Study on Association of Peroxisome Proliferator-Activated Receptor

Transcription

1 Originl Article Study on Assocition of Peroxisome Prolifertor-Activted Receptor Chinese Hn Su-Qin Zhng MD 1, Ge-Lin Li MD 1, Yu-Feng Liu MD 1 1 Abstrct Bckground: Methods: - Results: - stndrd error ws (P P - Conclusions: Keywords: Cite this rticle s: gene gene interction in Chinese Hn. Arch Irn Med. 2015; 18(11): Introduction I riety of diseses, including insulin resistnce, type 2 dibetes mellitus (DM2), ftty liver nd crdiovsculr disese (CVD). 1 moleculr meditors cpble of ctivting, or suppressing, nd numerous trnscription fctors hve been reported in recent yers, such s peroxisome prolifertor-ctivted receptors (PPARs). 2,3 PPARs tht were orphn nucler receptors belong to the steroid, retinoid, nd thyroid hormone receptor super-fmily of ligndctivted trnscription fctors. 4,5 Three subtypes hve been chr- 6 7,8 gene is locted on chromosome 22q12 q13.1, nd it spnned bout 93kb, including 8 exons which could encode protein of 1 of Zhengzhou University, Henn, Chin. Zhengzhou University, the Jinshedong Rod NO. 1, Zhengzhou City, Henn Province, P. O. Box: Tel ; E-mil: liyuqin33333@163. com. Accepted for publiction: 2 September 2015 mny orgns, such s hert, liver, skeletl muscle nd kidney. The in mcrophge fom cells but lso in vsculr endothelium. The considered s the min role in these cells. C-rective protein (CRP), plsm protein synthesized by the tion, 9 both clinicl nd genetic fctors. 10 The fmily study hs suggested tht genetic fctors ccount for 27% 40 % of the vrince in CRP level, 11 suggesting role for genetic vrition in determining serum levels. PPARs hve ttrcted enormous ttention on were rrely studied. So in this study, we sought to exmine the s- the dditionl interction mong the 6 SNPs. Mterils nd Methods Subjects This ws cross-sectionl study. Chinese prticipnts were consecutively recruited between Jnury 2012 nd December A totl of 1320 subjects were included in investigted popultion. - Archives of Irnin Medicine, Volume 18, Number 11, November

2 cuse of ny resons ws excluded, including subjects with infection (n = 22), trum (n = 19) nd ny other fctor (n = 9), nd CRP were missing (n = 10). At lst, totl of 1260 subjects (583 men, 677 women) were included in the study, including the genotyping of polymorphisms, The men ge of ll prticipnts between the selected subjects nd those who were not selected in terms of ge, sex, smoking sttus, nd lcohol consumption. Informed consent ws obtined from ll prticipnts. Body Mesurements Dt on demogrphic informtion, lifestyle risk fctors for ll prticipnts were obtined using stndrd questionnire dministered by trined stffs. Body weight nd height were mesured ccording to stndrdized procedures. 12 Body mss index (BMI) ws clculted s weight in kilogrms divided by the squre of the height in meters. Cigrette smokers were those who self-reported smoking cigrettes t lest once dy for 1 yer or more. Alcohol consumption ws expressed s the sum of milliliters of lcohol per week from wine, beer, nd spirits. Blood smples were collected in the morning fter t lest 8 hours of fsting. All plsm nd serum smples were frozen t 80 C until lbortory testing. Plsm glucose ws mesured using n oxidse enzymtic method. Prticle enhnced immune ltex gglutintion high sensitive ssy ws used to detect CRP level, nd the Humn C-Rective Protein- ELISA Kit Regent box (Shnghi EXcell biology, Inc., Shnghi, Chin) ws used. All nlysis ws performed by the sme lb. Genomic DNA extrction nd genotyping ing methods: 1) previously reported ssocitions with metbolic bnormlities; 2) known heterozygosity nd minor llele fre- were selected for genotyping in the study: rs135539, rs135551, rs135549, rs , rs , nd rs Genomic DNA from prticipnts ws extrcted from EDTA-treted whole blood, using the DNA Blood Mini Kit (Qigen, Hilden, Germny) ccording to the mnufcturer s instructions. All SNPs were detected by Tqmn ntion procedure were used for genotyping of fore-mentioned six - DNA, nd the conditions were s follows: initil denturtion for 10 min nd 95 C, denturtion for 15 seconds nd 92 C, nneling nd extension for 90 seconds nd 60 C, 50 cycles. Probe sequences of ll SNPs were shown in Tble 1. Sttisticl nlysis The men nd stndrd devition (SD) for normlly distributed continuous vribles, nd percentges for ctegoricl vrible, were clculted nd compred. The genotype nd llele frequencies were obtined by direct count. The ctegoricl dt 2 test or the Fisher exct test if necessry. Further, continuous vribles were nlyzed using Student s t-test or one-wy nlysis of vrince, followed by the lest sig- groups. Hrdy-Weinberg equilibrium (HWE) ws performed by using SNPStts (vilble online t SNPstts). Liner regression nlysis ws performed to verify the polymorphism ssocition between SNP with CRP levels. Logistic regression ws used to test the interction mong different SNPs, using gender, ge, smoking nd lcohol sttus, s well s physicl ctivity s covrites in the model. And those less thn Generlized MDR (GMDR) 13 ws employed to nlysis the interction mong six SNPs, some prmeters were clculted, including the testing blnced ccurcy, cross-vlidtion consistency, nd the sign test. The cross-vlidtion consistency score is mesure of the degree of consistency with which the selected considered. The testing blnced ccurcy is mesure of the degree to which the interction ccurtely predicts cse control sttus with scores between 0.50 (indicting tht the model predicts no better thn chnce) nd 1.00 (indicting perfect prediction). Finlly, sign test or permuttion test (providing empiricl P-vlues) for prediction ccurcy cn be used to mesure the sig- Results A totl of 1260 subjects (583 men, 677 women), with men ge of 41.3 ± 14.6 yers old, were selected. Minor llele frequencies of rs135539, rs135551, rs135549, rs , rs , nd rs were 25.2%, 22.5%, 23.2%, 23.3%, 23.9%, nd Tble 1. SNP ID Chromosome Exon/Intron Nucleotide substitution Probe sequence rs : Intron A>C rs : Intron G>A 5 -AGCAGAATTTAAATCCTAGGTGATT[A/C] TTAACTCTAATCATACATCTAATGA-3 5 -TCTGCCCTCAAGGAGTTAGACTCAG[C/T] GAGGACAGTCAGACTAACAGAAACA-3 rs : Intron T>C rs : Exon L>V rs : Exon G>C rs : Intron A>G 5 -CTCTCTCTCAGTCTAGGTGTGGGGG[A/G] AGCTGCAGAGGTCTGGGACAATTTC-3 5 -CCAGTATTGTCGATTTCACAAGTGC[C/G] TTTCTGTCGGGATGTCACACAACGG-3 5 CAGGAGGGTATTGTACATGTGCTCA[C/G] ACTCCACCTGCAGAGCAACCACCCG-3 5 -CAGAATATAAAAAAGAAACTTAAAG[A/G] TAATCCTCATCATGGTAAAAGATGA Archives of Irnin Medicine, Volume 18, Number 11, November 2015

3 Tble 2. The genotype nd llelic frequencies distribution in the ll subjects SNPs Genotypes nd Alleles Frequencies N (MAF, %) HWE test AA 718 (57.0) AC 452 (35.9) rs CC 90 (7.0) A 1888 (74.9) C 632 (25.2) GG 746 (59.2) GA 460 (36.5) rs AA 54 (4.3) G 1952 (77.5) A 568 (22.5) TT 738 (58.6) TC 460 (36.5) rs CC 62 (4.9) T 1936 (76.8) C 584 (23.2) LL 741 (58.8) LV 453 (36.0) rs VV 66 (5.2) L 1935 (76.8) V 585 (23.2) GG 726 (57.6) GC 466 (37.0) rs CC 68 (5.4) G 1918 (76.1) C 602 (23.9) AA 749 (59.4) AG 448 (35.6) rs GG 63 (5.0) A 1946 (77.2) G 574 (22.8) Tble 3. SNP ID Genotypes CRP (mg/l) Stndrd error P-vlues rs AA 1.12 ± 2.58 AC+CC 0.81 ± rs GG 0.98 ± 2.12 GA+AA 0.95 ± rs TT 1.08 ± 1.59 TC+CC 0.84 ± < rs LL 1.47 ± 1.45 LV+VV 0.74 ± rs GG 1.02 ± 2.34 GC+CC 0.86 ± rs AA 1.07 ± 2.07 AG+GG 0.90 ± 2.23 Adjusted for gender, ge, smoke nd lcohol sttus, physicl ctivity Archives of Irnin Medicine, Volume 18, Number 11, November

4 Tble 4. Locus no. Best combintion Cross-vlidtion consistency Testing ccurcy P-vlues 2 rs rs / rs rs rs / rs rs rs rs / rs rs rs rs rs / rs rs rs rs rs rs / Adjusted for gender, ge, smoke nd lcohol sttus, physicl ctivity 22.8%, respectively. All genotypes were distributed ccording to Hrdy Weinberg equilibrium (ll P-vlues more thn 0.05) (Tble 2). Liner regression nlysis ws performed to determine the ssocition between 6 SNPs nd CRP level. Six SNPs were included in the liner regression nlysis, we found tht the CRP level ws lower in the subjects with minor lleles, compred to subjects tion between muttion of rs nd CRP. The crriers of the - stndrd error ws (P < 0.001). However, the other 5 SNPs fore or fter covrite djustment (Tble 3). We lso employed the GMDR nlysis to ssess the impct of the interction mong six SNPs, fter djustment for covrites including: gender, ge, smoke nd lcohol sttus, s well s physicl ctivity. Tble 4 summrizes the results obtined from GMDR nlysis for two- to six-locus models with covrites djustment. P = ) involving rs nd rs135539, indicting potentil gene gene interction between rs nd rs Overll, the two- locus models hd cross-vlidtion consistency of 10 of 10, nd hd the testing ccurcy of 55.9%. To obtin ORS nd 95% CIs for the joint effects of cndidte SNPs (rs nd rs135539) on CRP, we conducted interction nlysis mong SNPs in the 2-locus models. In the two-locus model, subjects with rs LV or VV nd rs CG or GG genotypes hve the lowest CRP level. The difference (95% CI) = (-0.67 to -0.26) (P < 0.001), fter covrites djustment for gender, ge, smoke nd lcohol sttus, physicl ctivity (Tble 5). Discussion PPARs re lignd-ctivted trnscription fctors belonging to the nucler hormone receptor superfmily1, which includes three phism nd C-rective protein level, however few studies involved cited with CRP level. The CRP level ws lower in subjects with minor lleles (LV or VV) thn subjects with LL genotype. The crriers of the V llele (LV + VV) of rs were ssocited 14 mtory response in mouse er-swelling model. Some studies 15,16 tivity. Belfort, et l. 17 significntly reduce plsm hscrp (bout 50%) levels. Kleemnn, et l. 18 suppress hucrp expression, nd reduce hucrp gene expression et l. 19 conducted similr study in Chinese popultion, found tht rs ws ssocited with lower CRP level. However, this reltion just existed in norml weight subjects. could inhibit the expression of cyclooxygense-2 nd produc- k B nd induction of poptosis. 20 bsed on up-regultion of NF- k B, I k k B promoter ctivity, 18 nd decrese expression levels of p50 NF- k B tion with p65 NF- k B, to inctive the NF- k B trnscription fctor pthwys. 21,22 - I k B. 18,23 It hs been suggested tht the genetic susceptibility of the pheno- Tble 5. Interction nlysis for two- locus models by using logistic regression rs rs Difference (95% CI) P-vlues LL CC LV or VV CC 0.29 (-0.18 to 0.76) 0.23 LL CG or GG (-0.61to ) 0.01 LV or VV CG or GG (-0.67 to -0.26) < Adjusted for gender, ge, smoke nd lcohol sttus, physicl ctivity 768 Archives of Irnin Medicine, Volume 18, Number 11, November 2015

5 type ws relted to multiple-gene, nd most of which were minor genes. For this reson, interction nlysis, mong six SNPs ws needed. We employed the GMDR nlysis to ssess the impct of the interction mong the six SNPs on CRP level with covri- one-locus model (P = ) involving rs nd rs135539, indicting potentil gene gene interction between rs nd rs In order to obtin ORs nd 95% CIs for the joint effects of cndidte SNPs (rs nd rs135539) on CRP, we conducted n interction nlysis mong SNPs in the 2-locus models. The results indicted tht subjects with rs LV or VV, rs CG or GG genotypes hve the lowest CRP level, compred to subjects with rs LL nd rs cc genotypes. In this study, lthough rs ws not ssocited with CRP level in the liner regression model, in the interction mny genes, nd the impct of one or two genes or SNPs ws very smll However, minor gene could provide strong effect for CRP, due to the existing of gene-gene interction. Limittions of this study should be considered. Firstly, only six - studies should include more SNPs, even the other PPAR isoforms, smple size of the study, though the number of study prticipnts met the requirement for nlysis, future studies should be conducted in different rces. In conclusion, our results support n importnt ssocition be- the results lso shown combined effect of gene-gene interction between rs nd rs on decresed CRP level. Acknowledgments Hospitl of Zhengzhou University. We thnk ll the prtners nd stffs who help us in the process of this study. References 1. Nt Med. 2009; 15: Leone TC, Weinheimer CJ, Kelly DP. A criticl role for the peroxisome prolifertor-ctivted receptor lph (PPAR lph) in the cellulr fsting response: the PPAR lph-null mouse s model of ftty cid oxidtion disorders. Proc Ntl Acd Sci USA. 1999; 96: Iizuk K, Horikw Y. ChREBP: glucose-ctivted trnscription fctor involved in the development of metbolic syndrome. Endocr J. 2008; 55: Bookout AL, Jeong Y, Downes M, Yu RT, Evns RM, Mngelsdorf rchicl trnscriptionl network. Cell. 2006; 126: Michlik L, Auwerx J, Berger JP, Chtterjee VK, Glss CK, Gonzlez FJ, et l. Interntionl Union of Phrmcology. LXI. Peroxisome prolifertor-ctivted receptors. Phrmcol Rev. 2006; 58: Guo L, Tbrizchi R. Peroxisome prolifertor-ctivted receptor gmm s drug trget in the pthogenesis of insulin resistnce. Phrmcol Ther. 2006; 111: Gonzlez FJ, Shh YM. PPAR lph: mechnism of species differences nd heptocrcinogenesis of peroxisome prolifertors. Toxicology. 2008; 246: Pyper SR, Viswkrm N, Yu S, Reddy JK. PPAR lph: energy combustion, hypolipidemi, infmmtion nd cncer. Nucl Recept Signl. 2010; 8: e Ridker PM, Hennekens CH, Buring JE, Rifi N. C-rective protein disese in women. N Engl J Med. 2000; 342: Ledue TB, Rifi N. Prenlytic nd nlytic sources of vritions in C- rective prote in mesurement: implictions for crdiovsculr disese risk ssessment. Clin Chem. 2003; 49(8): McGregor AJ, Gllimore JR, Spector TD, Pepys MB. Genetic effects on bseline vlues of C-rective protein nd serum myloid protein: comprison of monozygotic nd dizygotic twins. Clin Chem. 2004; 50(1): Lohmn T, Roche AF, Mrtorell R. Stndrdiztion of nthropometric mesurements. Chmpign, IL: Humn Kinetics; Lou XY, Chen GB, Yn L, M JZ, Zhu J, Elston RC, et l. A generlized combintoril pproch for detecting gene-by gene nd gene-byenvironment interctions with ppliction to nicotine dependence. Am J Hum Genet. 2007; 80(6): Mrx N, Duez H, Fruchrt JC, Stels B. Peroxisome prolifertor-ctivted receptors nd therogenesis: regultors of gene expression in vsculr cells. Circ Res. 2004; 94: Cpell WH, DeSouz CA, Poirier P, Bell ML, Stuffer BL, Weil KM, sodiltor function in subjects with hypertriglyceridemi. Arterioscler Thromb Vsc Biol. 2003; 23: biomrkers in metbolic syndrome ptients. Obesity. 2009; 17: cose Metbolism in Ptients with the Metbolic Syndrom. J Clin Endocrinol Metb. 2010; 95: Kleemnn R, Gervois PP, Verschuren L, Stels B, Princen HM, Kooistr T. Fibrtes down-regulte IL-1-stimulted C-rective protein gene expression in heptocytes by reducing nucler p50-nfkpp B-C/EBP-bet complex formtion. Blood. 2003; 101: Gu SJ, Chen DH, Guo ZR, Zhou ZY, Hu XS, Wu M. Effect of obesity on the ssocition between common vritions in the PPAR gene nd C-rective protein level in Chinese Hn popultion. Endocrine. 2015; 48(1): Chinetti G, Griglio S, Antonucci M, Torr IP, Delerive P, Mjd Z, et l. Activtion of prolifertor-ctivted receptors lph nd gmm induces poptosis of humn monocyte- derived mcrophges. J Biol Chem. 1988; 273: Delerive P, De Bosscher K, Besnrd S, Vnden Berghe W, Peters JM, Gonzlez FJ, et l. Peroxisome prolifertor-ctivted receptor lph tive cross-tlk with trnscription fctors NF-kppB nd AP-1. J Biol Chem. 1999; 274: Stels B, Koenig W, Hbib A, Mervl R, Lebret M, Torr IP, et l. Activtion of humn ortic smooth-muscle cells is inhibited by PPARlph but not by PPAR-gmm ctivtors. Nture. 1998; 393: Delerive P, Gervois P, Fruchrt JC, Stels B. Induction of IkppBl- ryctivities of peroxisome prolifertor-ctivted receptor-lph ctivtors. J Biol Chem. 2000; 275: Archives of Irnin Medicine, Volume 18, Number 11, November