subgenomic RNA contributes to viral evasion of type I interferon-mediated antiviral response. J. Virol. 21. Suthar, M. S., D. Y. Ma, S. Thomas, J. M. Lund, N. Zhang, S. Daffis, A. Y. Rudensky, M. J. Bevan, E. A. Clark, M. K. Kaja, M. S. Diamond, and M. Gale, Jr IPS-1 is essential for the control of West Nile virus infection and immunity. PLoS Pathog 6:e

15

16

17

18

19 Table 1: Primer seqences for WNV-TX infectious clone Name Amind Acid Coding Differences Primer set (orientation) Primer Sequence (NY99 to TX2002HC) 1 249s GGCGTTCTTCAGGTTCACAGC E224K 2900a GGACATTCCTTGGTCTCCGGACCA V449A s CCCAGGAGGTCCTTCGCAAGA V1493I 5244a CTCTTTGATGATCTGTGGCA Downloaded from on April 20, 2018 by guest