WHOLE GENOME SEQUENCING OF MYCOBACTERIUM LEPRAE FROM LEPROSY SKIN BIOPSIES and skeletons
|
|
- Kellie Bennett
- 5 years ago
- Views:
Transcription
1 WHOLE GENOME SEQUENCING OF MYCOBACTERIUM LEPRAE FROM LEPROSY SKIN BIOPSIES and skeletons Pushpendra Singh Laboratory of Prof. Stewart Cole Global Health Institute School of Life Sciences Ecole Polytechnique Fédérale de Lausanne, Switzerland.
2 Mycobacterium leprae First bacterial pathogen to be discovered (Hansen 1873) - still remains uncultured in vitro. - over 1300 pseudogenes. Very long doubling time (2 weeks) Very low genetic diversity, very few SNPs: -Challenging for genotyping. -Optimal for re-sequencing projects and mapping. = several opportunities 2
3 PCR based M. leprae Genotyping SNPs - Excellent phylogeographic association - Very limited resolution (only 16 subtypes known) - Type 1(A,B,C,D), 2(E,F,G,H), 3(I,J,K,L,M) and 4(N,O,P). VNTRs - High resolution but limited phylogeographic association. - Intra-patient variability at different sites of infection. 3
4 Limitations of PCR-based genotyping Limited information - Targeted information and hence not comprehensive. - Many loci need to be investigated (Not effort-effective). Scarce amounts of gdna from an unculturable pathogen - Input of whole genome template for a few kb of information. - not a renewable approach (Empty tubes phenomenon). Genome-wide analysis (GENOME-Typing) offers great potential, given the improvements in sequencing technologies and sample prep methods (1-10 ng gdna). 4
5 Outline of the present study 1. DNA isolation directly from leprosy skin biopsies from diverse geographical areas (n=12) and medieval leprosy skeletons from Europe, yr old). 2. Library preparation and array-based capture of M. leprae DNA. 3. Sequencing and genome-wide comparison (medieval and modern M. leprae).
6 Geographic origins of samples NHDP63 3I v1 Zoonotic strain (NEJM 2011) * 3I strains European adna Jorgen_625 (Den), SK2 (UK) 4P Br4923 ** * 4N&4O * 2F strains European adna Refshale_1 (Den), 3077 (Sweden), SK8 (UK) 1A, 1D TN 3K 1A Thai53 N.Caledonia 1B, 3K, 3L
7 Leprosy deformities Leprosy deformities in hand fingers (1-3) destruction of joints (4-6) Complete drop of foot-fingers Maxillary alveolar bone resorption Rounding of nasal aperture, Porosity of mandibular bone
8 Sources and origins of the medieval M. leprae strains In collaboration with archeologists
9 Methods: Array- Capture for Whole Genome Sequencing (WGS)
10 WGS results 1. Genome wide coverage of 5 ancient and 7 modern strains (coverage of >80% of genome at > 10X). 2. Comparison with 4 reference strains 3. Detailed & Diverse Phylo-Geo-Chrono comparison: 16 genomes (separated by Evolution, Space, and Time): Phylogeny: from all four SNP types. Geographic: from all 5 continents. Chrono (Time): 1000 yr time span (10 th century ). As few as 755 SNPs, and 57 InDels. 10
11 Coverage stats of modern M. leprae strains after array enrichment (on a single array, in multiplex) Patient Biopsy (Yr) % genome covered Av. fold coverage SNP type (Origin) S2 (1992) B (N. Caledonia) S9 (1996) K (N. Caledonia) S10 (2006) K (China) S11 (1990s) D (India) S13 (2012) N (Mali) S14 (2012) O (Mali) S15 (1992) L (N. Caledonia) Over 84% genome coverage at over 10x depth 11
12 Coverage stats of ancient M. leprae strains Skeleton ID % genome covered Av. fold coverage SNP type/origin Radiodate F (Sweden) 938 ± 19 yr BP SK F (UK) 932 ± 70 yr BP Refshale_ F (Denmark) 909 ± 24 yr BP SK I (UK) 950 ± 70 yr BP Jorgen_ I (Denmark) 644 ± 23 yr BP SNP type 2F strains are reported from patients in Turkey and Iran and SNP type 3I strains are predominant in Americas. 12
13 Phylogenetic relationship of M. leprae genomes & divergence times ~3400 yrs Branch 2 strains (2F) are currently reported from Middle East. Branch 3 strains (3I) are found in Americas, (almost identical to zoonotic v1 strain from southern US (Truman et al NEJM 2011). 300 yrs
14 Genome-Typing for revealing strain specific features of the biology of a pathogen 10 NEW pseudogenes were identified in various strains. Premature stop codons by SNPs. Frameshift caused by Insertion/Deletion events (InDels). Drug resistance mutations Thr53Ile in folp1 (Dapsone Resistance mutation in 2 strains). High diversity in an immunodominant protein encoded by serine-rich antigen ML0411: 10 Non-Synonymous SNPs = immune pressure from the host? (Also reported recently in M. leprae Kyoto-2 genome from Japan (Kai et al, Infect Genet Evol 2013). 14
15 Important findings by genome scale comparisons 1. No major variations in M. leprae in past 1000 yrs. No evidences of change in the virulence/adaptability etc. Sudden decline of leprosy in Europe in 14 th century was NOT due to the medieval European strain of M. leprae losing virulence. 2. Confirmation of European origin of Leprosy in Americas. 3. Link between medieval European strains and those currently reported from the Middle East. (SNP type 2F strains of Iran & Turkey were present in medieval skeletons from 3 European countries). 15
16 Why genome-typing instead of genotyping? Comprehensive information All in one: - Genotyping. - Molecular drug susceptibility testing. - Detailed phylogeny. - Identification of any additional pseudogenes in a strain. - Uniform experimental approach for all strains. - Genome scale investigations into the biology of a strain. Why not performed routinely then? - Costs and technical difficulties. - streamlining of bioinformatic analysis needed. 16
17 Acknowledgements Stewart Cole Andrej Benjak, Philippe Busso, all other members of Prof Cole lab (UPCOL). Univ. of Surrey: GM Taylor, GR Stewart, TA Mendum. Tuebingen: Johannes Krause Lab (Verena Schuenemann & Kirsten Bos) Kay Nieselt Lab (Alexander Herbig, Günter Jäger). Christos (Swedish adna), Ben Kyora (Danish adna) Teams of Dr Samba Sow for samples from Mali, C. Johnson from Benin and collaborators from Niger. Ongoing studies using array capture approach: Milton Moraes, Luciana, P Suffys and Dr Samira Buhrer-Sekula and their teams All patients, clinicians and researchers for contributing clinical samples & relevant details. Brazil Swiss Joint Research Project Thank you for your attention 17
18 Thank you for your attention!
Mycobacterium lepromatosis Infections in Nuevo León, México
JCM Accepted Manuscript Posted Online 25 March 2015 J. Clin. Microbiol. doi:10.1128/jcm.03667-14 Copyright 2015, American Society for Microbiology. All Rights Reserved. 1 1 2 3 4 5 6 7 8 9 10 11 12 13
More informationExploring the evolution of MRSA with Whole Genome Sequencing
Exploring the evolution of MRSA with Whole Genome Sequencing PhD student: Zheng WANG Supervisor: Professor Margaret IP Department of Microbiology, CUHK Joint Graduate Seminar Department of Microbiology,
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationProbable Zoonotic Leprosy in the Southern United States
T h e n e w e ngl a nd j o u r na l o f m e dic i n e original article Probable Zoonotic Leprosy in the Southern United States Richard W. Truman, Ph.D., Pushpendra Singh, Ph.D., Rahul Sharma, Ph.D., Philippe
More informationHow Is TB Transmitted? Sébastien Gagneux, PhD 20 th March, 2008
How Is TB Transmitted? Sébastien Gagneux, PhD 20 th March, 2008 Today s Outline 1) Global spread of Mtb Comparative genomics Phylogeny 2) Transmission of drug-resistant Mtb Fitness assays Molecular epidemiology
More informationOIE Situation Report for Highly Pathogenic Avian Influenza
OIE Situation Report for Highly Pathogenic Avian Influenza Latest update: 28/02/2018 The epidemiology of avian influenza is complex. The virus constantly evolves and the behavior of each new subtype (and
More informationMulti-clonal origin of macrolide-resistant Mycoplasma pneumoniae isolates. determined by multiple-locus variable-number tandem-repeat analysis
JCM Accepts, published online ahead of print on 30 May 2012 J. Clin. Microbiol. doi:10.1128/jcm.00678-12 Copyright 2012, American Society for Microbiology. All Rights Reserved. 1 2 Multi-clonal origin
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationInvestigating rare diseases with Agilent NGS solutions
Investigating rare diseases with Agilent NGS solutions Chitra Kotwaliwale, Ph.D. 1 Rare diseases affect 350 million people worldwide 7,000 rare diseases 80% are genetic 60 million affected in the US, Europe
More informationIso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing
Iso-Seq Method Updates and Target Enrichment Without Amplification for SMRT Sequencing PacBio Americas User Group Meeting Sample Prep Workshop June.27.2017 Tyson Clark, Ph.D. For Research Use Only. Not
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationDetails of HPV-based Cervical Cancer Screening in Turkey
Details of HPV-based Cervical Cancer Screening in Turkey Murat Gultekin, MD, Assoc. Prof., Gyn Oncol Divison Cervical Cancer in Turkey Incidence: 4-5 /100.000 (Years 2004-2015) Annual New Cases: 1.800
More informationOIE Situation Report for Avian Influenza
OIE Situation Report for Avian Influenza Latest update: 25/01/2018 The epidemiology of avian influenza is complex. The virus constantly evolves and the behavior of each new subtype (and strains within
More informationEPIDEMIOLOGY. Accurate, in-depth information for understanding and assessing targeted markets
EPIDEMIOLOGY Accurate, in-depth information for understanding and assessing targeted markets WHY ACCURATE MARKET FORECASTS Start with accurate understanding Epidemiology is the study of disease patterns
More informationOIE Situation Report for Highly Pathogenic Avian Influenza
OIE Situation Report for Highly Pathogenic Avian Influenza Latest update: 31/05/2018 The epidemiology of avian influenza (AI) is complex. The AI virus constantly evolves by mutation and re-assortment with
More informationEnriched RWE study in the Nordics a case study
Enriched RWE study in the Nordics a case study RWD conf. Helsinki, November 28, 2018 Susanne Kihlblom, MSc Pharm., Diplom.Clin.Trials Copyright 2017 IQVIA. All rights reserved. IQVIA 2017. All rights reserved.
More informationGenomic structural variation
Genomic structural variation Mario Cáceres The new genomic variation DNA sequence differs across individuals much more than researchers had suspected through structural changes A huge amount of structural
More informationIncidence of Leprosy Real or Relative?
IOSR Journal of Dental and Medical Sciences (IOSR-JDMS) e-issn: 2279-0853, p-issn: 2279-0861.Volume 16, Issue 5 Ver. V (May. 2017), PP 43-47 www.iosrjournals.org Incidence of Leprosy Real or Relative?
More informationNGS for Cancer Predisposition
NGS for Cancer Predisposition Colin Pritchard MD, PhD University of Washington Dept. of Lab Medicine AMP Companion Society Meeting USCAP Boston March 22, 2015 Disclosures I am an employee of the University
More informationEvolution of influenza
Evolution of influenza Today: 1. Global health impact of flu - why should we care? 2. - what are the components of the virus and how do they change? 3. Where does influenza come from? - are there animal
More informationSurveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change!
Surveillance and outbreak investigation of Shiga toxin-producing Escherichia coli using whole genome sequencing- time for a change! Dr Marie Anne Chattaway Deputy Head STEC Laboratory Gastrointestinal
More informationEstimates for the mutation rates of spoligotypes and VNTR types of Mycobacterium tuberculosis
Estimates for the mutation rates of spoligotypes and VNTR types of Mycobacterium tuberculosis Josephine F. Reyes and Mark M. Tanaka November 30, 2009 1/21 Understanding diversity in bacterial pathogens
More informationNGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation
NGS in Cancer Pathology After the Microscope: From Nucleic Acid to Interpretation Michael R. Rossi, PhD, FACMG Assistant Professor Division of Cancer Biology, Department of Radiation Oncology Department
More informationNGS in tissue and liquid biopsy
NGS in tissue and liquid biopsy Ana Vivancos, PhD Referencias So, why NGS in the clinics? 2000 Sanger Sequencing (1977-) 2016 NGS (2006-) ABIPrism (Applied Biosystems) Up to 2304 per day (96 sequences
More informationHBV. Next Generation Sequencing, data analysis and reporting. Presenter Leen-Jan van Doorn
HBV Next Generation Sequencing, data analysis and reporting Presenter Leen-Jan van Doorn HBV Forum 3 October 24 th, 2017 Marriott Marquis, Washington DC www.forumresearch.org HBV Biomarkers HBV biomarkers:
More informationOIE Situation Report for Highly Pathogenic Avian Influenza
OIE Situation Report for Highly Pathogenic Avian Influenza Latest update: 30/06/2018 The epidemiology of avian influenza (AI) is complex. The AI virus constantly evolves by mutation and re-assortment with
More informationTB trends and TB genotyping
Management of a TB Contact Investigation for Public Health Workers Albuquerque, NM October 1, 214 TB trends and TB genotyping Marcos Burgos MD October 1, 214 Marcos Burgos, MD has the following disclosures
More informationMPS for translocations
MPS for translocations Filip Van Nieuwerburgh, Ph.D. Lab of Pharmaceutical Biotechnology NXTGNT massively parallel sequencing facility, Ghent University In collaboration with: Center for Medical Genetics,
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationOIE Situation Report for Avian Influenza
OIE Situation Report for Avian Influenza Latest update: 24/04/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening
More informationTo test the possible source of the HBV infection outside the study family, we searched the Genbank
Supplementary Discussion The source of hepatitis B virus infection To test the possible source of the HBV infection outside the study family, we searched the Genbank and HBV Database (http://hbvdb.ibcp.fr),
More informationOIE Situation Report for Avian Influenza
OIE Situation Report for Avian Influenza Latest update: 08/05/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening
More informationSequence analysis for VP4 of enterovirus 71 isolated in Beijing during 2007 to 2008
16 2009 3 4 1 Journal of Microbes and Infection, March 2009, Vol. 4, No. 1 2007 2008 71 VP4 1, 2, 2, 2, 1, 2, 2, 2, 1, 2 1., 100730; 2., 100020 : 2007 2008 71 ( EV71), 2007 3 EV71( 1, 2 ) 2008 5 EV71(
More informationInfluenza Update N 157
Influenza Update N 157 13 April 2012 Summary In most areas of the northern hemisphere temperate regions, influenza activity appears to have peaked and is declining. In North America, influenza indicators
More informationHuman leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis
Human leukocyte antigen-b27 alleles in Xinjiang Uygur patients with ankylosing spondylitis H.-Y. Zou, W.-Z. Yu, Z. Wang, J. He and M. Jiao Institute of Clinical Medicine, Urumqi General Hospital, Lanzhou
More informationBenefits and pitfalls of new genetic tests
Benefits and pitfalls of new genetic tests Amanda Krause Division of Human Genetics, NHLS and University of the Witwatersrand Definition of Genetic Testing the analysis of human DNA, RNA, chromosomes,
More informationRecommended composition of influenza virus vaccines for use in the 2007 influenza season
Recommended composition of influenza virus vaccines for use in the 2007 influenza season September 2006 This recommendation relates to the composition of vaccines for the forthcoming winter in the southern
More informationEbola Virus. Emerging Diseases. Biosciences in the 21 st Century Dr. Amber Rice December 4, 2017
Ebola Virus Emerging Diseases Biosciences in the 21 st Century Dr. Amber Rice December 4, 2017 Outline Disease emergence: a case study How do pathogens shift hosts? Evolution within hosts: The evolution
More informationWhat can pathogen phylogenetics tell us about cross-species transmission?
The Boyd Orr Centre for Population and Ecosystem Health What can pathogen phylogenetics tell us about cross-species transmission? Roman Biek! Bovine TB workshop 3 Sep 2015 Talk outline Genetic tracking
More informationThe association of and -related gastroduodenal diseases
The association of and -related gastroduodenal diseases N. R. Hussein To cite this version: N. R. Hussein. The association of and -related gastroduodenal diseases. European Journal of Clinical Microbiology
More informationhttp://www.ibs.upm.edu.my Challenges in controlling viral diseases of poultry Abdul Rahman Omar Institute of Bioscience Faculty of Veterinary Medicine Universiti Putra Malaysia aro@upm.edu.my Outline of
More informationLiquid biopsy in lung cancer: The EGFR paradigm
Liquid biopsy in lung cancer: The EGFR paradigm Lynette M. Sholl, M.D. Brigham and Women s Hospital Dana Farber Cancer Institute Department of Pathology Boston, MA Disclosure of Relevant Financial Relationships
More informationFluxion Biosciences and Swift Biosciences Somatic variant detection from liquid biopsy samples using targeted NGS
APPLICATION NOTE Fluxion Biosciences and Swift Biosciences OVERVIEW This application note describes a robust method for detecting somatic mutations from liquid biopsy samples by combining circulating tumor
More informationMultiplex target enrichment using DNA indexing for ultra-high throughput variant detection
Multiplex target enrichment using DNA indexing for ultra-high throughput variant detection Dr Elaine Kenny Neuropsychiatric Genetics Research Group Institute of Molecular Medicine Trinity College Dublin
More informationDr. Emanuele Campese
Genotyping of Bacillus anthracis Strains Circulating in Albania Dr. Emanuele Campese Istituto Zooprofilattico Sperimentale of Puglia and Basilicata National Reference Center for Anthrax - Italy Anthrax
More informationCRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery
CRISPR/Cas9 Enrichment and Long-read WGS for Structural Variant Discovery PacBio CoLab Session October 20, 2017 For Research Use Only. Not for use in diagnostics procedures. Copyright 2017 by Pacific Biosciences
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationTuberculosis Past. Jaap T. van Dissel. National Institute for Public Health and the Environment RIVM Bilthoven The Netherlands
Tuberculosis Past Jaap T. van Dissel National Institute for Public Health and the Environment RIVM Bilthoven The Netherlands Tuberculosis Past no financial disclosures Jaap T. van Dissel National Institute
More informationGenetic Counselling in relation to genetic testing
Genetic Counselling in relation to genetic testing Dr Julie Vogt Consultant Geneticist West Midlands Regional Genetics Service September 2016 Disclosures for Research Support/P.I. Employee Consultant Major
More informationNational Survey of Drug-Resistant Tuberculosis in China Dr. Yanlin Zhao
National Survey of Drug-Resistant Tuberculosis in China Dr. Yanlin Zhao National Centre for Tuberculosis Control and Prevention of China CDC National TB Reference Laboratory, China CDC BACKGROUND China
More informationGlobal End Stage Renal Disease (ESRD) Market With Focus on Dialysis Market ( Edition) July 2017
Global End Stage Renal Disease (ESRD) Market With Focus on Dialysis Market (2017-2021 Edition) July 2017 Scope of the Report Global End Stage Renal Disease Market The report titled Global End Stage Renal
More informationMI Flu Focus. Influenza Surveillance Updates Bureaus of Epidemiology and Laboratories
MI Flu Focus Influenza Surveillance Updates Bureaus of Epidemiology and Laboratories Editor: Susan Peters, DVM PetersS1@michigan.gov January 3, 2013 Surveillance and Infectious Disease Epidemiology Vol.
More informationOIE Situation Report for Avian Influenza
OIE Situation Report for Avian Influenza Latest update: 18/09/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening
More informationSCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA. Giuseppe Narzisi, PhD Schatz Lab
SCALPEL MICRO-ASSEMBLY APPROACH TO DETECT INDELS WITHIN EXOME-CAPTURE DATA Giuseppe Narzisi, PhD Schatz Lab November 14, 2013 Micro-Assembly Approach to detect INDELs 2 Outline Scalpel micro-assembly pipeline
More informationGolden Helix s End-to-End Solution for Clinical Labs
Golden Helix s End-to-End Solution for Clinical Labs Steven Hystad - Field Application Scientist Nathan Fortier Senior Software Engineer 20 most promising Biotech Technology Providers Top 10 Analytics
More informationPreparing for the Fall Flu Season. Jonathan Gubbay Medical Microbiologist Public Health Laboratory OAHPP
Preparing for the Fall Flu Season Laboratory Perspective Jonathan Gubbay Medical Microbiologist Public Health Laboratory OAHPP September 21, 2009 Objectives 1. Review the emergence of Novel Influenza A
More informationWhole genome sequencing identifies zoonotic transmission of MRSA isolates with the novel meca homologue mecc
Whole genome sequencing identifies zoonotic transmission of MRSA isolates with the novel meca homologue mecc Ewan M. Harrison, Gavin K. Paterson, Matthew T.G. Holden, Jesper Larsen, Marc Stegger, Anders
More informationEmerging Diseases. Biosciences in the 21 st Century Dr. Amber Rice October 26, 2012
Emerging Diseases Biosciences in the 21 st Century Dr. Amber Rice October 26, 2012 Outline Disease emergence: a case study Introduction to phylogenetic trees Introduction to natural selection How do pathogens
More informationin control group 7, , , ,
Q1 Rotavirus is a major cause of severe gastroenteritis among young children. Each year, rotavirus causes >500,000 deaths worldwide among infants and very young children, with 90% of these deaths occurring
More informationRecommended composition of influenza virus vaccines for use in the influenza season
Recommended composition of influenza virus vaccines for use in the 2006 2007 influenza season This recommendation relates to the composition of vaccines for the forthcoming influenza season in the northern
More informationMYCOBACTERIA. Pulmonary T.B. (infect bird)
MYCOBACTERIA SPP. Reservoir Clinical Manifestation Mycobacterium tuberculosis Human Pulmonary and dissem. T.B. M. lepra Human Leprosy M. bovis Human & cattle T.B. like infection M. avium Soil, water, birds,
More informationUnderstanding Gallibacterium-Associated Peritonitis in the Commercial Egg-Laying Industry
Understanding Gallibacterium-Associated Peritonitis in the Commercial Egg-Laying Industry Timothy J. Johnson A, Lisa K. Nolan B, and Darrell W. Trampel C A University of Minnesota, Department of Veterinary
More informationInvestigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains
Investigation of the genetic differences between bovine herpesvirus type 1 variants and vaccine strains Name: Claire Ostertag-Hill Mentor: Dr. Ling Jin Bovine herpesvirus Bovine herpesvirus-1 (BHV-1) Pathogen
More informationP. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University.
Databases and Tools for High Throughput Sequencing Analysis P. Tang ( 鄧致剛 ); PJ Huang ( 黄栢榕 ) g( ); g ( ) Bioinformatics Center, Chang Gung University. HTseq Platforms Applications on Biomedical Sciences
More informationCurrent Vaccines: Progress & Challenges. Influenza Vaccine what are the challenges?
Current Vaccines: Progress & Challenges Influenza Vaccine what are the challenges? Professor John S. Tam The Hong Kong Polytechnic University Asia-Pacific Alliance for the Control of Influenza (APACI)
More informationEnterprise Interest Thermo Fisher Scientific / Employee
Enterprise Interest Thermo Fisher Scientific / Employee A next-generation sequencing assay to estimate tumor mutation load from FFPE research samples Fiona Hyland. Director of R&D, Bioinformatics Clinical
More informationNGS and WGS in RNA virus pathogenesis
Serology & NGS and WGS in RNA virus pathogenesis Ki Wook Kim, Sonia Isaacs, Sacha Stelzer-Braid, Jessica Horton, Junipearl Cheng, William D. Rawlinson, and Maria E. Craig. UNSW Virology Research Laboratory
More informationPatterns of hemagglutinin evolution and the epidemiology of influenza
2 8 US Annual Mortality Rate All causes Infectious Disease Patterns of hemagglutinin evolution and the epidemiology of influenza DIMACS Working Group on Genetics and Evolution of Pathogens, 25 Nov 3 Deaths
More informationInter-country mixing in HIV transmission clusters: A pan-european phylodynamic study
Inter-country mixing in HIV transmission clusters: A pan-european phylodynamic study Prabhav Kalaghatgi Max Planck Institute for Informatics March 20th 2013 HIV epidemic (2009) Prabhav Kalaghatgi 2/18
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationAn update on the laboratory detection and epidemiology of astrovirus, adenovirus, sapovirus, and enterovirus in gastrointestinal disease
An update on the laboratory detection and epidemiology of astrovirus, adenovirus, sapovirus, and enterovirus in gastrointestinal disease Christopher McIver, Principal Hospital Scientist, Microbiology Department
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationA ten-year evolution of a multidrugresistant tuberculosis (MDR-TB) outbreak in an HIV-negative context, Tunisia ( )
A ten-year evolution of a multidrugresistant tuberculosis (MDR-TB) outbreak in an HIV-negative context, Tunisia (2001-2011) Naira Dekhil 1, Besma Mhenni 1, Raja Haltiti 2, and Helmi Mardassi 1 (speaker)
More informationAvian influenza - current situation and future trends
Avian influenza - current situation and future trends Calogero Terregino OIE, FAO and National Reference Laboratory for Newcastle Disease and Avian Influenza, Istituto Zooprofilattico Sperimentale delle
More informationPandemic H1N Dr. Maria Neira Global Influenza Programme WHO, Geneva
Pandemic H1N1 2010 Dr. Maria Neira Global Influenza Programme WHO, Geneva WHO Role during pandemic (H1N1) 2009 Under the International Health Regulations (2005) Detect event (notification by Member States
More informationEvaluation of MIA FORA NGS HLA test and software. Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More information2/10/2016. Evaluation of MIA FORA NGS HLA test and software. Disclosure. NGS-HLA typing requirements for the Stanford Blood Center
Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents,
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For certain patients the combination of symptoms does not allow
More informationMolecular Epidemiology of Tuberculosis. Kathy DeRiemer, PhD, MPH School of Medicine University of California, Davis
Molecular Epidemiology of Tuberculosis Kathy DeRiemer, PhD, MPH School of Medicine University of California, Davis Overview TB transmission and pathogenesis Genotyping methods Genotyping for clinical management
More informationLyme Disease and Tick Surveillance in British Columbia
Lyme Disease and Tick Surveillance in British Columbia Muhammad Morshed, PhD, SCCM Program Head, Zoonotic Diseases & Emerging Pathogens BCCDC Public Health Microbiology and Reference Laboratory Provincial
More informationContribution of avian influenza data through OFFLU network
Dr Gounalan Pavade Chargé de Mission, OIE Headquarters Contribution of avian influenza data through OFFLU network Asia-Pacific Workshop on surveillance, prevention and control of zoonotic influenza Paro,
More informationName: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise!
Name: Due on Wensday, December 7th Bioinformatics Take Home Exam #9 Pick one most correct answer, unless stated otherwise! 1. What process brought 2 divergent chlorophylls into the ancestor of the cyanobacteria,
More informationaward M. tuberculosis T cell epitope analysis reveals paucity of antigenic variation and identifies rare variable TB antigens Mireia Coscolla
award M. tuberculosis T cell epitope analysis reveals paucity of antigenic variation and identifies rare variable TB antigens Mireia Coscolla Lausanne 16.06.2016 TB today TB is the 2nd bigest killer disease.6
More informationPractical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs
Practical challenges that copy number variation and whole genome sequencing create for genetic diagnostic labs Joris Vermeesch, Center for Human Genetics K.U.Leuven, Belgium ESHG June 11, 2010 When and
More informationCentoXome FUTURE'S KNOWLEDGE APPLIED TODAY
CentoXome FUTURE'S KNOWLEDGE APPLIED TODAY More genetic information requires cutting-edge interpretation techniques Whole Exome Sequencing For some patients, the combination of symptoms does not allow
More informationViral genome sequencing: applications to clinical management and public health. Professor Judy Breuer
Viral genome sequencing: applications to clinical management and public health Professor Judy Breuer Why do whole viral genome sequencing Genome sequencing allows detection of multigenic resistance in
More informationUpdate to Public Health Reporting and National Notification for Hansen s disease
12-ID-01 Committee: Infectious Disease Title: Update to Public Health Reporting and National Notification for Hansen s disease I. Statement of the Problem For many years, CDC s Hansen s disease surveillance
More informationHIV-1 Subtypes: An Overview. Anna Maria Geretti Royal Free Hospital
HIV-1 Subtypes: An Overview Anna Maria Geretti Royal Free Hospital Group M Subtypes A (1, 2, 3) B C D F (1, 2) G H J K Mechanisms of HIV-1 genetic diversification Point mutations RT error rate: ~1 per
More informationAdvanced Molecular Detection: An Overview
Advanced Molecular Detection: An Overview Gregory Armstrong, MD Director Office of Advanced Molecular Detection National Center for Emerging and Zoonotic Infectious Diseases Office of Advanced Molecular
More informationGenetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response. Ray White Verona March
Genetic Approaches to Alcoholism, Alcohol Abuse Susceptibility, and Therapeutic Response Ray White Verona March 18. 2008 Craig Venter Genome 2,810,000,000 bases, 7.5-fold coverage 3,213,401 SNPs 85% in
More informationIMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION
National Center for HIV/AIDS, Viral Hepatitis, STD, and TB Prevention IMPLEMENTATION OF GHOST FOR HAV OUTBREAK DETECTION Sumathi Ramachandran,MS,MPH,PHD Molecular Epidemiology and Bioinformatics Team Division
More informationOIE Situation Report for Avian Influenza
OIE Situation Report for Avian Influenza Latest update: 10/07/2017 This report presents an overview of current disease events reported to the OIE by its Members. The objective is to describe what is happening
More informationHOST-PARASITE INTERPLAY
HOST-PARASITE INTERPLAY Adriano Casulli EURLP, ISS (Rome, Italy) HOST-PARASITE INTERPLAY WP3 (parasite virulence vs human immunity) (Parasite) Task 3.1: Genotypic characterization Task 3.6: Transcriptome
More informationChronic HIV-1 Infection Frequently Fails to Protect against Superinfection
Chronic HIV-1 Infection Frequently Fails to Protect against Superinfection Anne Piantadosi 1,2[, Bhavna Chohan 1,2[, Vrasha Chohan 3, R. Scott McClelland 3,4,5, Julie Overbaugh 1,2* 1 Division of Human
More informationNew methods for embryo selection: NGS and MitoGrade
New methods for embryo selection: NGS and MitoGrade Santiago Munné, PhD US: Livingston, Los Angeles, Chicago, Portland, Miami / Europe: Barcelona (Spain), Oxford (UK), Hamburg (Germany) / Asia: Kobe (Japan),
More informationM. tuberculosis as seen from M. avium.
M. tuberculosis as seen from M. avium Marcel A. Behr marcel.behr@mcgill.ca www.molepi.mcgill.ca Overview Classic view of M. tuberculosis Reductive genomics M. avium work Evidence for horizontal gene transfer
More informationInhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors
Inhibition of Cdk5 Promotes β-cell Differentiation from Ductal Progenitors Ka-Cheuk Liu, Gunter Leuckx, Daisuke Sakano, Philip A. Seymour, Charlotte L. Mattsson, Linn Rautio, Willem Staels, Yannick Verdonck,
More informationBWA alignment to reference transcriptome and genome. Convert transcriptome mappings back to genome space
Whole genome sequencing Whole exome sequencing BWA alignment to reference transcriptome and genome Convert transcriptome mappings back to genome space genomes Filter on MQ, distance, Cigar string Annotate
More informationAn Evolutionary Story about HIV
An Evolutionary Story about HIV Charles Goodnight University of Vermont Based on Freeman and Herron Evolutionary Analysis The Aids Epidemic HIV has infected 60 million people. 1/3 have died so far Worst
More informationLeprosy. Mycobacteriumleprae
Leprosy Mycobacteriumleprae Quick Reference Environment: human, mice, nine-banded armadillo Microorganism: Gram + rod Spore former: NO Motile: NO Susceptibility: anyone Communicability: infectious Exposure:
More information