UNIVERSITY OF CINCINNATI

Transcription

1 UNIVERSITY OF CINCINNATI Date: 1-Jun-2009 I, Jason G Barrera, hereby submit this original work as part of the requirements for the degree of: Doctor of Philosophy in Neuroscience/Medical Science Scholars Interdisciplinary It is entitled: The Role of Central Nervous System Glucagon-Like Peptide-1 in the Regulation of Energy Balance Student Signature: Jason G Barrera This work and its defense approved by: Committee Chair: Randy Seeley, PhD Randy Seeley, PhD David D'Alessio, MD David D'Alessio, MD Stephen Woods, PhD Stephen Woods, PhD Silvana Obici, MD Silvana Obici, MD James Herman, PhD James Herman, PhD 11/20/

2 The Role of Central Nervous System Glucagon-Like Peptide-1 in the Regulation of Energy Balance A dissertation submitted to the Division of Research and Advanced Studies of the University of Cincinnati in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY (Ph.D.) in the Graduate Program in Neuroscience of the College of Medicine June 1, 2009 By JASON G. BARRERA B.A. Miami University, Oxford, Ohio, USA, 2001 Dissertation Committee: Randy J. Seeley, Ph.D. (chair) Stephen C. Woods, Ph.D. David A. D Alessio, M.D. Silvana Obici, M.D. James P. Herman, Ph.D.

3 ABSTRACT Glucagon-like peptide-1 (GLP-1), a product of the preproglucagon (PPG) gene, is synthesized in the intestine and the nucleus of the solitary tract (NTS) and regulates numerous physiological processes, including glucose homeostasis and food intake. Exendin-4 (Ex4), a highly potent, long-acting GLP-1 receptor (GLP-1r) agonist, is used clinically for the treatment of type 2 diabetes mellitus (T2DM). Interestingly, in patients Ex4 not only improves glycemic control, but it also produces weight loss. This finding raises the possibility that the GLP-1 system may be a viable therapeutic target for obesity. To this end, the purpose of this dissertation was to further characterize the role of the central nervous system (CNS) GLP-1 system in the regulation of energy balance. Central administration of Ex4, like GLP-1, robustly reduces food intake. However, several lines of evidence suggest that Ex4 acts via distinct mechanisms. Therefore, we tested the hypothesis that the central anorectic effects of GLP-1 and Ex4 are different. Specifically, these effects, and their sensitivity to GLP-1r antagonists, were compared. In addition, the GLP-1r-dependence of central Ex4 was assessed in GLP-1r knockout (GLP-1r-/-) mice. Consistent with our hypothesis, central Ex4 reduced food intake at doses significantly lower than those required by GLP-1, and this effect was not blocked by GLP-1r antagonists. In contrast, GLP-1r antagonists completely blocked the anorectic effect of peripheral Ex4. Finally, central Ex4 failed to reduce food intake in GLP-1r-/- mice, indicating that this effect is in fact GLP-1r-dependent. Although these data underscore the fact that central GLP-1r agonism is sufficient to reduce food intake, the role of the endogenous CNS GLP-1 system in the regulation of energy balance remains unclear. Therefore, we tested the hypothesis that endogenous iii

4 CNS GLP-1 system activity is required for normal energy balance. Specifically, RNA interference was used to knock down NTS PPG, and chronic intracerebroventricular (ICV) infusion of the GLP-1r antagonist exendin (9-39) (Ex9) was used to block CNS GLP-1r. Consistent with our hypothesis, both NTS PPG knockdown and chronic ICV Ex9 resulted in hyperphagia. However, whereas NTS PPG knockdown exacerbated highfat diet-induced fat accumulation, chronic ICV Ex9 increased fat accumulation irrespective of diet. Finally, NTS PPG expression was found to correlate positively with fat mass, suggesting that CNS GLP-1 system activity may be altered in obesity. Taken together, the data presented in this dissertation reveal a novel role for the CNS GLP-1 system in the long-term regulation of energy balance. Moreover, they indicate that the GLP-1r agonist Ex4 interacts uniquely with this system to produce a powerful anorectic signal. As such, future studies are warranted to determine optimal strategies to target the CNS GLP-1 system for the treatment of obesity. iv

5 v

6 ACKNOWLEDGEMENTS I would like to express my deepest gratitude for the opportunity to train within both the Physician-Scientist Training Program and the Neuroscience Graduate Program at the University of Cincinnati. I am very fortunate to have been a part of both of these excellent programs, whose members past and present have inspired me to strive to achieve my highest potential. In return, I pledge to work toward a career that integrates both sides of my training and seeks to make significant contributions to both clinical medicine and biomedical science. To my mentor, Randy Seeley, thank you for all the opportunities you have given to me over the years. From giving me my first job out of college as a research assistant to training me as your graduate student, you have shown unwavering support of my education and career goals, and I would not be where I am today if it were not for your guidance. Moreover, I cannot think of a better example of somebody whose career truly embodies the goals of a physician-scientist. Randy, you have taught me many valuable lessons over the years, perhaps the most important of which is to always choose my research questions based on the potential significance of the answers. Your success inspires me to pursue science with as much dedication and passion as you have. To my dissertation committee members, which include Steve Woods, Dave D Alessio, Silvana Obici and Jim Herman, thank your for helping me to successfully navigate through four years of dissertation research. Steve, thank you for being such a strong advocate for graduate students, helping me through the most difficult of times, challenging me to think about the broader implications of my data, and always vi

7 encouraging me to pursue opportunities as a young scientist. Dave and Silvana, as accomplished M.D. researchers, you have been excellent role models for me, and you inspire me to always keep research at the forefront of my career as a physician-scientist. Jim, thank you for helping me work through the challenges of using viral vectors to achieve in vivo RNA interference and reminding me to be proud of my data. To all my friends in the Neuroscience Graduate Program, thank you for making these past four years so much fun. Your friendship has been an invaluable source of both enjoyment and support throughout what has undoubtedly been a challenging endeavor. A special thanks to Rob, Derrick, Brian, Georgette, Valerie and Susan, with whom I share many fond memories. Your intelligence has never ceased to amaze and inspire me, and I look forward to reading about all of your accomplishments in the future. Rob, a second call goes out to you, as I look forward to many more drinks and chats as we embark on this final phase of our time in the PSTP. To all members of the Woods/Seeley lab past and present, it has been an honor to work with each of you. I am fortunate to have crossed paths with such dedicated, enthusiastic and intelligent scientists, with whom I have had the privilege to work in such an enriching and nurturing environment. Like Randy and Steve, you have taught me so much, and as such, you have made me the scientist I am today. Moreover, I will never forget all the fun times we had, both inside and outside the lab. Thank you to all of you for encouraging, helping and inspiring me. I will miss you, but I look forward to future interactions within the world of science down the road. To all my friends and family, thank you for being a constant source of support and relaxation for me, and for keeping me sane. Thanks to you, I have not forgotten that vii

8 there is a world outside of science and that I am more than just a scientist. Moreover, you remind me that it is not only one s career that brings happiness, but perhaps more importantly it is the people in one s life. Although it may be somewhat of a mystery to you what I have been doing for the last several years, trust me when I say that you have all played an important role in making it all happen. Finally, to David Shaffer, thank you for being my biggest fan throughout this entire journey. It has been an amazing ride one that I am fortunate enough to have shared with you. Moreover, you have stood by me throughout the best and worst of times with unwavering support, patience and love, and for that I can neither express the full extent of my appreciation nor repay all that you have given to me. Thank you for always believing in me. You are the reason this work has been possible, and as such, it is with love that I dedicate it to you. viii

9 TABLE OF CONTENTS ABSTRACT..iii ACKNOWLEDGEMENTS...vi TABLE OF CONTENTS...1 Page LIST OF FIGURES....2 LIST OF COMMONLY USED ABBREVIATIONS CHAPTER 1: General Introduction...6 CHAPTER 2: Differences in the Central Anorectic Effects of GLP-1 and Exendin-4 in Rats.36 Abstract..37 Introduction 38 Materials and Methods...40 Results 44 Discussion.. 47 CHAPTER 3: Hyperphagia and Increased Fat Accumulation in Two Models of Chronic CNS GLP-1 Loss of Function.59 Abstract.. 60 Introduction 61 Materials and Methods...63 Results...69 Discussion..74 CHAPTER 4: General Discussion...85 REFERENCES

10 LIST OF FIGURES Page CHAPTER 1 CHAPTER 2 Figure 2.1 Figure 2.2 Comparison of anorectic effects of i3vt GLP-1 and Ex4..53 Effect of GLP-1r antagonists on anorexia induced by i3vt GLP-1 and Ex4..54 Figure 2.3 Figure 2.4 Effect of dhex on c-fos IR induced by i3vt GLP-1 and Ex Effect of dhex on insulin secretion induced by GLP-1 and Ex4 in the presence of glucose..56 Figure 2.5 Figure 2.6 Effect of ip dhex on anorexia induced by ip Ex4.57 Effect of i3vt Ex4 in wild-type and GLP-1R-/- mice 58 CHAPTER 3 Figure 3.1 RNAi against PPG significantly decreases PPG expression in vitro and in vivo.79 Figure 3.2 NTS PPG knockdown results in hyperphagia and increased body weight in CHOW-fed rats.80 Figure 3.3 NTS PPG knockdown results in exacerbation of HFD-induced obesity and glucose intolerance.81 Figure 3.4 Figure 3.5 Hindbrain PPG expression correlates positively with fat mass.82 Chronic ICV Ex9 results in hyperphagia, increased fat accumulation and glucose intolerance in CHOW- and HFD-fed rats..83 2

11 Figure 3.6 Chronic ICV Ex9-induced weight gain and glucose intolerance are secondary to hyperphagia and increased fat mass, respectively 84 CHAPTER 4 Figure 4.1 Segregated model of GLP-1 regulation of long- and short-term energy balance...98 Figure 4.2 Integrated model of GLP-1 regulation of long- and short-term energy balance Figure 4.3 Spectrum of CNS GLP-1 system activity and its inverse relationship with food intake

12 LIST OF COMMONLY USED ABBREVIATIONS AUC camp cdna CCK CeA CNS CTA dhex DNA DPP-4 Ex4 Ex9 GIP GLP-1 GLP-1r GLP-1r-/- GLP-2 HFD ip ICV LiCl LPS Area under the curve Cyclic adenosine monophosphate Complementary DNA Cholecystokinin Central nucleus of the amygdala Central nervous system Conditioned taste aversion Des His1, Glu8 exendin-4 (GLP-1r antagonist) Deoxyribonucleic acid Dipeptidyl peptidase-4 Exendin-4 (GLP-1r agonist) Exendin (9-39) (GLP-1r antagonist) Glucose-dependent insulinotropic polypeptide Glucagon-like peptide-1 Glucagon-like peptide-1 receptor Glucagon-like peptide-1 receptor knockout Glucagon-like peptide-2 High-fat diet Intraperitoneal Intracerebroventricular Lithium chloride Lipopolysaccharide 4

13 I3vt mrna NTS OXM PBS PC PG PPG PVN RIA RNA RNAi shrna T2DM Into the 3 rd cerebral ventricle Messenger RNA Nucleus of the solitary tract Oxyntomodulin Phosphate-buffered saline Prohormone convertase Proglucagon Preproglucagon Paraventricular nucleus of the hypothalamus Radioimmunoassay Ribonucleic acid RNA interference Short hairpin RNA Type 2 diabetes mellitus 5

14 CHAPTER 1 General Introduction 6

15 Ontogeny and Discovery of GLP-1: Glucagon-like peptide-1 (GLP-1) is a member of the pituitary adenylate cyclaseactivating polypeptide (PACAP)/glucagon superfamily of polypeptides. This family consists of nine bioactive peptides that bear high sequence homology (21-48% amino acid identity with glucagon) and includes glucagon, GLP-1, glucagon-like peptide-2 (GLP-2), glucose-dependent insulinotropic polypeptide (GIP), growth hormone-releasing factor (GRF), PACAP, peptide histidine methionine (PHM), secretin and vasoactive intestinal polypeptide (VIP) [1, 2]. These nine peptides are encoded by six genes, which are structurally similar in that they all encode an N-terminal peptide, one-to-three bioactive peptides (each encoded by a single exon) and a C-terminal peptide [1]. These peptides, as well as their genes, are also highly conserved, and it is thought that the diversity of peptides within the PACAP/glucagon superfamily is the result of duplication and amplification of a single ancestral gene that occurred during evolution from protochordates to vertebrates [3]. Specifically, the preproglucagon (PPG) gene, which encodes glucagon, GLP-1 and GLP-2, is thought to have arisen from the duplication of a common ancestral gene approximately 800 million to one billion years ago [4, 5]. In order to fully appreciate the history surrounding the discovery of GLP-1, one must frame it within the context of the discoveries of other related hormones. In fact, this history dates back to 1902 when secretin, the first hormone to be discovered, was identified by Bayliss and Starling as part of an extract from the proximal small intestine whose secretion was stimulated by gastric acid and that in turn stimulated the secretion of pancreatic juices [6]. This discovery prompted Bayliss and Starling to hypothesize the existence of other gut-derived hormones, and in 1929, Zunz and Labarre reported that 7

16 intestinal extracts were able to produce hypoglycemia in dogs [2]. Based on these findings, Labarre coined the term incretin to describe a factor secreted from the intestine in response to nutrient ingestion that stimulates the endocrine pancreas. Further support for the incretin concept came in the 1960 s from studies reporting that oral glucose administration resulted in significantly greater insulin secretion than intravenous glucose administration, a phenomenon that was subsequently termed the incretin effect [7, 8]. This finding led Creutzfeldt in 1979 to officially define an incretin as a factor released from the intestine in response to nutrients that, at physiological levels, augments glucose-stimulated insulin secretion [9]. The first incretin to be discovered was GIP, which was isolated in 1969 by Brown and colleagues from porcine intestinal extracts containing impure preparations of the hormone cholecystokinin (CCK) [10-12]. GIP was originally named gastric inhibitory polypeptide due to its ability to inhibit gastric acid secretion in dogs [13, 14]. Around the same time, Dupré and Beck, who were also studying impure CCK preparations, reported that these extracts possessed insulinotropic activity, which they later discovered could be abolished upon further purification of the CCK [15, 16]. Therefore, they hypothesized that GIP was an insulin secretagogue, and in 1973 Dupré and Brown reported that co-infusion of GIP and glucose in humans resulted in significantly greater insulin secretion than glucose alone [17]. Subsequent studies confirmed that, when administered at physiological levels, GIP stimulated insulin secretion in a glucosedependent manner [18]. In addition, it was later reported that GIP was secreted into the circulation in response to fat or glucose ingestion by a sub-population of enteroendocrine cells called K cells located primarily in the duodenum and jejunum [19, 20]. Together, 8

17 these data provided strong evidence that GIP was indeed an incretin, and thus it was appropriately renamed glucose-dependent insulinotropic polypeptide. Despite the identification of GIP as an incretin, several lines of evidence suggested that the actions of GIP may not account for the entire incretin effect. Specifically, studies in which GIP activity was blocked by immunoneutralization reported a diminished but not abolished incretin effect [21]. In addition, it was reported that the incretin effect was attenuated in patients with lower small bowel resections despite having normal plasma GIP levels, and in fact the magnitude of preservation of the incretin effect correlated positively with the remaining length of lower small bowel [22]. These findings led to the hypothesis that, in addition to GIP, another hormone, possibly of lower small intestinal origin, contributes to the incretin effect. The discovery of GLP-1 as the second component of the incretin effect marks the convergence of the discoveries of GIP and glucagon. The discovery of glucagon dates back to 1923, when Murlin and colleagues reported the presence of a substance in pancreatic extracts and impure insulin preparations whose administration resulted in elevation of blood glucose levels [23]. Sutherland and De Duve further characterized the hyperglycemic actions of glucagon and in 1948 reported that gastrointestinal extracts also possessed hyperglycemic properties [24], a finding that led them to hypothesize the existence of glucagon or glucagon-like peptides of gastrointestinal origin. In the 1960 s, Unger and colleagues confirmed the presence of gut glucagon-like immunoreactivity using radioimmunoassay (RIA) [25]. However, they later reported that this gut glucagonlike immunoreactivity differed from pancreatic glucagon in both structure and function [26]. Finally, in the early 1980 s, PPG mrnas and cdnas of several mammalian 9

18 species as well as the human PPG gene were cloned [4, 27-29]. From this information, it was determined that not only were intestinal and pancreatic PPG transcripts identical, but in addition to glucagon, PPG also encoded two glucagon-like peptides, which were named GLP-1 and GLP-2. Subsequently, GLP-1, but not GLP-2, was reported to augment glucose-stimulated insulin secretion in a manner similar to that of GIP [30-32], and thus the second incretin hormone was discovered. Preproglucagon and Proglucagon: Distribution and Tissue-Specific Processing As stated above, GLP-1 is one of several peptide products of the PPG gene. In humans, PPG is located on the long arm of chromosome 2 (2q36-q37) [33], and all known mammalian PPG genes are structurally similar, consisting of 6 exons and 5 introns flanked by 5 and 3 untranslated regions (UTRs) [29, 34]. PPG is expressed in 3 tissues in mammals: the α-cells of the pancreatic islets, the L-cells of the small and large intestines, and a small population of neurons located in the caudal nucleus of the solitary tract (NTS) and ventrolateral medulla [35, 36]. In all 3 of these tissues, PPG is transcribed in an identical manner to yield a single 2 kb mrna transcript. This transcript is subsequently translated in an identical manner to yield a 20-amino acid signal peptide as well as the 160-amino acid proglucagon (PG) prohormone [35]. The tissue-specific expression of PG-derived peptides is the result of differential post-translational processing and proteolytic cleavage by various prohormone convertases. In the pancreatic α-cells, PPG expression is directed by promoter elements located within the first 1.3 kb of the 5 UTR, and PG is cleaved primarily by prohormone convertase 2 (PC2) [37, 38]. This α-cell-specific proteolytic cleavage results in the 10

19 formation and parallel secretion of the following peptides: glicentin-related polypeptide (GRPP), glucagon, intervening peptide-1 (IP-1) and major proglucagon fragment (MPGF), which contains the full-length sequences of GLP-1 and GLP-2 separated by a second intervening peptide (IP-2). In contrast, PPG expression in intestinal L-cells requires enhancer elements located between 1.3 and 2.3 kb of the 5 UTR in addition to the proximal promoter elements [39, 40]. Moreover, intestinal PG is cleaved primarily by prohormone convertase 1/3 (PC1/3) to yield the following peptides, which are also secreted in parallel: glicentin (GRPP + glucagon + IP-1), oxyntomodulin (glucagon + IP- 1), GLP-1, IP-2, and GLP-2 [41]. Finally, brain-specific PPG and PG processing is a hybrid such that, like the α-cell, only the proximal promoter elements are required to drive PPG expression [37], yet like the L-cell, PG is cleaved by PC1/3 [41]. When the mammalian PPG cdna was first cloned, putative sites of proteolytic cleavage were predicted based upon the assumption that PCs cleaved prohormones at sites containing two adjacent basic amino acids [42]. Thus, GLP-1 was originally thought to consist of 36 to 37 amino acids, depending upon whether the C-terminal glycine was present or absent. However, when full-length GLP-1 was synthesized and tested for biological activity, it was found to have little-to-no effect on insulin secretion or plasma glucose levels [30]. Subsequent comparisons of the GLP-1 sequence with those of other closely related peptides revealed that the histidine at position 7 rather than position 1 was the best site of alignment, which led to the hypothesis that an N-terminally truncated GLP-1 was the bioactive peptide. This hypothesis was supported by the findings that intestinal extracts contained primarily truncated GLP-1 and that truncated GLP-1 elicited a potent insulinotropic effect [31]. We now know that intestinal L-cells 11

20 secrete GLP-1 in many forms, including full-length GLP-1(1-37) and GLP-1(1-36) amide as well as truncated GLP-1(7-37) and GLP-1(7-36) amide. However, GLP-1(7-36) amide remains the predominant form of circulating GLP-1 in humans [43]. Regulation of Peripheral GLP-1: Secretion and Degradation In the periphery, GLP-1 is secreted from the intestinal L-cell, which is an opentype enteroendocrine cell whose apical surface contacts luminal contents and whose basolateral surface abuts both neural and vascular tissue. Although L-cells are located predominantly in the distal ileum, they can be found throughout the length of the small intestine as well as in the colon [44]. The majority of GLP-1-secreting cells co-secrete the gut hormone peptide YY (PYY) [45]; however, it has also been reported that some overlap exists between the cells that secrete GLP-1 and GIP [46]. Meals serve as the primary stimulus for intestinal GLP-1 secretion [47]. Under fasting conditions, circulating GLP-1 levels are quite low (5-10 pm) yet still detectable, and the finding that somatostatin infusion lowers fasting GLP-1 levels provides strong evidence for some degree of basal GLP-1 secretion [48]. Upon nutrient ingestion, GLP-1 is secreted rapidly in a biphasic manner, which includes an early (10-15 min) first phase followed by a later (30-60 min) second phase [49]. During this excursion, circulating levels of bioactive GLP-1 increase approximately 2-3 fold, although the precise magnitude of increase depends upon factors such as meal size, nutrient composition, and gastric emptying rate [50-52]. Numerous lines of evidence suggest that dietary nutrients trigger the secretion of GLP-1 upon meal ingestion. Consistent with GLP-1 s role as an incretin, oral and intra- 12

21 intestinal glucose, but not intravenous glucose, stimulate GLP-1 secretion [53]. This glucose-stimulated GLP-1 secretion likely occurs via several mechanisms, including the sodium/glucose co-transporter (SGLT-1) and closure of K + ATP channels [54, 55]. In addition, dietary fats, particularly long-chain monounsaturated fatty acids such as oleic acid and its metabolite oleoylethanolamide, stimulate GLP-1 secretion in part via orphan G-protein-coupled receptors such as GPR40, GPR119 and GPR120 and the atypical protein kinace C zeta (PKC-ζ), all of which are expressed by L-cells [56-59]. Finally, although neither amino acids nor intact proteins were found to stimulate GLP-1 secretion in vivo [53], it has been reported that peptones, which are partially hydrolyzed proteins that mimic the protein-derived components of intestinal chyme, stimulate GLP-1 secretion in vitro [60]. Despite the preponderance of evidence implicating dietary nutrients in the physiological stimulation of intestinal GLP-1 secretion, both the timing of GLP-1 secretion and the fact that the majority of glucose and fatty acids are absorbed in the proximal intestine suggest that these nutrients likely stimulate GLP-1 secretion via indirect mechanisms in addition to direct interaction with L-cells. In support of this hypothesis, selective infusion of either glucose or fat into the proximal small intestine elicits the same magnitude of GLP-1 secretion as infusion into the distal small intestine [61], suggesting the existence of a proximal-distal loop that facilitates the L-cell response to nutrients. However, because some L-cells are located in the duodenum and jejunum, it is possible that stimulation of these more proximal L-cells is sufficient to elicit GLP-1 secretion comparable to that elicited by ileal L-cell stimulation. 13

22 Nonetheless, numerous experiments suggest that intestinal GLP-1 secretion results from the coordinated stimulation of L-cells by various hormonal, neural, and nutritional signals. Regarding hormones, GIP potently stimulates GLP-1 secretion in rats [62]; however, this effect has not been replicated in humans. Other studies have implicated the autonomic nervous system, particularly vagal afferent-efferent loops, in mediating both GIP- and fat-induced GLP-1 secretion. Specifically, hepatic branch vagotomy and bilateral subdiaphragmatic vagotomy block GLP-1 secretion induced by GIP and fat, respectively, whereas electrical stimulation of the vagal celiac branches stimulates GLP-1 secretion [63]. This neurally-mediated GLP-1 secretion is thought to involve the neurotransmitters gastrin-releasing peptide (GRP) and acetylcholine, as antagonism of both GRP and muscarinic acetylcholine receptors attenuates nutrientstimulated GLP-1 secretion [64-66], whereas GRP, acetylcholine and muscarinic agonists all stimulate GLP-1 secretion [67, 68]. Finally, little is known about the negative regulation of GLP-1 secretion, yet inhibitory effects of the hormones galanin, insulin and somatostatin have been reported [69-71]. The biological activity of GLP-1 is determined largely by renal and hepatic clearance as well as by enzymatic degradation. Circulating GLP-1 is eliminated primarily by the kidney. In rats, both nephrectomy and ureteral ligation increase the circulating half-life of GLP-1 [72], and plasma GLP-1 levels are increased in patients with renal insufficiency [73, 74]. The role of the liver in clearance of circulating GLP-1 is less clear, although significant hepatic extraction was detected following systemic GLP-1 infusion in anesthetized pigs [75]. 14

23 Although the elimination half-life of circulating GLP-1 is approximately 5 minutes [32], its biological half-life is only 1-2 minutes, as circulating GLP-1 is rapidly cleaved and inactivated by the enzyme dipeptidyl peptidase-4 (DPP-4) [76]. DPP-4, also called CD26, is a serine protease that cleaves dipeptides from the N-terminus of proteins containing an alanine or proline residue at position 2. Because GLP-1 contains an alanine residue at position 2, it is a substrate for DPP-4, which cleaves GLP-1(7-36) amide to the biologically inactive GLP-1(9-36) amide [77]. DPP-4 is expressed in numerous tissues, including portal vascular endothelial cells [78], and it is estimated that only 25% of newly secreted GLP-1 leaves the gut intact. Moreover, GLP-1 undergoes significant intra-hepatic degradation such that only 10-15% of newly secreted GLP-1 reaches the systemic circulation intact. In addition to being a substrate for DPP-4, GLP-1 has been reported to undergo significant C-terminal cleavage by neutral endopeptidase (NEP-24.11), which is a membrane-bound zinc metalloprotease [79]. The GLP-1 Receptor: Structure, Distribution and Intracellular Signaling In the mid-to-late 1980 s, it had been reported that GLP-1 activates the cyclic AMP (camp) signal transduction pathway in rat brain and insulinoma cells [80, 81]. Subsequent competition binding studies confirmed the presence of high-affinity GLP-1 binding sites and thus suggested the existence of a specific GLP-1 receptor (GLP-1r) [82, 83]. To date, one known GLP-1r has been identified, which is thought to mediate all biological effects of GLP-1. This receptor was first cloned in 1992 by Bernard Thorens from a rat pancreatic islet cdna library [84]. Shortly thereafter, the human GLP-1r, which is located on chromosome 6p21.1 and bears 90% sequence homology to the rat 15

24 GLP-1r [85], was cloned by several groups [86-88]. The GLP-1r is a 463-amino acid, seven-transmembrane G-protein-coupled receptor that belongs to the Class B or Type II family of G-protein-coupled receptors [89]. Members of this family share 27-49% sequence homology and include receptors for the PACAP/glucagon superfamily as well as calcitonin, parathyroid hormone (PTH) and corticotropin-releasing factor (CRF) [90]. Initial radioligand-binding studies revealed the GLP-1r to be expressed in tumorderived pancreatic β- and δ-cell lines as well as in rat islets, lung membranes, gastric glands and brain [91-97]. We now know that, consistent with the diverse physiological roles of GLP-1, the GLP-1r is distributed throughout a variety of tissues. It is generally accepted that the GLP-1r is expressed in brain, pancreatic islets, stomach, intestine, heart, lung and kidney [98-100]. However, the extent to which the GLP-1r is expressed in other tissues, particularly adipose tissue, liver and muscle, remains controversial, largely because of discrepancies among individual reports, putative species differences, and conflicting in vitro and in vivo data. Therefore, at present, the full extent of the tissue distribution of the GLP-1r remains to be determined. As is the case with the periphery, the GLP-1r is also widely distributed within the central nervous system (CNS). Early studies employing RIA revealed strong GLP-1 immunoreactivity in the thalamus, hypothalamus and medulla [91]. Subsequent studies employing 125 I-labeled GLP-1 revealed an even more widespread distribution of GLP-1 binding sites throughout the CNS, including numerous thalamic, hypothalamic, limbic, and hindbrain nuclei in addition to several circumventricular organs [101]. Finally, in situ hybridization and immunohistochemistry studies confirmed the presence of specific GLP-1r mrna and immunoreactivity within both neurons and glia of many of these 16

25 same brain regions [102]. However, the extent to which NTS PPG neurons project to these different areas remains unknown. To date, neuronal tracing studies are limited and have only confirmed projections to the hypothalamic paraventricular and dorsomedial nuclei [103]. Furthermore, the fact that the GLP-1r is expressed in circumventricular organs raises the possibility that these locations, and perhaps other CNS GLP-1r populations, may be acted upon by peripheral GLP-1 [104]. To date, much of what we know about GLP-1r signaling comes from studies conducted in pancreatic β-cells, in which GLP-1 was first observed to activate the camp signal transduction pathway [81]. We now know that the GLP-1r, via its fifth transmembrane helix and third intracellular loop, is coupled to several G-proteins, including Gα s, Gα q, Gα i and Gα o, which initiate a number of intracellular signaling cascades [105, 106]. Perhaps the most canonical of these cascades is the activation of adenylate cyclase, which leads to an increase in camp and subsequent activation of protein kinase A (PKA). However, GLP-1r signaling also includes many other pathways, including phospholipase C (PLC), protein kinase C (PKC), phosphatidylinositol-3 kinase (PI3K) and mitogen-activated protein kinase (MAPK) [107]. In addition, GLP-1r activation leads to increases in intracellular calcium mediated by calcium influx through L-type calcium channels and non-selective cation channels as well as mobilization of intracellular calcium stores [107]. Exendin-4 and Exendin (9-39): Agonist and Antagonist of the GLP-1 Receptor The PACAP/glucagon superfamily of peptides is highly evolutionarily conserved, particularly among mammals and to differing degrees among vertebrates as a whole. 17

26 Interestingly, there exists a unique family of bioactive peptides found exclusively in the venom of the Helodermatidae or beaded lizards, which include the Gila monster (Heloderma suspectum) and the Mexican beaded lizard (Heloderma horridum). These peptides, called exendins, bear moderate sequence homology to members of the PACAP/glucagon superfamily and include helospectin (exendin-1), helodermin (exendin- 2), exendin-3 (Ex3) and exendin-4 (Ex4) [108]. Helospectin and helodermin were discovered in the early 1980 s in an effort to identify bioactive peptides from insect and reptile venoms [109], whereas Ex3 and Ex4 were discovered in the early 1990 s in an effort to identify peptides in lizard venom that contained an N-terminal histidine (H 1 ), which characterizes many peptides in the PACAP/glucagon superfamily [110, 111]. Since their discovery, all four exendin peptides, which have no known mammalian homologues, have been reported to elicit biological effects in mammals that are mediated via receptors for members of the PACAP/glucagon superfamily. Specifically, helospectin and helodermin, which differ by only 5 amino acids, bear moderate homology to VIP and secretin and act via VIP and secretin receptors [112]. In contrast, Ex3 and Ex4, which are structurally different than helospectin and helodermin yet differ from each other by only 2 amino acids, bear moderate homology to glucagon and GLP-1 and act via the GLP-1r [88, 113]. Interestingly, Ex3, but not Ex4, has also been reported to interact with the VIP receptor at high concentrations [114]. Of these peptides, Ex4 has by far received the most attention over the years, primarily due to its role as a highly potent, long-acting GLP-1r agonist. However, because the GLP-1r had not yet been identified when Ex4 was first reported to elicit biological effects in mammalian tissues, it was presumed that Ex4 acted via a unique 18

27 exendin receptor [111]. Upon sequencing of Ex4, it was revealed that Ex4 bore 53% homology to mammalian GLP-1, and based on this sequence homology, it was proposed that GLP-1 might be an agonist of the putative exendin receptor. Consistent with this hypothesis, GLP-1 elicited effects identical to those of Ex4 in dispersed guinea pig pancreatic acini, including a small monophasic increase in cellular camp as well as potentiation of CCK-, carbamylcholine-, bombesin- and calcium ionophore-induced amylase release [115]. Similar consistencies were found in guinea pig gastric chief cells and rat gastric parietal cells [116, 117]. In addition, GLP-1 inhibited binding of radiolabeled Ex4, and like Ex4, its effects were antagonized by the truncated peptide exendin (9-39) (Ex9) [117]. Together, these data supported the hypothesis that GLP-1 and Ex4 were agonists of a common receptor and that Ex9 was an antagonist of this same receptor. However, it was unclear whether this receptor was the GLP-1r or an as yet unidentified exendin receptor. Evidence in favor of the GLP-1r came in 1992 with the cloning of the human GLP-1r [88], which allowed for its identification and selective expression. Subsequent in vitro studies revealed that GLP-1, Ex4 and Ex9 were all high-affinity GLP-1r ligands and that GLP-1 and Ex4 elicited similar increases in intracellular camp that could be blocked by Ex9 [88, 113, 118]. In addition, GLP-1 and Ex4 both augmented glucose-stimulated insulin secretion in an Ex9-dependent manner in vivo [119]. Convincing evidence that the GLP-1r is required for the effects of both GLP-1 and Ex4 came with the development of GLP-1r knockout (GLP-1r-/-) mice, which to date have been reported to elicit no physiological responses to either exogenous GLP-1 or Ex4 [120, 121]. Therefore, it is thought that the GLP-1r is the sole mediator of both GLP-1 and Ex4 effects, and as such 19

28 both Ex4 and Ex9 have been used extensively to study GLP-1 physiology. However, although these data argue strongly against the existence of an alternate GLP-1r or a separate mammalian exendin receptor, such a possibility cannot definitively be ruled out, especially when one considers that pancreatic exocrine tissue, in which GLP-1 and Ex4 were both found to induce an increase in intracellular camp, has been reported to not express the known GLP-1r [88, 122]. The Diverse Roles of GLP-1 Given the widespread distribution of GLP-1r throughout both the CNS and the periphery, it is not surprising that GLP-1 has been found to elicit diverse effects throughout the body. To date, the incretin effect is the most well-characterized effect of GLP-1. However, in addition to augmenting glucose-stimulated insulin secretion, GLP-1 increases insulin biosynthesis and contributes to the maintenance of β-cell glucose competence [81, 123]. Moreover, GLP-1 decreases glucagon secretion from α-cells and increases somatostatin secretion from δ-cells [95, 124]. Finally, GLP-1 exerts protective and trophic effects on β-cells, as GLP-1 promotes β-cell neogenesis, proliferation and differentiation and prevents β-cell apoptosis in response to a variety of insults [125]. The finding that GLP-1r-/- mice are glucose intolerant indicates that GLP-1 is required for normal glucose homeostasis [120]. However, numerous lines of evidence suggest that the glucoregulatory actions of GLP-1 extend beyond the pancreas. GLP-1 may regulate blood glucose in part by indirect mechanisms such as negative regulation of gastrointestinal function. In fact, GLP-1 has been referred to as an ileal brake in that it decreases gastric and pancreatic secretion and delays gastric emptying [126, 127]. GLP-1 20

29 also exerts extrapancreatic effects on glucose homeostasis, such as increasing insulin sensitivity and decreasing endogenous glucose production. However, the sites of action for these effects remain unclear. Numerous in vitro studies suggest that GLP-1 exerts direct anabolic effects on adipose tissue, liver and muscle [128], yet the GLP-1r is not thought to be expressed in these tissues. More recent evidence points to portal vein vagal afferent GLP-1r and CNS GLP-1r as important mediators of both islet-dependent and independent effects of GLP-1 on glucose-homeostasis [ ]. This neuroendocrine model is particularly attractive given the short circulating half-life of active GLP-1. In addition to its effects on glucose homeostasis, GLP-1 alters cardiovascular, CNS, pituitary, pulmonary and renal function (For review, see 23), yet the role of endogenous GLP-1 in these tissues, particularly in humans, remains incompletely understood. One striking theme, however, is the protective effect that GLP-1 exerts on many of these tissues. In humans, GLP-1 has been reported to improve cardiac function and decrease infarct size following ischemia-reperfusion injury as well as enhance sodium excretion and prevent glomerular hyperfiltration [132, 133]. Moreover, GLP-1 improves learning and memory and is neuroprotective in numerous in vitro models as well as animal models of Alzheimer s disease, epilepsy, Huntington s disease, peripheral neuropathy, Parkinson s disease and stroke [ ]. Together, these data are significant in that they raise the possibility that the therapeutic potential of GLP-1 and related compounds may be expanded far beyond T2DM. The following sections will present a brief description of homeostatic regulation of energy balance followed by a detailed review of the effects of central and peripheral GLP-1, other PPG-derived peptides and Ex4 on food intake and body weight. 21

30 Homeostatic Regulation of Energy Balance The concept of energy balance can easily be explained by the energy equation, which states that under conditions of adequate energy availability, when energy intake equals energy expenditure, the amount of stored energy in the form of adipose tissue remains constant. Both sides of the energy equation are highly regulated, and the maintenance of energy balance requires complex communication among the CNS and numerous peripheral tissues, including adipose tissue, gastrointestinal tract, liver and skeletal muscle. This communication takes place via several mechanisms, including hormonal, neural and nutritional signals, which integrate at the level of the CNS to determine one s defended level of adiposity and thus one s overall body weight. Broadly speaking, the regulation of energy balance takes place on both a shortand long-term basis. In the short term, energy balance is regulated at the level of individual meals, whereby nutrient ingestion stimulates a variety of signals that serve to limit meal size in order to ensure that the body takes in only as many nutrients as it is capable of handling at one time. These so-called satiety signals induce feelings of fullness or satiation that lead to meal termination followed by satiety, which is defined as prolongation of the inter-meal interval until the motivation to eat returns [139]. In order to be considered a bona fide satiety signal, a compound must be secreted in response to nutrient ingestion, have a rapid onset and short duration of action and reduce meal size at physiological concentrations without inducing malaise. Moreover, reducing the endogenous activity of such a compound must increase meal size [140]. Perhaps the most well-characterized satiety signal to date is CCK. CCK is secreted from duodenal I-cells in response to fat or protein entering the duodenum [141], 22

31 and it acts in an endocrine fashion to regulate numerous processes, including gastric emptying and gastric acid secretion, GI motility, gallbladder contraction and pancreatic enzyme secretion [142]. In addition, CCK acts in a paracrine fashion on local vagal sensory nerve endings to regulate satiety [143, 144]. In support of this role, exogenous CCK reduces meal size without inducing malaise, and CCK-1 receptor antagonists increase meal size [145, 146]. However, it is important to note that CCK has no effect on overall food intake or body weight when administered repeatedly, as meal number increases to compensate for decreased meal size [147, 148]. Whereas satiety signals regulate short-term energy balance by determining the amount of energy consumed during individual meals, adiposity signals regulate long-term energy balance by determining the amount of energy stored as adipose tissue. Such regulation was first posited in 1953, when Kennedy introduced his lipostatic theory, which hypothesized the existence of a negative feedback signal that circulates in proportion to total body adiposity and acts within the CNS to reduce body weight by modulating neuronal pathways that control energy balance [149]. Since then, only insulin and leptin, which are secreted from pancreatic β-cells and white adipose tissue, respectively, have been found to fit these criteria. Both insulin and leptin circulate in proportion to total body adiposity and enter the CNS via saturable transport systems [ ]. Within the CNS, insulin and leptin receptors are expressed within key hypothalamic, hindbrain and other nuclei important for energy balance regulation [154, 155], and central administration of either peptide reduces food intake and body weight [156, 157]. Conversely, decreasing either insulin or leptin signaling within the CNS increases food intake and body weight [158, 159]. In 23

32 light of these actions, both insulin and leptin were initially thought to be promising therapeutic targets for obesity. However, these prospects were largely derailed by the finding that obese individuals, despite having high circulating insulin and leptin levels, are characterized by resistance to the anorectic effects of insulin and leptin a phenomenon that may in part underlie the development of obesity [160, 161]. Within the CNS, there exist multiple neuronal populations through which insulin and leptin modulate food intake to maintain appropriate body fat stores. Two of the most well-characterized of these exist within the hypothalamic arcuate nucleus (ARC). The first population expresses the orexigenic neuropeptides neuropeptide Y (NPY) and agouti-related protein (AgRP), both of which stimulate food intake [162, 163]. Conversely, the second population expresses the anorectic precursor peptide proopiomelanocortin (POMC), whose cleavage product alpha-melanocyte stimulating hormone (αmsh) inhibits food intake [164]. Upon binding to their receptors, insulin and leptin inhibit NPY/AgRP neurons and stimulate POMC neurons [ ]. These effects in turn modulate activity of second-order neurons in the PVN, lateral hypothalamic area (LHA) and elsewhere to produce an overall reduction in food intake and body weight. Central GLP-1 and Energy Balance The first evidence of a role for GLP-1 in the regulation of energy balance came in 1996, when both Turton and Tang-Christensen and colleagues reported that central administration of GLP-1 elicits a potent and dose-dependent reduction in short-term food intake [170, 171]. Follow-up studies revealed that peripheral administration of GLP-1 elicits a much weaker anorectic effect seen only at high doses [ ]. Thus, the 24

33 anorectic effect of GLP-1 was hypothesized to be centrally mediated. We now know that stimulation of key CNS GLP-1r populations is sufficient to reduce food intake. These include several hypothalamic nuclei, including the PVN, DMH, ventromedial nucleus (VMH) and LHA [131, ]. However, to date the role of the ARC remains unclear, as GLP-1 fails to reduce food intake in rats in which the ARC has been ablated by neonatal monosodium glutamate treatment, yet direct intra-arc GLP-1 infusion also fails to reduce food intake [131, 178]. In addition to the hypothalamus, stimulation of hindbrain GLP-1r is sufficient to reduce food intake [179, 180]. The above data support the hypothesis that GLP-1 acts within the CNS to promote short-term satiety, but they do not necessarily imply a role for central GLP-1 in the longterm regulation of energy balance. In fact, studies in which GLP-1 was administered centrally over several days have yielded conflicting results [181, 182]. Moreover, the above studies fail to address the role of endogenous CNS GLP-1 in the regulation of energy balance. In support of such a role, central Ex9 increases short-term food intake when administered acutely and promotes weight gain when administered repeatedly over 3 days [170, 182], suggesting that CNS GLP-1r activity tonically inhibits food intake and body weight gain. In contrast, GLP-1r-/- mice have normal food intake and body weight, arguing against a necessary role of GLP-1 in the regulation of energy balance [120]. Therefore, the precise role of the endogenous CNS GLP-1 system in the regulation of energy balance remains unclear. Presently, little is known about either the downstream mediators of central GLP- 1-induced anorexia or the relationship between GLP-1 and other central regulators of energy balance. Regarding the former, it has been reported that central corticotropin- 25

34 releasing hormone (CRH) signaling is required for the anorectic effect of central GLP-1, but this finding has never been replicated [183]. Regarding the latter, several lines of evidence point to a relationship between GLP-1 and leptin, yet this evidence suggests that the relationship is species-specific. First, leptin receptors are expressed on mouse hindbrain PPG neurons, and these neurons express phosphorylated STAT3 in response to leptin, implying direct regulation [184, 185]. In contrast, rat hindbrain PPG neurons express c-fos but not phosphorylated STAT3 in response to leptin, implying indirect regulation [185, 186]. Second, leptin increases both hindbrain PPG mrna and hypothalamic GLP-1 content in mice, whereas leptin increases only hypothalamic GLP-1 content in rats [185, 187]. Finally, Ex9 attenuates ICV leptin-induced anorexia in rats, but GLP-1r-/- mice respond normally to leptin [184, 188, 189]. Thus, these data indicate that leptin interacts uniquely with the CNS GLP-1 systems of mice and rats. However, the nature of this interaction remains incompletely understood. Central GLP-1, Visceral Illness and Stress Numerous lines of evidence suggest that the reduction in food intake following central administration of GLP-1 may reflect a non-specific response to visceral illness. Consistent with this hypothesis, NTS PPG neurons are activated by a variety of stimuli including CCK, lithium chloride (LiCl), lipopolysaccharide (LPS), artificial gastric distension and leptin [186, 190, 191]. Although several of these stimuli are associated with satiety, many are also associated with visceral illness, an important observation when one considers that consumption of a large meal alone fails to activate NTS PPG neurons [190]. In addition, central administration of GLP-1 elicits a pattern of neuronal 26

35 activation similar to that of LiCl, a known inducer of visceral illness, and central GLP-1r antagonism blocks LiCl-induced neuronal activation and visceral illness symptoms, suggesting that CNS GLP-1r activity is necessary these responses [ ]. The putative role of central GLP-1 in mediating the response to visceral illness is consistent with a broader role of central GLP-1 in the regulation of stress. As mentioned earlier, NTS PPG neurons project to the PVN, which contains CRH neurons that serve as the first step in the activation of the hypothalamic-pituitary-adrenal (HPA) axis in response to interoceptive and psychogenic stressors [103, 190]. In addition, central administration of GLP-1 activates CRH neurons and increases plasma adrenocorticotropic hormone (ACTH) and corticosterone (CORT) levels [195, 196], most likely in a direct manner, as GLP-1-immunoreactive nerve terminals appose CRH neurons [197, 198]. Finally, direct stimulation of GLP-1r into the PVN and the central nucleus of the amygdala (CeA) activates the HPA axis and induces anxiety, respectively, and central GLP-1r antagonism blocks HPA axis activation in response to LiCl and elevated platform exposure [196], suggesting that CNS GLP-1r activity is required for both the endocrine and behavioral responses to interoceptive and psychogenic stressors. Together, these data support the hypothesis that central GLP-1 plays an important role in the regulation of visceral illness and stress. Therefore, it is possible that the reduction in food intake observed following central administration of GLP-1 may reflect a specific role for central GLP-1 in mediating illness- or stress-induced anorexia rather than regulating satiety or energy balance per se. Interestingly, however, GLP-1r-/- mice have no disruption in their ability to form a conditioned taste aversion to LiCl, and paradoxically, their endocrine and behavioral stress responses are significantly greater 27

36 than those of wild-type (WT) mice [199, 200]. These data, combined the normal food intake and body weight of GLP-1r-/- mice, raise the possibility that these mice may be subject to developmental compensations, and thus their phenotype may not accurately reflect the diverse roles of the GLP-1 system. Peripheral GLP-1 and Energy Balance The initial reports of a weak or absent anorectic effect following peripheral administration of GLP-1 are not surprising when one considers that DPP-4 severely limits the circulating half-life of active GLP-1 [76, 201, 202]. However, despite this obstacle, much experimental evidence points to a role for peripheral GLP-1 in the regulation of food intake. For instance, prolonging exogenous GLP-1 activity by either continuous intravenous infusion or viral-mediated overexpression circumvents DPP-4 and thereby reduces food intake [203, 204]. Moreover, peripheral administration of stable GLP-1r agonists and GLP-1 analogues elicits a potent and sustained reduction in food intake. These compounds include the lizard peptide Ex4 [205], liraglutide, which is acylated GLP-1 [206], and small molecule GLP-1r agonists [207]. Although together, these data suggest that stimulation of peripheral GLP-1r is sufficient to reduce food intake, it is possible that such treatments reduce food intake by ultimately reaching and activating central GLP-1r, as GLP-1 and Ex4 are known to cross the blood-brain barrier (BBB) [208, 209]. However, the fact that an albumin conjugate of Ex4 and an albumin-glp-1 fusion protein (Albugon) reduce food intake when administered peripherally provides stronger evidence that stimulation of peripheral GLP-1r is sufficient to reduce food intake, as these compounds are theoretically BBB-impermeable [210, 211]. 28

37 Currently, the mechanism underlying the anorectic effect of peripheral GLP-1r activation remains obscure, but several explanations are possible. First, this effect may be secondary to delayed gastric emptying; however, this hypothesis has yet to be tested directly. Second, this effect may be mediated via the vagus nerve, as vagal resection, pharmacological inhibition with capsaicin and selective deafferentation all attenuate the anorectic effect of ip GLP-1r stimulation [174, 212, 213]. In addition, the nodose ganglion contains GLP-1r mrna, and GLP-1r are expressed on nerve terminals innervating the wall of the hepatic portal vein, which is thought to be an important sight of GLP-1 regulation of glucose homeostasis [129, 214]. However, vagal signaling may not mediate the anorectic effect of intra-portal GLP-1, as this effect is preserved in rats with selective vagal deafferentation [213]. Finally, there are conflicting reports as to whether portal vein GLP-1r mediate the anorectic effect of peripheral GLP-1r stimulation; however, these same reports are consistent in that intravenous infusion of GLP-1 into the systemic circulation, either via the vena cava or jugular vein, reduces food intake [213, 215]. Taken together, these data suggest that perhaps peripheral GLP-1- induced anorexia is mediated by multiple peripheral GLP-1r populations, some of which may act directly and others indirectly to modulate food intake. Despite numerous reports of anorexia following exogenous peripheral GLP-1r stimulation, only recently has there been evidence of a role for endogenous peripheral GLP-1 in the regulation of food intake. This evidence comes largely from work by Williams and colleagues, who report that peripheral administration of Ex9 increases short-term food intake in rats during the light phase, when consumption is low [216]. Although this finding suggests that endogenous peripheral GLP-1 tonically inhibits food 29

38 intake, it is somewhat problematic in that it calls into question the specificity of Ex9 for endogenous GLP-1, as circulating GLP-1 levels should also be low when consumption is low. However, the authors go on to report that blockade of peripheral GLP-1r attenuates satiety induced by voluntary consumption or intra-gastric infusion of a nutrient preload [216]. Similarly, Hayes and colleagues report that blockade of hindbrain and specifically NTS GLP-1r blocks satiety induced by a voluntarily consumed nutrient preload or artificial gastric distension, although in this case it is unclear whether these receptors are being activated by gut-derived or hindbrain-derived GLP-1 [217]. Nonetheless, together, these data support the hypothesis that endogenous peripheral, and perhaps central, GLP-1 acts as a physiological satiety signal. This hypothesis is further supported by the finding that the satiating effect of peripheral GLP-1, much like that of CCK, is enhanced by leptin, a signal of whole-body energy surfeit [218]. Certainly, numerous reports validate that stimulation of peripheral GLP-1r is sufficient to reduce food intake in rodents, and this finding extends to humans. Indeed, intravenous GLP-1 infusion dose-dependently decreases hunger and increases fullness and satiety in healthy humans, leading to an overall reduction in caloric intake [219, 220]. These effects are enhanced when GLP-1 is combined with a nutrient preload [221], and they are present in obese and diabetic patients [ ]. Moreover, repeated subcutaneous GLP-1 infusion results in modest weight loss in obese men [227]. It is important to note that some studies have found no effect of physiological doses of GLP-1 on hunger, satiety or total caloric intake [228], thus calling into question the physiological relevance of GLP-1 as a satiety signal in humans. However, the data collectively indicate that exogenous administration of GLP-1 is sufficient to decrease 30

39 hunger, increase satiety and thereby reduce food intake in humans, a finding that carries significant therapeutic relevance when one considers that GLP-1-based drugs are currently being used for the treatment of T2DM. Other PPG-Derived Peptides and Energy Balance The discovery that central administration of GLP-1 reduces food intake in rats led to the investigation of potential roles for other PPG-derived peptides in the regulation of energy balance. Thus, in 2000, it was reported by Tang-Christensen and colleagues that central administration of GLP-2 also reduces food intake in rats [229]. This effect was blocked by Ex9 and hypothesized to be mediated via the DMH, as both GLP-2r expression and GLP-2-induced neuronal activation were found to be restricted to the DMH [229]. However, these initial findings were contradicted by Lovshin and colleagues, who reported a much wider distribution of GLP-2r in the murine CNS as well as an enhanced anorectic effect of central GLP-2 when combined with Ex9 or administered to GLP-1r-/- mice. Since then, interest in the role of GLP-2 in the regulation of energy balance has largely waned, and reports of the effect of GLP-2 on eating behavior in humans have been negative [230]. In contrast, OXM has been reported to reduce food intake in a manner similar to that of GLP-1, albeit with some intriguing distinctions. Specifically, central and peripheral administration of OXM reduces food intake in rats and mice. This effect is thought to be GLP-1r-mediated, as it is blocked by Ex9 and not present in GLP-1r-/- mice [121, 173, 231]. Interestingly, despite a 100-fold lower affinity for the GLP-1r, OXM reduces food intake at doses similar to those required by GLP-1. In addition, repeated 31

40 ICV administration of OXM produces weight loss that is significantly greater than that achieved by food restriction alone, an effect thought to be mediated by increased thermogenesis and upregulation of the thyroid axis [232]. At present, it is not known the extent to which OXM and GLP-1 reduce food intake via similar or distinct mechanisms. It has been hypothesized that OXM acts specifically via the ARC [173, 233, 234], but other reports refute this claim [121]. Moreover, studies involving selective OXM loss of function are not technically possible, thereby precluding the possibility to address the role of endogenous OXM in the regulation of energy balance. However, OXM has been reported to reduce food intake and body weight and increase energy expenditure in humans, making it a potential therapeutic target for obesity [ ]. Exendin-4 and Energy Balance Since its discovery as a potent and long-acting GLP-1r agonist, Ex4 has served as a valuable tool for studying GLP-1 system function. Like GLP-1, Ex4 reduces short-term food intake when administered centrally, and notably, it does so as well when administered peripherally because of its resistance to DPP-4 degradation [172, 205]. This anorectic effect is due to a selective reduction in meal size rather than meal number [216, 238]. In addition, across several lean and obese animal models, chronic administration of peripheral Ex4 elicits a transient and dose-dependent reduction in food intake accompanied by weight loss that persists upon discontinuation of Ex4 [172, ]. Surprisingly, no food intake or body weight phenotype was observed in mice engineered to overexpress Ex4; however, adenoviral-mediated overexpression of Ex4 decreased 32

41 weight gain in high-fat diet (HFD)-fed mice [243, 244]. Together, these data indicate that prolonged GLP-1r activation by Ex4 is sufficient to produce enduring weight loss. In light of these data, body weight was observed closely throughout clinical trials of exenatide (synthetic Ex4) and the DPP-4 inhibitor sitagliptin, which are now FDAapproved for the treatment of T2DM. Interestingly, whereas both drugs were effective at improving glycemic control [245, 246], Ex4, but not sitagliptin, was also associated with significant weight loss [245, 247]. This dichotomy is reflected in the animal literature, as the DPP-4 inhibitor vildagliptin was reported to have no effect on food intake or body weight in obese rats [248]. However, it is important to note that the DPP-4 inhibitor desfluoro-sitagliptin was reported to decrease fat mass but not food intake in HFD-fed mice [242]. Despite this discrepancy, the above data highlight an important clinical advantage of exenatide over DPP-4 inhibitors, as not only does exenatide directly improve glycemic control, but it also produces weight loss, which carries numerous health benefits, including improvement of T2DM. The finding that exenatide, but not DPP-4 inhibitors, produces weight loss raises the possibility that Ex4 acts via mechanisms distinct from those of GLP-1, which could include differential activation of GLP-1r-dependent pathways or mechanisms independent of the known GLP-1r. In fact, evidence for the latter hypothesis goes back to early studies in which both GLP-1 and Ex4 were reported to increase intracellular camp in dispersed pancreatic acini, which do not express the known GLP-1r [111, 115, 122, 249]. Further evidence comes from studies in which Ex4 was reported to elicit certain effects, such as reductions in thyroid stimulating hormone (TSH) and ghrelin secretion, that were neither elicited by GLP-1 nor blocked by Ex9 but rather were 33

42 recapitulated by Ex9 alone [250, 251]. Regarding food intake, no study thus far has reported a convincing blockade of Ex4-induced anorexia with a GLP-1r antagonist. Navarro and colleagues attempted to block the anorectic effect of ICV Ex4 with a 100- fold higher dose of Ex9, but this dose of Ex9 elicited its own orexigenic effect [205]. Similarly, Baggio and colleagues attempted to block the anorectic effect of ICV Ex4 with a 500-fold higher dose of Ex9, and although Ex9 had no effect on its own, it failed to block Ex4 [121]. However, in this same study, both ICV and ip Ex4 failed to reduce food intake in GLP-1r-/- mice, a finding that has since been replicated [252]. Therefore, to date the question of whether Ex4 acts via distinct mechanisms, either GLP-1r-dependent or independent, remains unanswered. Objective of this Research At present, it is well established that pharmacological activation of both central and peripheral GLP-1r is sufficient to reduce food intake and body weight [172]. As such, it is perhaps not surprising that exenatide produces weight loss in diabetic patients [245]. This finding is exciting in that not only does it reveal an additional mechanism by which exenatide improves glycemic control, but it also underscores the potential for exenatide, and perhaps other GLP-1r agonists, to be targeted for the treatment of obesity. In light of this possibility, it is critical that we develop a more thorough understanding of the unique mechanisms underlying exenatide-induced weight loss. To this end, Chapter 2 of this dissertation addresses putative differences in how GLP-1 and Ex4 reduce food intake and body weight. Although it is known that Ex4 is a highly potent, long-acting GLP-1r agonist [113], several lines of evidence suggest that 34

43 Ex4 elicits unique central effects that may be GLP-1r-independent [250, 251]. Moreover, the GLP-1r-dependence of Ex4-induced anorexia remains controversial, as although Ex4 fails to reduce food intake and body weight in GLP-1r-/- mice [121, 252], several reports suggest that the anorectic effect of Ex4 is insensitive to GLP-1r antagonism [121, 205, 251]. Thus, the aim of Chapter 2 is to test the hypothesis that the central anorectic effects of GLP-1 and Ex4 are different. In order to most effectively target the GLP-1 system for the treatment of obesity, it is important to understand not only the pharmacology of various GLP-1r agonists, but also the physiology of the endogenous GLP-1 system and its role in the regulation of energy balance. Recent evidence supports the hypothesis that endogenous peripheral GLP-1 acts as a physiologically relevant satiety signal [216, 218]. However, the precise role of the endogenous central GLP-1 system remains unclear, in part due to limitations of the current experimental models. Specifically, GLP-1r-/- mice are subject to developmental compensation and lack specificity for CNS GLP-1r, and GLP-1r antagonists have yet to be administered chronically into the CNS. Moreover, neither of these tools directly targets hindbrain-derived GLP-1. Chapter 3 of this dissertation addresses these limitations by employing two novel methods to achieve chronic CNS GLP-1 system loss of function in adult rats. First, a lentivirus encoding RNA interference (RNAi) against PPG is delivered into the NTS to achieve persistent knockdown of hindbrain PPG expression. Second, Ex9 is infused into the lateral ventricle via osmotic pump to achieve chronic blockade of CNS GLP-1r. Together, these experiments test the hypothesis that activity of the endogenous CNS GLP-1 system is required for normal energy balance. 35

44 CHAPTER 2 Differences in the Central Anorectic Effects of GLP-1 and Exendin-4 in Rats 36

45 ABSTRACT Objective: Glucagon-like peptide-1 (GLP-1) is a regulatory peptide synthesized in the gut and the brain that plays an important role in the regulation of food intake. Both GLP-1 and exendin-4 (Ex4), a long-acting GLP-1 receptor (GLP-1r) agonist, reduce food intake when administered intracerebroventricularly (i3vt), whereas Ex4 is much more potent at suppressing food intake when given peripherally. It has generally been hypothesized that this difference is due to the relative pharmacokinetic profiles of GLP-1 and Ex4, but it is possible that the two peptides control feeding via distinct mechanisms. Research Design and Methods: In this study, the anorectic effects of i3vt GLP-1 and Ex4, and the sensitivity of these effects to GLP-1r antagonism, were compared in rats. In addition, the GLP-1r-dependence of the anorectic effect of i3vt Ex4 was assessed in GLP-1r-/- mice. Results: I3vt Ex4 was 100-fold more potent than GLP-1 at reducing food intake, and this effect was insensitive to GLP-1r antagonism. However, GLP-1r antagonists completely blocked the anorectic effect of intraperitoneal Ex4. Despite the insensitivity of i3vt Ex4 to GLP-1r antagonism, i3vt Ex4 failed to reduce food intake in GLP-1r-/- mice. Conclusions: These data suggest that, although GLP-1r are required for the actions of Ex4, there appear to be key differences in how GLP-1 and Ex4 interact with CNS GLP- 1r, and in how Ex4 interacts with GLP-1r in the brain versus the periphery. A better understanding of these unique differences may lead to expansion and/or improvement of GLP-1-based therapies for type 2 diabetes and obesity. 37

46 INTRODUCTION Glucagon-like peptide-1 (GLP-1) is a product of the preproglucagon (PPG) gene [28] that is synthesized in the distal ileum [253] as well as the caudal nucleus of the solitary tract (NTS) and ventrolateral medulla [102]. Although GLP-1 is perhaps best known for its essential role in the regulation of peripheral glucose homeostasis, multiple lines of evidence suggest that GLP-1 also acts in the central nervous system (CNS) to regulate food intake. In support of this hypothesis, GLP-1 receptors (GLP-1r) are expressed in brain regions known to regulate energy balance, such as the mediobasal hypothalamus and the caudal brainstem [91, 102], and consistent with a role for GLP-1 as a putative satiety signal, central administration of GLP-1 potently reduces short-term food intake [170, 254]. Conversely, central administration of the GLP-1r antagonist exendin (9-39) (Ex9) increases food intake and body weight [182], suggesting that endogenous GLP-1 has a physiological role in the regulation of energy balance. Recently, the GLP-1 system has emerged as a novel therapeutic target for type 2 diabetes mellitus (T2DM), as peripheral GLP-1 infusion effectively lowers blood glucose levels and improves glucose tolerance in humans [32]. However, because circulating active GLP-1 is rapidly degraded by the enzyme dipeptidyl peptidase-4 (DPP-4) [76, 201, 202], alternative strategies for targeting the GLP-1 system have been developed, including stable GLP-1 analogues and DPP-4 inhibitors. One such analogue is exendin-4 (Ex4), a peptide originally isolated from the saliva of the Gila monster (Heloderma suspectum), which is a highly potent, DPP-4 resistant GLP-1r agonist in vitro and in vivo [255, 256]. Recently, exenatide (a synthetic Ex4) and the DPP-4 inhibitor sitagliptin were FDA-approved as therapies for T2DM. However, whereas both drugs effectively 38

47 improved glycemic control in clinical trials [245, 246], Ex4, but not sitagliptin, was also associated with significant weight loss [245, 247]. The above finding is compelling in that it raises the possibility that Ex4, at doses used clinically, may have in vivo actions that are substantively different from those of intact GLP-1 achieved through DPP-4 inhibition. Although studies using GLP-1r knockout (GLP-1r-/-) mice provide strong evidence that the GLP-1r is necessary for the in vivo actions of Ex4 [121, 210, 211, 252, 257], other studies using GLP-1r antagonists suggest that Ex4, particularly in the brain, may act at least in part independently of GLP- 1r [250, 251, 258]. Therefore, we tested the hypothesis that the central anorectic effect of Ex4 is different from that of GLP-1. 39

48 MATERIALS AND METHODS Animals: Adult male Long-Evans rats (Harlan, Indianapolis, IN), GLP-1r-/- mice and their wild-type (WT) littermates were housed individually in standard plastic rodent cages and maintained on a 12-hour light/dark cycle with ad libitum access to water and standard pelleted rodent chow (Harlan Teklad). All procedures were approved by the University of Cincinnati Institutional Animal Care and Use Committee (IACUC). Surgeries: Rats were anesthetized with ketamine/xylazine and implanted with 22-gauge stainless steel cannulas (Plastics One, Roanoake, VA) in the 3 rd -cerebral ventricle (AP: mm; DV: -7.5 mm from dura). To verify correct cannula placement, rats were injected intracerebroventricularly (i3vt) with 10 ng of angiotensin II in 1.0 μl of saline during the light phase, and subsequent water intake was measured. Only rats that drank at least 5.0 ml of water in 60 min were included in studies. Mice were anesthetized with avertin and implanted with 26-gauge stainless steel cannulas (Plastics One, Roanoake, VA) in the 3 rd ventricle (AP: -0.8 mm; DV: -4.8 mm from skull measurement at bregma). To verify correct cannula placement, mice were injected i3vt with 1.0 μg of neuropeptide Y (NPY) in 1.0 μl of saline during the light phase, and subsequent food intake was measured. Only mice that ate at least 0.5 grams of food in 60 min were included in studies. Food Intake Studies: On study days, food was removed from cages 4 h prior to lights off, and injections commenced 1 h prior to lights off. At lights off, food was returned to the cages, and food intake was measured at 1, 2, 4, and 24 h and body weight after 24 h. Conditioned taste aversion studies were performed as described previously [259]. 40

49 To assess the ability of central GLP-1r antagonism to block anorexia induced by central GLP-1 and Ex4, rats were injected i3vt with 1.0 μl of saline, the GLP-1r antagonist des His1, Glu8 exendin-4 (dhex, 10.0 μg, Baylor College of Medicine Protein Synthesis Core, Houston, TX) [260], or the GLP-1r antagonist Ex9 (100.0 μg, Tocris, Ellisville, MO) followed by 1.0 μl of saline, GLP-1 (10.0 μg, Bio Nebraska, Lincoln, NE), or Ex4 (0.1 μg, American Peptide, Sunnyvale, CA). To assess the ability of peripheral GLP-1r antagonism to block anorexia induced by peripheral Ex4, rats were injected intraperitoneally (ip) with 1.0 ml/kg of saline or dhex (1.0 mg/kg) followed by saline or Ex4 (10.0 μg/kg). Finally, to assess the ability of i3vt Ex4 to reduce food intake in GLP-1r-/- mice, mice were injected with 1.0 μl of saline or Ex4 (1.0 μg). c-fos Immunohistochemistry: To assess the ability of central GLP-1r antagonism to block neuronal activation induced by central GLP-1 and Ex4, rats were injected i3vt with 1.0 μl of saline or dhex (10.0 μg) followed by i3vt saline, GLP-1 (10.0 μg) or Ex4 (0.1 μg). Two hours later, rats were deeply anesthetized with sodium pentobarbital and perfused transcardially with 0.1 M phosphate-buffered saline (PBS) followed by 4.0% paraformaldehyde/pbs. Brains were postfixed at 4 C for 24 h in 4.0% paraformaldehyde/pbs and stored at 4 C in 30.0% sucrose/pbs. Serial coronal forebrain sections and longitudinal hindbrain sections were collected at 35 μm using a freezing microtome and stored at -20 C in cryoprotectant. After washing with PBS, sections were incubated in 1.0% hydrogen peroxide/pbs for 10 min followed by 1.0% sodium borohydride/pbs for 30 min. Sections were blocked for 1 h in 0.1% BSA/0.4% Triton-X-100/PBS and incubated overnight at room temperature in blocking solution containing rabbit anti-c-fos diluted at 1:5,000 (sc-52, 41

50 Santa Cruz Biotechnology, Santa Cruz, CA). The next morning, sections were washed and incubated at room temperature for 1 h in blocking solution containing biotinylated goat anti-rabbit IgG diluted at 1:200 (BA-1000, Vector Laboratories, Burlingame, CA) followed by 1 h in ABC solution diluted 1:800 in PBS (PK6100, Vector Laboratories, Burlingame, CA) and 10 min in DAB-nickel solution. Finally, sections were washed with 0.1 M phosphate buffer (PB), mounted on gelatin-coated slides, and coverslipped. For quantification of c-fos immunoreactivity (c-fos IR) in the central nucleus of the amygdala (CeA), paraventricular nucleus of the hypothalamus (PVN) and nucleus of the solitary tract (NTS), digital images of sections were acquired using a digital camera attached to a Zeiss microscope (Zeiss, Thornwood, NY). For each brain, two sections per area were analyzed, and special care was taken to compare only sections within the same plane along the rostro-caudal (CeA and PVN) or dorso-ventral (NTS) axis. c-fos IR was quantified as optical density using the NIH program Scion Image. Tissue Culture Studies: INS-1 cells were seeded in 35-mm 6-well plates at a density of 2 x 10 5 cell/well in 1.5 ml of media consisting of RPMI-1640 supplemented with 10% heatinactivated FBS, 1.0 mm sodium pyruvate, 2.0 mm L-glutamine, 50.0 μm β- mercaptoethanol and 0.5 mg/ml gentamicin sulfate and grown in a 37 C incubator in an atmosphere of 5% CO 2 and 95% air and 100% humidity for 3 days until nearly confluent. On Day 4, cells were washed with PBS and replaced with fresh media. On Day 5, cells were pre-incubated for 2 h in 2.0 ml of buffer consisting of KRB supplemented with 0.1% BSA and 30 mg/dl glucose and then washed twice with 2.0 ml of the same buffer solution. Cells were then incubated for 1 h in 1.0 ml of KRB supplemented with 0.1% BSA, 200 mg/dl glucose and either 1.0 nm GLP-1, 0.01 nm Ex4 or 1.0 nm Ex4 with or 42

51 without 100 nm dhex. Finally, incubation buffer was harvested, centrifuged, decanted and stored at -20 C for IRI assay, and cells were washed once with 1.0 ml of preincubation buffer and then extracted with 1.0 ml of acid ethanol for 2 h at -20 C, after which acid ethanol was diluted 1:200 with Tris assay buffer for IRI assay in cell layer. IRI was measured using a radio-immunoassay as previously described [261]. Statistical Analysis: All values are reported as mean ± SEM. Data were analyzed using one- or two-way ANOVA or two-way repeated-measures ANOVA. Post-hoc multiple comparisons were made using Tukey s post-hoc test. Significance was set at p<0.05 for all analyses. 43

52 RESULTS Comparison of i3vt GLP-1 and Ex4-induced anorexia. Consistent with previous reports, i3vt GLP-1 and Ex4 elicited potent, dosedependent reductions in 4-h food intake (Fig. 2.1A and B; p<0.05, one-way ANOVA with Tukey s post-hoc test). However, Ex4 significantly reduced food intake at doses much lower than those of GLP-1. Specifically, 10.0 μg of GLP-1 and 0.1 μg of Ex4 produced comparable degrees of anorexia, reducing food intake to 56 and 45% of control values, respectively. These data indicate that, when administered into the 3 rd ventricle, Ex4 is roughly 100-fold more potent than GLP-1 at reducing food intake. Figure 2.1C illustrates the time course of i3vt GLP-1- and Ex4-induced anorexia. Whereas 3.0 nmol (~10.0 μg) of GLP-1 and 0.03 nmol (~0.1 μg) of Ex4 both actively suppressed food intake up to 4 h, only Ex4 elicited persistent anorexia that remained detectable throughout the 24 h of observation (p<0.05, two-way repeated-measures ANOVA with Tukey s post-hoc test). Furthermore, these doses of GLP-1 and Ex4 both led to the formation of a conditioned taste aversion (Fig. 2.1D; p<0.05, one-way ANOVA with Tukey s post-hoc test). Interestingly, there was a strong trend toward a significantly lower preference ratio of Ex4-treated rats versus GLP-1-treated rats (p=0.052), suggesting that the aversive effects of Ex4 were more pronounced than those of GLP-1. Sensitivity of i3vt GLP-1 and Ex4 to GLP-1r antagonism. Although previous studies have reported an inability to block certain effects of Ex4 with GLP-1r antagonists, these studies did not necessarily account for the significantly greater potency of Ex4 over GLP-1. Therefore, we sought to compare the ability of GLP-1r antagonists to block anorexia and neuronal activation induced by doses 44

53 of i3vt GLP-1 and Ex4 that produce effects of comparable magnitude. Pretreatment with either 10.0 μg of dhex or μg of Ex9 caused near-complete blockade of anorexia induced by 10.0 μg of GLP-1 (Fig. 2.2A and C; p<0.05 by two-way ANOVA with Tukey s post-hoc test). However, whereas 0.1 μg of Ex4 and 10.0 μg of GLP-1 elicited comparable degrees of anorexia, the doses of dhex and Ex9 that nearly abolished GLP- 1-induced anorexia failed to block the effects of Ex4 on food intake (Fig. 2.2B and D). To determine whether neuronal activation in response to GLP-1 and Ex4 was also differentially sensitive to GLP-1r antagonism, the effect of i3vt dhex to block c-fos immunoreactivity (IR) induced by i3vt GLP-1 and Ex4 was compared. At the same doses as used above, GLP-1 and Ex4 both induced c-fos IR in identical brain regions, including the CeA, PVN and the NTS (Fig. 2.3A, B, and C; p<0.05 by two-way ANOVA with Tukey s post-hoc test). The magnitude of c-fos IR induced by GLP-1 and Ex4 was similar in the PVN and NTS, whereas GLP-1 induced slightly more c-fos IR than Ex4 in the CeA. In the CeA, dhex significantly blocked c-fos IR induced by GLP-1 (p<0.05); however, in the PVN and the NTS, this difference failed to reach statistical significance. Nonetheless, for all three regions, the amount of c-fos IR in brains treated with dhex and Ex4 was significantly greater than that of brains treated with saline, dhex alone, or dhex and GLP-1 (p<0.05). These results, combined with the food intake data, suggest that CNS actions of Ex4 are relatively insensitive to competitive GLP-1r antagonism. Potency of Ex4 and sensitivity to GLP-1r antagonism in vitro. Because dhex, a validated but lesser used GLP-1r antagonist [194, 260, 262], failed to block anorexia and neuronal activation induced by i3vt Ex4, we sought to determine whether dhex is an effective antagonist of Ex4 in vitro by assessing its ability 45

54 to block insulin secretion induced by Ex4 in the rat pancreatic islet cell line INS-1. As expected, 1.0 nm GLP-1 significantly augmented insulin secretion above that of glucose alone, and this effect was completely blocked by co-incubation with 100 nm dhex (Fig. 2.4; p<0.05 by two-way ANOVA with Tukey s post-hoc test). However, in contrast to our in vivo data, 0.01 nm Ex4 failed to augment insulin secretion, whereas 1.0 nm Ex4 had an effect that was comparable to 1.0 nm GLP-1. Moreover, this effect was completely blocked by co-incubation with 100 nm dhex (p<0.05). Sensitivity of ip Ex4 to GLP-1r antagonism. To determine whether the insensitivity of Ex4 to GLP-1r antagonism was specific to CNS administration, we assessed the ability of dhex to block anorexia induced by ip Ex4. As expected, 10 μg/kg of ip Ex4 significantly reduced food intake at 4 h (Fig. 2.5; p<0.05 by two-way ANOVA with Tukey s post-hoc test). Surprisingly, pretreatment with 1.0 mg/kg of ip dhex, the same 100-fold excess of antagonist that failed to block anorexia induced by i3vt Ex4, significantly attenuated this effect (p<0.05). Effect of i3vt Ex4 in WT and GLP-1r-/- mice. The insensitivity of CNS Ex4 effects to GLP-1r antagonism raises the possibility that Ex4 may act in part via a GLP-1r-independent mechanism. To determine whether the GLP-1r is required for the central anorectic effect of Ex4, i3vt Ex4 was administered to WT and GLP-1r-/- mice. In WT mice, 1.0 μg of i3vt Ex4 elicited profound anorexia such that daily food intake and body weight were significantly reduced for up to 48 and 72 h, respectively (Fig. 2.6A and B; p<0.05 by two-way repeated-measures ANOVA with Tukey s post-hoc test). Conversely, this same high dose of i3vt Ex4 had no effect on food intake or body weight in GLP-1r-/- mice (Fig. 2.6C and D). 46

55 DISCUSSION Not only has the development of stable GLP-1r agonists and DPP-4 inhibitors brought novel approaches to treat T2DM, but it has also provided tools to study the function of the endogenous GLP-1 system. However, the fact that Ex4 [245], but not DPP-4 inhibitors [247], is associated with weight loss underscores the importance of discerning these drugs pharmacological versus physiological effects as well as potential differences in their mechanisms of action. In order to better understand the distinct anorectic properties of Ex4, we tested the hypothesis that the CNS actions of GLP-1 and Ex4 are different by closely comparing the central anorectic effects of these two peptides. Our data reveal key differences between central GLP-1 and Ex4 with respect to potency, duration of action and sensitivity to GLP-1r antagonism. Ex4, when administered into the CNS, reduces food intake in a manner distinct from that of GLP-1. Specifically, central Ex4 reduced 4-h food intake at doses 30- to 100-fold lower than those required by GLP-1 to cause equivalent anorexia. This difference in potency at 4 h cannot simply be explained by differences in duration of action, as both 3.0 nmol of GLP-1 and 0.03 nmol of Ex4 significantly reduced food intake to a comparable extent from 0-2 and 2-4 h. Consistent with our food intake data, significantly lower doses of central Ex4 than GLP-1 produced comparable degrees of neuronal activation at 2 h. In fact, the magnitudes of c-fos IR induced by 10.0 μg of GLP-1 and 0.1 μg of Ex4 were nearly identical in the PVN and the NTS. Together, these data indicate that Ex4 activates CNS GLP-1r with increased potency relative to GLP-1. Interestingly, unlike the PVN and NTS, the CeA had less c-fos IR in response to central Ex4 than GLP-1. One possible explanation for this discrepancy is that, because 47

56 Ex4 was administered at a dose 100-fold lower than that of GLP-1, less peptide diffused through the neuropil to the CeA, which is not adjacent to the ventricular system. On the other hand, despite producing less neuronal activation in the CeA, an area known to be important for the formation of GLP-1-mediated conditioned taste aversions [179], central Ex4 treatment resulted in an even lower preference ratio for saccharin than did treatment with GLP-1, suggesting that Ex4 induced a significantly greater visceral illness response than GLP-1. Although neither our results, nor those of other investigators, have established a proportional relationship between neuronal activity and behavioral responses elicited by GLP-1r activation, these data are consistent with a role for Ex4 as a high-potency CNS GLP-1r agonist. Not only was central Ex4 more potent than GLP-1, but its anorectic effect was also more prolonged, reducing food intake over 24 h of observation. This result suggests that Ex4 is capable of producing sustained activity of neuronal pathways engaged by CNS GLP-1r stimulation; however, the mechanism for this ongoing activity remains unknown. At present, it is uncertain whether the activity of GLP-1 within the CNS is regulated by DPP-4, which is known to inactivate plasma GLP-1 [76, 201, 202], thereby substantially shortening its circulating half-life and duration of action relative to Ex4. Another possible explanation is that Ex4 may bind to GLP-1r with higher affinity than GLP-1. In support of this hypothesis, Ex4 exhibited greater binding affinity than GLP-1 in RINm5F rat insulinoma cells and rat lung membranes [113]. However, there were no differences in binding affinity between GLP-1 and Ex4 in GLP-1r-transfected CHO cells [118], rat posterior pituitary sections [263] or rat brain sections [101], findings consistent with the results of our INS-1 cell experiments. Regardless of these differences, it remains 48

57 unclear whether GLP-1 and Ex4 remain receptor bound for different periods of time in the CNS, and whether putative differences in dissociation rates or peptide degradation account for differential activation of the GLP-1r or its downstream effectors. Perhaps the most compelling finding to suggest distinct effects of central GLP-1 and Ex4 on food intake was the striking difference in their sensitivity to GLP-1r antagonism. Specifically, 10.0 μg of dhex almost completely blocked anorexia and c- Fos IR induced by 10.0 μg of GLP-1, whereas it failed to block that induced by 0.1 μg of Ex4. This phenomenon is not specific to dhex because there was a similar discrepancy in the ability to block anorexia induced by GLP-1 and Ex4 using the more common GLP- 1r antagonist Ex9. However, we determined that dhex is an effective antagonist of Ex4 in vitro in that it completely blocked the enhancement of glucose-stimulated insulin secretion induced by Ex4 in INS-1 cells. Interestingly, when administered peripherally at 1.0 mg/kg, dhex also proved to be an effective antagonist of Ex4 in vivo in that it completely blocked anorexia induced by 10.0 μg/kg of ip Ex4. Taken together, these data indicate that, compared to GLP-1, Ex4 is relatively insensitive to known GLP-1r antagonists. Moreover, this phenomenon seems to be specific for CNS effects of Ex4 and not peripheral effects, many of which have previously been reported to be sensitive to Ex9 blockade [119, 264, 265]. One possible explanation for the discrepancies between central GLP-1 and Ex4 is that the latter acts at least in part independently of the GLP-1r. However, when administered at a dose that elicited significant anorexia and weight loss in WT mice, central Ex4 had no effect on food intake or body weight in GLP-1r-/- mice. This result, consistent with previous reports [121], supports the hypothesis that the GLP-1r is 49

58 required for the effects of Ex4. However, whereas the lack of Ex4 effects in GLP-1r-/- mice provides a strong basis to rule out GLP-1r-independent effects of Ex4, there is some evidence for both functional [200] and structural [185] differences between the GLP-1 systems of mice and rats. In fact, Sowden and colleagues recently reported that Ex4 increases heart rate in rats but not in mice [252]. Finally, other studies that have reported an inability to block Ex4 effects with GLP-1r antagonists have all been conducted in rats [250, 251, 258]. Although none of these observations provides definitive evidence for GLP-1r-independent effects of Ex4, they do raise the possibility that Ex4 may interact with the GLP-1r in a species-dependent manner. Although difficult to reconcile with the above data, our findings regarding central Ex4 and GLP-1r antagonists are consistent with a small body of literature reporting in vivo effects of Ex4 that are either not recapitulated by GLP-1 [250, 251] or that are insensitive to known GLP-1r antagonists [258, 266]. Specifically, it has been reported that Ex4, but not GLP-1, decreases TSH [250] and ghrelin [251] secretion in rats. However, in the study of TSH secretion, GLP-1 and Ex4 were administered systemically, such that differences could easily be explained by rapid degradation of peripheral GLP-1 by DPP-4. In contrast, in the study of ghrelin secretion, GLP-1 and Ex4 were administered both peripherally and centrally. These two studies are also consistent in that not only did Ex9 fail to block Ex4-induced reductions in TSH and ghrelin secretion, but also Ex9 alone elicited the same effects as the agonists [250, 251]. Similar agonist-like properties of Ex9 have also been observed in vitro in 3T3-L1 adipocytes [267] and L6 myotubes [268] as well as rat and human primary adipocyte [269, 270] and myocyte cultures [271, 272]. Together, these data support the possibility that Ex4, and perhaps 50

59 other closely related peptides, are capable of producing effects distinct from those of GLP-1, although the GLP-1r may very well be required for these unique effects. Although previous studies have reported an inability to block certain effects of Ex4 with GLP-1r antagonists, these studies may not have adequately accounted for the increased potency of Ex4 over GLP-1. Here, we closely controlled for this difference and found that central Ex4, at doses significantly lower than those of GLP-1, acted in the presence of 100- and 1,000-fold excesses of dhex and Ex9, respectively. These data are difficult to reconcile with our in vitro study, in which we found no difference between GLP-1 and Ex4 regarding potency or sensitivity to dhex in INS-1 cells, as well as our peripheral Ex4 food intake study, in which the same 100-fold excess of dhex, this time administered ip, completely blocked ip Ex4-induced anorexia. Although the first discrepancy might easily be explained by obvious differences between animal models and immortalized cell lines, the second is more difficult to explain. Consequently, these data raise the possibility that there are fundamental differences between CNS GLP-1r and peripheral GLP-1r, which may occur at the level of post-translational processing, proteinprotein interactions, or coupling to second-messenger systems. Because studies involving GLP-1r-/- mice have generally found no effect of Ex4 in these animals [121, 210, 211, 252, 257], it seems reasonable to cite pharmacological differences when attempting to explain discrepancies between in vivo effects of GLP-1 and Ex4. However, in many ways the existing data fail to adequately support this hypothesis. For instance, some in vitro studies have found Ex4 to have greater potency and affinity for the GLP-1r than native GLP-1 [113], but these reported differences, at least in potency, are significantly smaller in magnitude than those demonstrated here. 51

60 Regarding antagonist sensitivity, one potential explanation for our findings is that Ex4 binds differently to the GLP-1r and is therefore more able to displace GLP-1r antagonists than GLP-1. However, although several studies provide evidence that GLP-1 and Ex4 interact uniquely with the GLP-1r, these same studies reported either no or very small differences in the ability of GLP-1 versus Ex4 to displace radio-labeled Ex9 [ ]. Taken together, our data, combined with the existing literature, provide conclusive evidence for differential pharmacological profiles of GLP-1 and Ex4, yet further studies are needed to understand whether these differences are sufficient explain the unique in vivo effects of Ex4. In conclusion, our data indicate that the central, but not peripheral, anorectic effect of Ex4 is insensitive to GLP-1r antagonism, yet the GLP-1r is required for the anorectic effect of central Ex4. These data suggest that there are important differences between the in vivo pharmacological properties of GLP-1 and Ex4, particularly regarding interactions with CNS GLP-1r. Moreover, they underscore the need for a greater understanding of how GLP-1 and Ex4 interact with the endogenous GLP-1 system, in the absence of presence of GLP-1r antagonists, if we are to maximize the therapeutic benefit of Ex4 and other GLP-1-based therapies. 52

61 A Hour Food Intake B Hour Food Intake Percent Vehicle * * Percent Vehicle * * GLP-1 (μg) Ex4 (μg) Intake (g) C Interval Food Intake Saline GLP-1 (3.0 nmol) Ex4 (0.03 nmol) * * * * Hours Saccharin/Total Fluid Intake D Hour Preference Ratio * p = vs. GLP-1 * * # Saline GLP-1 Ex4 LiCl Figure 2.1: Comparison of anorectic effects of i3vt GLP-1 and Ex4. A, B: Doseresponse curves for i3vt GLP-1 (A) and Ex4 (B). Cumulative 4-hour food intake is shown. C: Time course of anorectic effects of i3vt GLP-1 (3.0 nmol) and Ex4 (0.03 nmol) over 24 hours. D: Preference ratios for 0.1% saccharin vs. total fluid intake during the 4-hour 2-bottle access to saccharin and water. Saccharin was previously paired with i3vt saline, i3vt GLP-1 (3.0 nmol), i3vt Ex4 (0.03 nmol) or ip LiCl (0.15 M administered at 2.0% body weight. Dotted line represents preference ratio for saline-treated rats. Data are represented as mean ± SEM. * p < 0.05 vs. saline. # p < 0.05 vs. GLP-1. 53

62 A 4-Hour Food Intake B 4-Hour Food Intake Intake (g) Sal/Sal * # Sal/GLP-1 dhex/sal dhex/glp-1 Intake (g) * * Sal/Sal Sal/Ex4 dhex/sal dhex/ex4 C 4-Hour Food Intake D 4-Hour Food Intake 10 8 # 10 8 Intake (g) 6 4 * Intake (g) 6 4 * * Sal/Sal Sal/GLP-1 Ex9/Sal Ex9/GLP-1 0 Sal/Sal Sal/Ex4 Ex9/Sal Ex9/Ex4 Figure 2.2: Effect of GLP-1r antagonists on anorexia induced by i3vt GLP-1 and Ex4. A, B: Rats were pre-treated with i3vt dhex (10 μg) followed by i3vt GLP-1 (10 μg, A) or Ex4 (0.1 μg, B). C, D: Rats were pre-treated with i3vt Ex9 (100 μg) followed by i3vt GLP-1 (10 μg, C) or Ex4 (0.1 μg, D). Cumulative 4-hour food intake is shown. Data are represented as mean ± SEM. * p < 0.05 vs. Sal/Sal. # p < 0.05 vs. Sal/GLP-1. 54

63 c-fos Positive Nuclei A PVN * * * B NTS c-fos Positive Nuclei * * * 0 C CeA c-fos Positive Nuclei * # * * 0 Sal/Sal dhex/sal Sal/GLP-1 dhex/glp-1 Sal/Ex4 dhex/ex4 Figure 2.3: Effect of dhex on c-fos IR induced by i3vt GLP-1 and Ex4. Quantification of c-fos positive nuclei in the PVN (A), NTS (B) and CeA (C) of rats that were treated with i3vt saline or dhex (10 μg) followed by i3vt saline, GLP-1 (10 μg) or Ex4 (0.1 μg) and sacrificed 2 hours later. Data are represented as mean ± SEM. * p < 0.05 vs. Sal/Sal. # p < 0.05 vs. Sal/GLP-1. 55

64 Insulin Secretion * Saline dhex 100 nm * IRI μu/ml # # Glucose GLP nm Ex nm Ex4 1.0 nm Figure 2.4: Effect of dhex (100 nm) on insulin secretion induced by GLP-1 (1.0 nm) and Ex4 (0.01 and 1.0 nm) in the presence of glucose (200 mg%). Data are represented as mean ± SEM. * p < 0.05 vs. Glucose. # p < 0.05 vs. Glucose + GLP-1 (1.0 nm) or Glucose + Ex4 (1.0 nm). 56

65 10 4-Hour Food Intake 8 # Intake (g) * 0 Sal/Sal Sal/Ex4 dhex/sal dhex/ex4 Figure 2.5: Effect of ip dhex (1.0 mg/kg) on anorexia induced by ip Ex4 (10.0 μg/kg). Cumulative 4-hour food intake is shown. Data are represented as mean ± SEM. * p < 0.05 vs. Sal/Sal. # p < 0.05 vs. Sal/Ex4. 57

66 Food Intake (g) Food Intake (g) A C Wildtype Mice Saline Ex4 (1.0 μg) * * * * * Hours GLP-1R -/- Mice Saline Ex4 (1.0 μg) Hours Body Weight Change (g) Body Weight Change (g) B D Wildtype Mice Saline Ex4 (1.0 μg) * * * * * Hours GLP-1R -/- Mice Saline Ex4 (1.0 μg) 24 Hours Figure 2.6: Effect of i3vt Ex4 in wild-type and GLP-1R-/- mice. A, B: Wild-type mice received i3vt saline or Ex4 (1.0 μg). Food intake (A) and body weight change (B) were measured over 96 hours. C, D: GLP-1R-/- mice received i3vt saline or Ex4 (1.0 μg). Food intake (C) and body weight change (D) were measured over 24 hours. Data are represented as mean ± SEM. * p < 0.05 vs. saline. 58

67 CHAPTER 3 Hyperphagia and Increased Fat Accumulation in Two Models of Chronic CNS GLP-1 Loss of Function 59

68 ABSTRACT Central administration of glucagon-like peptide-1 (GLP-1) elicits a robust reduction in food intake, but the role of the endogenous CNS GLP-1 system in the regulation of energy balance remains unclear. Here, we test the hypothesis that activity of the CNS GLP-1 system is required for normal energy balance by employing two methods to achieve chronic CNS GLP-1 system loss of function in rats. These include lentiviral-mediated expression of RNAi to knock down NTS preproglucagon (PPG) and chronic intracerebroventricular (ICV) infusion of the GLP-1 receptor (GLP-1r) antagonist exendin (9-39) (Ex9) to block CNS GLP-1r. NTS PPG knockdown resulted in hyperphagia and exacerbation of high-fat diet-induced fat accumulation with concomitant glucose intolerance, whereas chronic ICV Ex9 elicited hyperphagia, increased fat accumulation and glucose intolerance irrespective of diet. In addition, NTS PPG expression was found to positively correlate with fat mass. Together, these data indicate that the CNS GLP-1 system plays a critical role in the long-term regulation of energy balance. Our findings are significant in that not only do they clarify the role of the CNS GLP-1 system, but they also broaden our understanding of GLP-1 beyond that of a shortterm satiety signal. Therefore, it may be possible to tailor existing GLP-1-based therapies for the prevention and/or treatment of obesity. 60

69 INTRODUCTION The regulation of energy balance requires complex communication between the periphery and the central nervous system (CNS). One component of this network is the gut-brain axis. Upon eating, hormonal, neural and nutritional signals from the GI tract inform the CNS of nutrient availability, leading to activation of compensatory pathways that facilitate appropriate nutrient disposal and maintenance of energy balance [277]. Of these signals, the preproglucagon (PPG)-derived peptide glucagon-like peptide-1 (GLP-1) is unique in that it lies on both ends of the gut-brain axis. Not only is GLP-1 produced in the intestine [253], but it is also expressed in the hindbrain [102]. GLP-1 is also unique in that it regulates numerous physiological processes, including glucose homeostasis and food intake [278]. Traditional models hold that GLP-1 acts in the CNS to regulate energy balance, and much experimental evidence supports this hypothesis. GLP-1 receptors (GLP-1r) are expressed in hypothalamic nuclei known to regulate energy balance [102], and hindbrain PPG neurons project to these areas [103]. Moreover, central administration of GLP-1 reduces food intake and body weight, whereas central administration of GLP-1r antagonists elicits opposite effects [182]. Despite its putative role as a satiety signal, some studies suggest that CNS GLP-1 may contribute to long-term energy balance regulation. Leptin activates NTS PPG neurons and increases hypothalamic GLP-1 content in food-restricted mice and rats [186, 187]. Moreover, hindbrain PPG mrna is elevated in obese Zucker rats, suggesting that CNS GLP-1 activity may be altered in obesity or states of leptin resistance [279]. 61

70 Although the above data support a role for CNS GLP-1 in the regulation of energy balance, much experimental evidence contradicts this hypothesis. Hindbrain PPG neurons are activated by noxious stimuli, yet no activation is seen following a large meal [190]. Moreover, central administration of GLP-1 induces visceral illness and activates the HPA axis [194, 196], suggesting that CNS GLP-1 may mediate illness- or stressinduced anorexia rather than regulate energy balance. Finally, GLP-1r knockout mice exhibit no differences in food intake or body weight on chow or high-fat diet, arguing further against a role for CNS GLP-1 in the regulation of energy balance [120, 280]. At present, the data regarding CNS GLP-1 and energy balance are equivocal, in part due to experimental limitations. GLP-1r knockout mice are subject to developmental compensations and lack CNS specificity. Moreover, although recent studies have employed chronic CNS GLP-1r blockade [281], this approach assumes that CNS GLP-1r are activated solely by hindbrain GLP-1 and not by intestinal GLP-1. Here we address these limitations by comparing RNAi-mediated knockdown of NTS PPG and chronic CNS GLP-1r blockade to test the hypothesis that CNS GLP-1 signaling is required for normal energy balance. Furthermore, we assess the effects of these two treatments under conditions of diet-induced obesity. 62

71 MATERIALS AND METHODS Animals: Adult male Long-Evans rats (Harlan, Indianapolis, IN) were housed individually in standard plastic rodent cages and maintained on a 12-hour light/dark cycle with ad libitum access to food and water. Rats were fed either a standard pelleted chow (CHOW: 3.41 kcal/g, ~5 % fat by kcal, Harlan-Teklad, Indianapolis, IN) or a high-fat diet (HFD: 4.54 kcal/g, 40% butter fat by kcal, Research Diets, New Brunswick, NJ). All animal procedures were approved by the University of Cincinnati Institutional Animal Care and Use Committee (IACUC). Body Composition Parameters: Fat mass and lean mass were measured in conscious rats using a NMR whole-body composition analyzer (Echo Medical Systems, Houston, TX). Conditioned Taste Aversion Studies: Conditioned taste aversion (CTA) to ip 0.15 M lithium chloride (LiCl) was assessed as previously described [259]. However, LiCl was administered at a volume in milliliters equivalent to 1.0% body weight in grams. Glucose Tolerance: Intraperitoneal glucose tolerance tests (ipgtts) were performed in order to isolate the effects of the CNS GLP-1 system and to avoid engaging the peripheral GLP-1 system. Briefly, overnight-fasted rats were injected ip with 25% dextrose at a dose of 1.5 g/kg. Blood glucose levels were measured at 0, 15, 30, 45, 60 and 120 min using glucometers and glucose strips (Accu-Chek, Indianapolis, IN). NTS PPG Knockdown Studies: Lentiviral Vectors: Low-titer (>1.0 x 10 6 IU/ml) and high-titer (>1.0 x 10 9 IU/ml) lentiviral vectors dissolved in PBS were obtained from America Pharma Source (Gaithersburg, MD). These viral vectors expressed either a scrambled (CONTROL) short-hairpin RNA (shrna) or a shrna directed against rat and mouse preproglucagon 63

72 (PPG) under the control of the human U6 promoter, in addition to an independent egfp cassette for detection of transduced neurons. The PPG shrna oligonucleotide sequences are as follows: 5 GATCCAGCATGCTGAAGGGACCTTTACTTCAAGAGAGTAA AGGTCCCTCAGCATGCTTTGG-3 and 5 -AATTCCAAAAAGCATGCTGAAGG GACCTTTACTCTCTTGAAGTAAAGGTCCCTTCAGCATGCTG-3. Tissue Culture Studies: Rat pancreatic islet INS 1 cells were maintained in culture media consisting of RPMI 1640 supplemented with 10% heat-inactivated FBS, 50 μm β- mercaptoehtanol, 100 U/ml penicillin and 100 μg/ml streptomycin and grown in a 37 C incubator in an atmosphere of 5% CO 2 and 95% air and 100% humidity. On Day 1, cells were seeded in 24-well plates at a density such that they would be 40-50% confluent the following day. On Day 2, culture media was replaced by 200 μl of low-titer virus stock per well, and cells were incubated overnight. On Day 3, virus stock was replaced with fresh culture media for an additional 48 h, at which time cells were harvested and stored at -80 C for RNA isolation. Quantitative RT-PCR: Total RNA was isolated using TriReagent according to the manufacturer s instructions. Complementary DNA (cdna) was reverse-transcribed from 1.0 μg of total RNA using the iscript cdna synthesis kit (Bio-Rad, Hercules, CA) and amplified using an icycler (Bio-Rad, Hercules, CA) and the iq SYBR Green Supermix (Bio-Rad, Hercules, CA). Primer sequences were as follows: L32 Forward 5 - CAG ACG CAC CAT CGA AGT TA-3 Reverse 5 -AGC CAC AAA GGA CGT GTT TC-3 at 61.2 C; PPG Forward 5 -GGT TGA TGA ACA CCA AGA GGA-3 Reverse 5 -CCT GGC CCT CCA AGT AAG A-3 at 55 C (IDT, Coralville, IA). Primers were optimized as previously described [282], and all samples were run in triplicate. PPG 64

73 expression was normalized to that of the constitutively-expressed ribosomal protein L32, and relative expression was quantified as previously described [282]. Viral Delivery: Rats were anesthetized with ketamine/xylazine and placed into a stereotaxic frame (David Kopf Instruments, Tujunga, CA). To target the NTS, a 26- gauge bilateral guide cannula (Plastics One, Roanoake, VA) was slowly lowered and allowed to rest for 5 min at the following coordinates: AP -5.3 mm from the inter-aural line, ML +/-0.6 mm, and DV -7.4 mm from skull. Using a micro-infusion pump (Harvard Apparatus, Holliston, MA), high-titer lentiviral vectors were infused via Hamilton syringes attached to a 30-gauge bilateral internal cannula (Plastics One, Roanoake, VA) projecting 1.0 mm below the tip of the guide cannula. For each rat, 2.0 μl of virus stock was infused on each side over 20 min, and 5 min later, the guide and internal cannulas were slowly removed and the skin sutured. Experiment #1: Prior to surgery, CHOW-fed rats were divided into two groups: CONTROL and PPG. Following viral delivery, body weight and food intake were measured daily for 12 days. On the day of sacrifice, rats were deeply anesthetized with sodium pentobarbital and perfused transcardially with DEPC-treated 0.1 M phosphatebuffered saline (DEPC PBS) followed by 4.0% paraformaldehyde/pbs. Brains were postfixed at 4 C for 24 h in 4.0% paraformaldehyde/pbs and stored at 4 C in 30.0% sucrose/depc PBS. Serial coronal forebrain and hindbrain sections were collected at 25 μm using a freezing microtome and stored at -20 C in DEPC-treated cryoprotectant. Experiment #2: Prior to surgery, body composition was measured, and CHOW-fed rats were divided into two groups (CONTROL or PPG) matched for body weight, fat mass and lean mass. Following viral delivery, body weight and food intake were measured 65

74 daily for 2 weeks and weekly thereafter. CTA was assessed and body composition measured at 3 and 5 weeks, respectively. At 6 weeks, rats were sacrificed and their brains processed for histology as described in Experiment #1. Experiment #3: Prior to surgery, body composition was measured, and CHOW-fed rats were divided into two groups (CONTROL or PPG) matched for body weight, fat mass and lean mass. Following viral delivery, body weight and food intake were measured daily for 2 weeks and weekly thereafter. Rats were maintained on CHOW for 6 weeks followed by HFD for 4 weeks. Body composition was measured at 2, 6 and 10 weeks, and glucose tolerance was measured at 5 and 9 weeks. At 10 weeks, rats were sacrificed by CO 2 asphyxiation. Whole brains were harvested, and the caudal medulla was dissected, flash-frozen in isopentane on dry ice and stored at -80 C. To determine the relationship between hindbrain PPG expression and fat mass, tissue from CONTROL shrna rats was processed for qpcr as described above. PPG In Situ Hybridization: In situ hybridization was performed on hindbrain sections as previously described [283]. Antisense crna probes complementary to rat PPG (399 bp) were generated by in vitro transcription and labeled using 35 S-labeled UTP. The PPG fragment was cloned into the Bluescript SK vector, linearized with HindIII restriction enzyme and transcribed with T7 RNA polymerase to generate the crna probe. Hybridization with a sense probe was used as a negative control. Standard curves constructed from co-exposed 14C standard slides (American Radiolabeled Chemicals, Inc., St. Louis, MO) were used to verify that all expressed signals were within the linear range of the film. The NTS region was defined according to the rat brain atlas of Paxinos and Watson [284]. 66

75 GFP Immunohistochemistry: After washing with PBS, hindbrain sections were incubated at room temperature (RT) in 0.3% glycine/pbs for 20 min followed by 0.03% SDS/PBS for 10 min. Sections were blocked for 2 h at RT in 3.0% NDS/0.25% Triton X-100/PBS and incubated overnight at RT in blocking solution containing chicken anti-gfp (Abcam, Cambridge, MA) diluted at 1,1000. The next morning, sections were washed with PBS and incubated for 2 h at RT in blocking solution containing biotinylated donkey antichicken IgG (Jackson ImmunoResearch, West Grove, PA) diluted at 1:1,000. Sections were then washed with PBS and incubated for 2 h at RT in blocking solution containing Alexa-Fluor 488-conjugated streptavidin (Invitrogen, Carlsbad, CA) diluted at 1:200. Finally, sections were washed with PBS, mounted on gelatin-coated slides and coverslipped with gelvatol mounting medium. Chronic ICV Ex9 Studies: ICV Minipump Implantation: Under ketamine/xylazine anesthesia, rats were implanted with lateral ventricular cannulas connected via PVC tubing to osmotic pumps (Alzet, Cupertino, CA) that delivered either saline or the GLP-1R antagonist exendin (9-39) (Ex9: 100 μg/day, 21 st Century Biochemicals, Marlboro, MA). Pump duration was 6 weeks (Model 2006) for Experiment #1 and 4 weeks (Model 2004) for Experiment #2. Experiment #1: Rats were fed CHOW or HFD for 4 weeks. Prior to surgery, body composition was measured, and within each diet rats were divided into two groups (CHOW Saline, CHOW Ex9, HFD Saline, HFD Ex9, n=10/group) matched for body weight, fat mass and lean mass. Body weight and food intake were measured daily for one week post-surgery and weekly thereafter. Glucose tolerance and body composition were measured 4 and 5 weeks post-surgery, respectively. However, in this 67

76 experiment glucose was administered ip at a flat dose of 0.75 g. At 5 weeks, rats were sacrificed via CO 2 asphyxiation. Whole brains were harvested, flash-frozen in isopentane on dry ice and stored at -80 C. In addition, trunk blood was collected and plasma harvested and stored at -80 C. Experiment #2: Prior to surgery, body composition was measured, and CHOW-fed rats were divided into four groups (Saline, Ex9 AL, Ex9 PF and Ex9 SC, n=10/group) matched for body weight, fat mass and lean mass. Rats in the Saline and Ex9 AL groups were fed ad libitum, and Ex9 PF rats were pair-fed to match the intake of the Saline rats. An additional group of rats receiving the same dose of Ex9 only subcutaneously (Ex9 SC) was included to rule out the possibility of ICV Ex9 blocking peripheral GLP-1R. Body weight and food intake were measured daily for one week post-surgery and weekly thereafter. Body composition and glucose tolerance were measured at 4 weeks, and 2 days later rats were sacrificed as described above. Statistical Analysis: All values are reported as Mean ± SEM. Data were analyzed using Student s t-test, one- or two-way ANOVA or two- or three-way repeated-measures ANOVA. Post-hoc multiple comparisons were made using Tukey s post-hoc test. Significance was set at p<0.05 for all analyses. 68

77 RESULTS RNAi against PPG significantly decreases PPG expression in vitro and in vivo. To validate the efficacy of our PPG shrna-expressing lentivirus, we first assessed the ability of the virus to knock down PPG expression in the rat pancreatic islet cell line INS-1, which has been reported to express PPG [285]. At 48 h, PPG mrna in PPG-infected cells was significantly decreased (92%) relative to CONTROL-infected cells, indicating successful knockdown (Fig. 3.1A, p=0.0019). Next, we assessed the ability of the virus to knock down PPG expression in rat brain. At 12 d post-infection, PPG rats expressed significantly (47%) less PPG mrna in the NTS relative to CONTROL rats (Fig. 3.1C, p < ), whereas PPG mrna was unchanged in the ventrolateral medulla (Fig. 3.1D). Together, these data indicate that our PPG shrnaexpressing lentivirus effectively knocks down PPG expression in vitro and in vivo, and they confirm that our stereotactic targeting was specific for the NTS. NTS PPG knockdown leads to increased food intake and body weight and selective changes in body composition. Following viral infection, both CONTROL and PPG rats exhibited significant anorexia and weight loss. However, by 2 weeks PPG rats weighed significantly more than CONTROL rats, and this difference persisted throughout the duration of the experiment (Fig 3.2A, p=0.004). This increase in body weight was accompanied by hyperphagia, which was significant from 2 weeks onward (Fig 3.2B, p=0.003). Body composition analysis revealed that the difference in body weight apparent at 2 weeks was associated with significant preservation of fat mass (Fig. 3.2C, p<0.001) as well as lean 69

78 mass (Fig. 3.2D, p=0.003) in PPG vs. CONTROL rats. However, beyond 2 weeks there were no significant differences in fat mass or lean mass gained. Because NTS PPG neurons are activated by stimuli associated with visceral illness [190] and CNS GLP-1r antagonism blocks the response to visceral illnesss [193, 194], we assessed the ability of CONTROL vs. PPG rats to form a CTA to ip LiCl. Surprisingly, both CONTROL and PPG rats exhibited preference ratios for 0.1% saccharin significantly below 0.5 (0.17 and 0.14, respectively), indicating that there was no significant difference in the ability of CONTROL vs. PPG rats to form a CTA to ip LiCL (Fig. 3.2E). NTS PPG knockdown exacerbates HFD-induced obesity and glucose intolerance. Previous studies have reported that hindbrain PPG expression is significantly increased in obese Zucker rats and HFD-fed mice [279, 281]. In addition, HFD-fed mice given twice-daily injections of the GLP-1r agonist exendin-4 were relatively protected against HFD-induced fat accumulation. Based on these observations, we predicted that NTS PPG knockdown would enhance fat accumulation in response to HFD. To this end, we infected rats and maintained them on CHOW for 6 weeks followed by HFD for 4 weeks and assessed changes in body weight, body composition and food intake. Consistent with the above results, PPG rats were significantly heavier (~25g) than CONTROL rats at 2 weeks post-infection (Fig 3.3A, p=0.006), and this difference remained constant for the 6 weeks that the animals were maintained on CHOW. Interestingly, after 4 weeks of high-fat feeding, the weight difference between PPG and CONTROL rats had increased to roughly 40g (p<0.001). Body composition analysis revealed that, once again, at 2 weeks PPG rats had significantly more lean mass (Fig. 70

79 3.3D, p<0.001) and a trend toward more fat mass relative to CONTROL rats, and from 2-6 weeks there were parallel changes in both lean and fat mass between the two groups. However, after 4 weeks of high-fat feeding, PPG rats had gained significantly more fat mass (Fig. 3.3C, p<0.001) than CONTROL rats, whereas changes in lean mass between the two groups were not significantly different. Finally, PPG rats were significantly hyperphagic relative to CONTROL rats throughout the entire study (Fig. 3.3B, p<0.001). Because recent evidence suggests that the CNS GLP-1 system plays a direct role in the regulation of peripheral glucose homeostasis [130, 131, 281], we measured ip glucose tolerance under CHOW-fed and HFD-fed conditions. There was no significant difference in glucose tolerance between PPG and CONTROL rats while maintained on CHOW (Fig. 3.3E and F); however, after 4 weeks of high-fat feeding, PPG rats were significantly more glucose intolerant than CONTROL rats. Specifically, PPG rats were hyperglycemic relative to CONTROL rats at 45, 60 and 120 min, and area under the curve (AUC) over baseline was significantly increased in PPG vs. CONTROL rats (Fig. 3.3G and H, p=0.0356). Hindbrain PPG expression correlates positively with fat mass in HFD-fed rats. The above data, combined with previous observations associating increased hindbrain PPG expression with obesity and high-fat feeding [279, 281], suggest that the activity of the CNS GLP-1 system may vary with energy balance. To better understand this putative relationship, we correlated hindbrain PPG mrna with terminal body weight and body composition parameters in the above CONTROL shrna-infected rats. There was a significant positive correlation between PPG mrna and body weight (Fig. 3.4A, r=0.5384, p=0.0174). Upon closer examination, PPG mrna correlated even more 71

80 strongly with fat mass (Fig. 3.4B, r=0.7207, p=0.0005), whereas there was no significant correlation with lean mass (Fig. 3.4C, r= ). Chronic ICV Ex9 increases body weight, food intake, and fat mass and impairs glucose tolerance in CHOW- and HFD-fed rats. The data from the NTS PPG knockdown studies support the hypothesis that the activity of the CNS GLP-1 system is upregulated in diet-induced obesity in an effort to prevent excess fat accumulation. Based on this hypothesis, we predicted that, relative to CHOW-fed rats, HFD-fed rats would be more sensitive to chronic CNS GLP-1r blockade and would therefore show a greater degree of hyperphagia and fat accumulation. Contrary to our prediction, chronic ICV Ex9-treated CHOW- and HFD-fed rats both gained significantly more weight (Fig. 3.5A, p<0.001) and ate significantly more (Fig. 3.5B, p<0.001) than their saline-treated controls, and the degree of weight gain and hyperphagia was not significantly different between the two diets. Weight gain in response to chronic ICV Ex9 was primarily the result of a selective increase in fat mass (Fig. 3.5C, p<0.0001) and not lean mass (Fig. 3.5D). Consistent with their increased fat mass, chronic ICV Ex9-treated CHOW- and HFD-fed rats were also glucose intolerant relative to their saline-treated controls (Fig. 3.5E and F, p=0.0021). Chronic ICV Ex9-induced weight gain and glucose intolerance are secondary to hyperphagia and increased fat mass, respectively. In order to better understand the mechanisms underlying chronic ICV Ex9- induced weight gain and glucose intolerance, we assessed the ability of chronic ICV Ex9 to increase weight and impair glucose tolerance independent of hyperphagia and increased fat mass. To this end, we included a group of rats receiving chronic ICV Ex9 72

81 that were pair-fed to saline-treated controls. In addition, we included a group of rats receiving the same dose of chronic Ex9 only subcutaneously to assess the specificity of chronic ICV Ex9 for CNS GLP-1r. Consistent with the above data, ad libitum-fed chronic ICV Ex9-treated rats gained significantly more weight (Fig. 3.6A, p<0.001) and ate significantly more (Fig. 3.6B, p<0.001) than saline-treated controls, whereas these effects were absent in pair-fed chronic ICV Ex9-treated rats. Similarly, ad libitum-fed chronic ICV Ex9-treated rats gained significantly more fat mass than saline-treated controls (Fig. 3.6C, p=0.003), whereas changes in lean mass were not significantly different (Fig. 3.6D). Interestingly, pair-fed Ex9-treated rats exhibited a trend toward increased fat accumulation relative to saline-treated controls, but this difference failed to reach statistical significance. Glucose tolerance was not significantly different between groups; however, as expected, there was a trend toward impaired glucose tolerance in ad libitum-fed chronic ICV Ex9-treated rats (Fig. 3.6E and F). Finally, there were no differences between rats receiving chronic subcutantous Ex9 and saline-treated controls on any of the measured parameters. 73

82 DISCUSSION To date, the role of the endogenous CNS GLP-1 system in the regulation of energy balance has remained elusive, largely because of discrepancies between genetic and pharmacological studies [120, 182]. Despite such discrepancies, these models suffer from several limitations, including that they fail to directly target hindbrain-derived GLP- 1. Here we address these limitations by employing two distinct methods to achieve chronic CNS GLP-1 system loss of function in adult rats. These include RNAi to knock down NTS PPG and chronic ICV Ex9 to block CNS GLP-1r. Here we provide strong evidence that the endogenous CNS GLP-1 system indeed contributes to the regulation of energy balance. Specifically, NTS PPG knockdown resulted in hyperphagia and exacerbation of HFD-induced obesity, whereas chronic ICV Ex9 increased food intake and fat accumulation irrespective of diet. Together, these data support the hypothesis that, at least in rats, both endogenous NTS PPG and CNS GLP-1r activity modulate food intake to determine one s defended level of adiposity. Importantly, the present results challenge traditional models of GLP-1 system function, which hold that GLP-1 acts as a short-term satiety signal. Rather, our data, combined with recent experimental evidence, favor a model whereby GLP-1 regulates energy balance on a short- and long-term basis. Indeed, work by Williams and colleagues suggests that gut-derived GLP-1 acts as a physiological satiety signal in a manner similar to that of cholecystokinin (CCK) [216, 218]. Similarly, work by Hayes and colleagues suggests a role for endogenous hindbrain GLP-1r signaling in mediating nutrient- and gastric distension-induced satiety [217]. Together, these data support the hypothesis that endogenous peripheral and hindbrain GLP-1r activity limit individual 74

83 meal size. However, our data indicate that, on a chronic basis, NTS PPG and CNS GLP- 1r activity contribute to the overall regulation of body weight. Although NTS PPG knockdown and chronic ICV Ex9 both result in hyperphagia and weight gain, key discrepancies exist between these two models. Regarding NTS PPG knockdown, the initial weight change occurs within the context of significant postsurgical weight loss such that, rather than gaining more weight than CONTROL rats, PPG rats lose significantly less weight, which is largely accounted for by lean mass. However, after 2 weeks, both groups grow in parallel until the rats are switched to HFD, at which point PPG rats gain significantly more fat mass. Conversely, in the chronic ICV Ex9 model, there is considerably less post-surgical weight loss, and Ex9 dynamically increases weight gain, which is of comparable magnitude in CHOW and HFD-fed rats and is largely accounted for by fat mass. Regarding these discrepancies, several explanations are possible. First, they may simply reflect differences in experimental design. After all, in the NTS PPG knockdown model, rats were infected with virus, maintained on CHOW and then switched to HFD, whereas in the chronic ICV Ex9 model, rats were maintained on CHOW or HFD and then implanted with ICV minipumps. This alternative design was employed largely to test the hypothesis that the activity of the CNS GLP-1 system is selectively upregulated in dietinduced obesity; however, the duration of the minipumps also precluded a longitudinal design. Thus, it is possible that the observed changes in weight, fat mass and lean mass merely reflect differences in the size and body composition of the rats used in the studies, the specific timing of treatments relative to diet exposures and differential compensation for NTS PPG knockdown vs. chronic ICV Ex9. 75

84 An alternative explanation is that the two models target different components of the CNS GLP-1 system namely, NTS PPG and CNS GLP-1r. Although it is often assumed that CNS GLP-1r are activated solely by hindbrain-derived GLP-1 because of the short circulating half-life of gut-derived GLP-1 [201], it is possible that both sources contribute to overall CNS GLP-1r activity. In addition, NTS PPG knockdown targets all three PPG-derived peptides, including GLP-1, GLP-2 and oxyntomodulin, and despite considerable evidence that Ex9 blocks anorexia induced by oxyntomodulin [121, 173, 231, 286], the extent to which Ex9 antagonizes the actions of GLP-2 remains a point of debate [229, 287, 288]. Therefore, it is possible that discrepancies between the two models reflect differential roles of NTS PPG vs. overall CNS GLP-1r activity. Hindbrain GLP-1 neurons are activated by a variety of stimuli, including CCK, LiCl, LPS, artificial gastric distension and leptin [186, 190, 191]. Because several of these stimuli are associated with interoceptive stress, it is noteworthy that, in the NTS PPG knockdown model, the initial divergence in food intake and body weight occurs within the context of significant post-surgical weight loss. Thus, it is possible that the surgery and viral infection represent interoceptive stressors that differentially stimulate NTS PPG, leading to relative protection from post-surgical anorexia and weight loss in PPG vs. CONTROL rats, followed by normal growth in both groups. In addition, HFDinduced obesity is associated with hyperleptinemia and metabolic endotoxemia [289, 290]. Thus, it is possible that as fat mass and plasma leptin and LPS levels increase in response to HFD, so, too does NTS PPG, and the increased adiposity observed in HFDfed PPG rats may represent a failure to upregulate NTS PPG in order to mitigate HFDinduced fat accumulation. 76

85 The above interpretation supports a model whereby the CNS GLP-1 system regulates energy balance in a context-specific manner such that it mediates illness- or stress-induced anorexia and protects against diet-induced obesity. However, chronic ICV Ex9-treated rats exhibit hyperphagia and weight gain largely in the absence of illness or stress, and these changes occur irrespective of diet. These differences raise the possibility that chronic ICV Ex9 may not be specific for hindbrain-derived GLP-1 and that gut-derived GLP-1 may also contribute to overall CNS GLP-1r activity. In support of this hypothesis, a high degree of GLP-1 binding occurs in circumventricular organs [101, 104]. Moreover, although NTS PPG neurons are thought to project widely throughout the CNS, the only proven projections are to the hypothalamic dorsomedial and paraventricular nuclei [103, 190]. Therefore, it is possible that chronic ICV Ex9 blocks not only context-specific GLP-1r activity initiated by hindbrain-derived GLP-1, but also ongoing GLP-1r activity initiated by gut-derived GLP-1, which may serve to tonically inhibit food intake. Together, the NTS PPG knockdown and chronic ICV Ex9 data support the hypothesis that the endogenous CNS GLP-1 system contributes to the regulation of energy balance. However, our CTA and glucose tolerance data are inconsistent with previous reports implicating endogenous CNS GLP-1 in the regulation of visceral illness [193, 194] and glucose homeostasis [130, 131, 281]. Although our data argue against required roles for CNS GLP-1 in mediating visceral illness and directly regulating glucose homeostasis, such roles cannot be ruled out, as it is possible that insufficient loss of function, compensation and/or differences in experimental design could explain the lack of effects. 77

86 In conclusion, our data indicate that both knockdown of NTS PPG and chronic CNS GLP-1r blockade result in hyperphagia and increased fat accumulation, implying that the endogenous CNS GLP-1 system plays a critical role in the long-term regulation of energy balance. In addition, our data reveal a positive correlation between NTS PPG expression and fat mass, although further studies are needed to determine the significance of this relationship. These findings are significant in that they broaden our understanding of GLP-1 function beyond that of a short-term satiety signal, thereby making it a potential target for the prevention and/or treatment of obesity. 78

87 A 125 INS-1 Cells B % CONTROL CONTROL ** PPG C 125 NTS D 125 Ventrolateral Medulla % CONTROL *** % CONTROL CONTROL PPG 0 CONTROL PPG E F Figure 3.1: RNAi against PPG significantly decreases PPG expression in vitro and in vivo. A: Quantification of PPG mrna in INS-1 cells 48 hours after infection with a lentivirus encoding either a scrambled (CONTROL) or PPG-specific (PPG) shrna. B: Representative image of GFP immunoreactivity 12 days after intra-nts lentivirus infusion. C, D: Quantification of PPG mrna in NTS (C) and ventrolateral medulla (D) 12 days after intra-nts lentivirus infusion. E, F: Representative images of hindbrain PPG mrna 12 days after intra-nts infusion of CONTROL (E) or PPG (F) lentivirus. Data are represented as MEAN ± SEM. ** p<0.01, *** p<0.001 vs. CONTROL. 79