Handouts. Handouts 2/11/ Thank you for joining us today

Transcription

1 2/11/2016 Thank you for joining us today Agenda: Applications of NGS in Transplantation Marcelo A. Fernández-Viña, Ph.D. Director Histocompatibility, Immunogenetics, and Disease Profiling Laboratory Stanford Medical School Blood Center Palo Alto, CA Evaluation of MIA FORA NGS Test and Software Lisa Creary, PhD Research Associate Histocompatibility, Immunogenetics and Disease Profiling Laboratory Stanford University School of Medicine The MIA FORA Solution Carly J. Callender, MS, CHS(ABHI) Regional Sales Manager Immucor - LIFECODES All Content 2015 Immucor, Inc. Handouts All Content 2015 Immucor, Inc. Handouts All Content 2015 Immucor, Inc. 1

2 Marcelo Fernandez Vina Conflict of Interest: Co-Founder Sirona Genomics Next Generation Sequencing (NGS) and its Role in Transplantation Marcelo A. Fernández Viña, Ph.D. Professor Department of Pathology Stanford School of Medicine Stanford University 2 The HLA system High degree of polymorphism at most of the expressed loci (function) Lack of a single predominant allele, high degree of heterozygosity (function) Strong linkage disequilibrium (unknown, function?) 1

3 HLA-Class I Organization of a class II alpha gene 2

4 HLA Nomenclature 2010 (field delimiters) HLA A * 24 : 02 : 01 : 01 HLA A * 24 : 02 : 01 : 02 L Expression variants Locus * Group of alleles (serotype) AA# Silent Mutations Non-coding regions ARS Identical that are Allele Mismatches A*02:01 A*02:09 These alleles differ in regions that are not thought to affect allorecognition (one amino acid replacement at residue 236) The amino acid sequences distinguishing some alleles may be located in segments of the molecule that are not likely to elicit immune responses (cytoplasmic and trans membrane domains) Antigen Recognition Site 3

5 Probability of Overall Survival by HLA Matching for Early Disease Stage S u 0.7 r 0.6 v 0.5 i 0.4 v a 0.3 l 0.2 8/8 HLA Matched (n=835) 7/8 HLA Matched (n=379) 50% 39% 28% 6/8 HLA Matched (n=241) 0.1 Log-rank p-value = < Months after transplant AUD08_14.ppt Why not whole-genome sequencing? Inadequate coverage of complex genomic regions, such as HLA. Conventional WGS (30x avg. coverage) provides only sparse coverage of HLA. Complexities due to: Indels GC-rich regions, secondary structure Paralogous genes Repeat regions across HLA loci Cost. Using WGS, to achieve adequate coverage of HLA would require >1,000X avg. coverage 4

6 Coverage HLA coverage over WGS A B DRB1 DQB1 DQA1 DPB1 DPA1 C A B DRB1 DQB1 DQA1 DPB1 DPA1 C A B DRB1 DQB1 DQA1 DPB1 DPA1 C A B Sample 1 Sample 2 Sample 3 DRB1 DQB1 DQA1 DPB1 DPA1 C Sample 4 Average Average Average Average Minimum Minimum Minimum Minimum J.Immunol Jun 15;148(12): HLA-J, a second inactivated class I HLA gene related to HLA-G and HLA-A. Implications for the evolution of the HLA-A-related genes. Messer G, Zemmour J, Orr HT, Parham P, Weiss EH, Girdlestone J. Ragoussis and co-workers described a class I HLA gene that maps to within 50 kb of HLA-A. Comparison of the nucleotide sequences of HLA-J alleles shows this gene is more related to HLA-G, A, and H. All alleles of HLA-J are pseudogenes because of deleterious mutations that produce translation termination either in exon 2 orexon 4. HLA-J appears, like HLA-H, to be an inactivated gene that result from duplication of an Ag-presenting locus related to HLA-A. Evolutionary relationships as assessed by construction of trees suggest the four modern loci: HLA-A, G, H, and J were formed by successive duplications from a common ancestral gene. In this scheme one intermediate locus gave rise to HLA-A and H, the other to HLA-G and J. 5

7 Alleles at different HLA loci (genes and pseudogenes) share nucleotide sequences HLA_A and HLA-H (pseudogene) AA Codon A*24:02:01:01 GAC CGG GCC ATG CCG GGC TAC GTG GAC ACG CAG TTC GTG TTC GAC AGC GAC GCG AGC CAG AGG GAG CCG CGG GCG A A*01:01:01:01 A*02:01:01: A*25:01: A*32:01: T H*01:01:01:01 GGC TAC GTG GAC GAT ACG CAG TTC GTG CGG TTC GAC AGC GAC GCC GCG AGC CAG AGG ATG GAG CCG CGG GCG CCG HLA-A, B and HLA-H (pseudogene) AA Codon B*57:01:01 ATC TAC GCC GAG AAC CTG CGG GCG CTC CGC TAC AAC CAG AGC GAG G --- -G A- CT- -G- G B*07:02:01 B*08:01: G A- CT- -G- G B*15:17:01: B*35:01:01: G A- CT- -G- G B*44:02:01: C -C B*51:01:01: AA Codon H*01:01:01:01 ATC GCG TAC AAC GGC GAG AAC CTG CGG CTC CGC TAC CAG AGC GAG G AA Codon A*24:02:01:01 ATC GCG TAC AAC GCC GAG AAC CTG CGG CTC CGC TAC CAG AGC GAG G -C G-- -C- CT- -G- G A- - A*01:01:01:01 A*02:01:01:01 -T- G G-- -C- CT- -G- G A*25:01: G A- - A*32:01: G Polymorphic nucleotide positions: two hybrid alleles HLA typing using high throughput sequencing technologies. Exon-wise amplification of few exons. Whole-gene amplification. 18 6

8 HLA Typing by NGS Wang C, Krishnakumar S, Wilhelmy J, Babrzadeh F, Stepanyan L, Su LF, Levinson D, Fernandez-Viña MA, Davis RW, Davis MM, Mindrinos M High-throughput, high-fidelity HLA genotyping with deep sequencing. Proc Natl Acad Sci U S A. 2012May 29;109(22): doi: /pnas Epub 2012 May 15. PubMed PMID: ; PubMed Central PMCID: PMC New methodology that leverages the power of Next Generation Sequencing (NGS) and long range PCR Interrogated the entire sequences of the class I genes and most of the extent Class II genes in more than 9,000 subjects Potential benefits of next-generation sequencing for HLA typing Clonal template amplification in vitro to eliminate problem of sequencing heterozygous DNA Sufficiently long read length (300+ bp) to cover entire exon (or more) in phase Increased sequence coverage of HLA genes Capability to multiplex patient specimens Potential to complete run and data analysis within one week 20 Practical Advantages or of Extending Sequence Coverage Test complete gene No Assumptions made Transplantation: Detect mismatches thought to be absent Mapping of Disease Susceptibility Factors 7

9 5 UTR UTR 5 UTR UTR 5 UTR UTR 5 UTR UTR 5 UTR UTR 5 UTR UTR 5 UTR UTR 5 UTR UTR HLA-A HLA-B HLA-C HLA-DQA1 HLA-DQB1 HLA-DPB1 HLA-DPA1 HLA-DRB1, 3, 4, 5 NGS HLA TYPING SYSTEM 7. Data analysis 1. Sample Collection 6. Sequencing 2. Long-Range PCR Single amplification condition 5. Library preparation 3. Quantification & Pooling 4. Fragmentation Applicatications of NGS in Clinical Histocompatibility Practice Identification of a novel allele that results in one mismatch Detection of null alleles (resulting from mutations in untested/uncovered areas; no a priori assumptions made) Identification of null alleles allows the identification of nonself epitopes that may be recognized as foreign Identification of mismatches: Immediate identification and characterization of novel alleles; interpretation of clinical significance if mismatched Detection of sequence variations that regulate expression levels (permissible and deleterious if alleles are mismatched) Identification of Novel alleles 8

10 3 3 Patient and Donor are Heterozygous in all HLA loci Difference (mismatch) in one allele of HLA-A Molecules encoded in the HLA system PATIENT Molecules encoded in the HLA system DONOR Encoded in HLA-A locus (Class I) Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) The HLA-A mismatched antigen in the Patient can be recognized as foreign by the Donor s Immune System (Graft versus Host; GvHD and GvL) S-17 SBT: B*45:01, B*40@ NGS: B*45:01,B*40:02:01e1_Exon3, C to G, codon 127 ASN TO LYS. S-108 SBT: DQA1*02:01, DQA1*04:01@ NGS: DQA1*02:01, DQA1*04:01:01i1_Ex3Var C to A substitution codon 180 His to Gln, IV1_x2_IV3_x1. 9

11 ARS Identical that are Allele Mismatches A*0201 A*0209 These alleles differ in regions that are not thought to affect allorecognition (one amino acid replacement at residue 236) The amino acid sequences distinguishing some alleles may be located in segments of the molecule that are not likely to elicit immune responses (cytoplasmic and trans membrane domains) Antigen Recognition Site Clinical Implications of null alleles In bone marrow transplantation, assuming that a donor carries an expressed allele when in fact the allele is not expressed results in a mismatch in the graft-versus host direction Patient: A*02:01, 24:02/24:09N Donor A*02:01, 24:02/24:09N 29 BS-25 DQA1*05:05:01:01, Exon 3 variant, insertion of T, codon 135 (Null allele) 10

12 BS-25 DQA1*05:05:01:01, Exon 3 variant, insertion of T, codon 135; frame shift mutation-> PTC (DQA1*05- Null) TGA = PTC Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 72 Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) x Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 33 11

13 Molecules encoded in the HLA system Encoded in HLA-A locus (Class I) x Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin 34 Clinical Implications of null alleles Null alleles are not expressed: e.g. a subject carrying A*02:01, A*24:09N, has a phenotype of A*02:01, - Assuming that a patient carries an expressed allele when in fact the allele is not expressed results in a mismatch in the rejection direction Patient: Donor A*02:01, 24:02/24:09N A*02:01, 24:02/24:09N 35 Identifying a Null allele (formerly Q ) allele and its biological relevance 12

14 C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity C*16:01 C*03:04 B*08:01 B*45:01 A*02:01 A*23:01 A*24:02 A*24:03 B*15:02 B*15:13 A*68:01 B*15:01 B*15:10 A*34:02 B*51:02 A*68:02 B*15:11 A*33:03 C*07:02 B*57:01 B*35:01 B*53:01 Fluorescence Intensity A B C DRB1 DRB3 DQB DR Normalized MFI Self A B C DRB1 DRB3 DQB1 02:KRUH DR :KKVU Normalized MFI 23:KKVU = 23:01/23:07N/23:17/23:18/23:19Q/23:20/23:23/23:26/23:30/23: 32/23:33/23:34/23:35 Self A B C DRB1 DRB3 DQB1 DPB1 02:01 08:01 03:04 13:01 02:02P 02:01 01:01 23:19N 45:01 16:01 08:04 03:19 01: Normalized MFI Self 13

15 A*01:01:01 GT TCT CAC ACC ATC CAG ATA ATG TAT GGC TGC GAC GTG GGG CCG GAC GGG CGC TTC CTC CGC GGG TAC CGG CAG A*23:01: C G --- -T T AC --- A*23:19Q C G --- -T T AC --- A*01:01:01 GAC GCC TAC GAC GGC AAG GAT TAC ATC GCC CTG AAC GAG GAC CTG CGC TCT TGG ACC GCG GCG GAC ATG GCA GCT A*23:01:01 T A G --- A*23:19Q T A G --- A*01:01:01 CAG ATC ACC AAG CGC AAG TGG GAG GCG GTC CAT GCG GCG GAG CAG CGG AGA GTC TAC CTG GAG GGC CGG TGC GTG A*23:01: C C- -G- -T TT C AC A*23:19Q C C- -G- -T TT C AC A*01:01:01 GAC GGG CTC CGC AGA TAC CTG GAG AAC GGG AAG GAG ACG CTG CAG CGC ACG G A*23:01: A*23:19Q A A*23:01:01 and A*23:19N (Q) differ by one nucleotide replacement at the end of exon-3; replacement alters a splicing site, patient typed as A2, -. This data and previously reported data (13IHWS)indicate that A*23:19Q is null. A*23:19Q is now in the CWD What Mutations affect and abrogate expression of HLA alleles A single nucleotide mutation that introduces a Premature Termination Codon (TAA, TAG, TGA) results in a truncated, often non functional, protein Mutations in sequences of splicing elements (intron-exon junctions) affect or fully abrogate expression of a functional protein Insertion(s)/deletion(s) in exons that change the reading frame for codons result in a non functional and/or truncated protein Splicing modifications that abrogate or diminish HLA expression B* N (STOP : 5) A* L (STOP: 195) A* N (STOP : retained intron 4) B* S (soluble molecule) B* N intron 1 retention A* L use of a cryptic site located 15 nt downstream of the 5' end of exon 3 A* N intron 4 retention B* S exon 5 skipping Exon 1 EXON 2 EXON 3 EXON 4 Exon 5 AG GT G AG AG GGT AG GT AG Enh B A* L (mutation in the promoter CAT box B) B* N (del. 10 nt 17 nt upstream exon 2) A* L (G -> A 7 nt upstream exon 3) A*23N or L (G -> A) A* N (G -> T) B* S (A->G) 42 14

16 Exonic Insertions and Deletions: change the sequence reading frame that introduce PMT A*2311N (STOP : 60 A*6818N (STOP : 59) B*1579N (STOP : 127) A*2611N (STOP: 190) A*0104N A*2307N A*2411N B*5111N (STOP: 196) A*0243N (STOP: 264) Exon 1 EXON 2 EXON 3 EXON 4 A*2311N ins. 23 nt : 25 A*6818N ins. 20 nt : 48 B*1579N ins. 2nt : 86 A*2611N ins. CC : 150 A*0104N A*2307N A*2411N B*5111N ins. C : A*0243N ins. C : Patient and Donor appear as Heterozygous and Matched at all HLA loci Molecules encoded in the HLA system PATIENT Molecules encoded in the HLA system DONOR Encoded in HLA-A locus (Class I) Encoded in HLA-A locus (Class I) Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin Encoded in HLA-B locus (Class I) Encoded in HLA-DRB1 locus (Class II) Paternal origin Maternal origin The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) The HLA-A mismatched antigen in the Patient can be recognized as foreign by the Donor s Immune System (Graft versus Host; GvHD and GvL) Patient is Hemzygous in HLA-A and Donor is Heterozygous in HLA-A; One Difference (mismatch) HLA-A in the HvG direction Molecules encoded in the HLA system PATIENT Molecules encoded in the HLA system DONOR Encoded in HLA-A locus (Class I) Encoded in HLA-A locus (Class I) Encoded in HLA-B locus Encoded in HLA-DRB1 locus (Class II) Encoded in HLA-B locus Encoded in HLA-DRB1 locus (Class II) (Class I) Paternal origin Maternal origin (Class I) Paternal origin Maternal origin The HLA-A mismatched antigen in the Donor can be recognized as foreign by the Patient s Immune System (Host versus Graft; rejection) No mismatch in the Graft versus host direction (No Graft versus Host; No GvHD/ No GvL) 15

17 Typing two DRB5 alleles All reads need to be accounted Correct genotype: DRB5*01:01:01, DRB5*01:08N DRB5*01:02, 0108N DRB5*01:01:01, 01:02 DRB5*01:01:01, 01:08N DRB5*01:02/01:08N identical in exon 2, differ by 19 nt indel in exon 3 DRB5*01:01:01/01:02 identical in exon 3, differ by 3 nt substitutions in exon 2 Many allele groups in HLA-A show one allele with an insertion of an extra C after seven C A* AC CCC CCC.AAG ACA CAT ATG ACC CAC CAC A*0104N C A* G A --G T A* A*0321N C A* G T A*3114N C--- --G T C A* AAAACGCATATGACTCACCAC A*0321N CAAGACACATATGACCCACCA MAARMSMMWWWK A* AAGACACATATGACCCACCAC A*02null CAAAACGCATATGACTCACCA MARAMMSMWWWK Resolution of common and well documented null- alleles ( clinically relevant) Locus Allele related allele Difference Change Resolution Alternative A 0104N EXON 4 ins 1 routine SBT A 0253N EXON 2 PTC routine SBT A 2409N EXON 4 PTC routine SBT A 2411N EXON 4 ins 1 routine SBT A 6811N EXON 1 del 1 ad hoc SSP B N INTRON 1 del 10 ad hoc SSP extend reading by SBT B 4022N EXON 3 PTC routine SBT B 4423N EXON 3 PTC routine SBT B 5111N EXON 4 ins 1 routine SBT Cw 0409N EXON 7 del 1 ad hoc SSP Cw 0507N EXON 3 del 2 routine SBT DRB N INTRON 1 splicing site ad hoc SSP extend reading by SBT DRB5 0108N 0102 EXON 3 del 19 ad hoc SSP DRB5 0110N 0102 EXON 2 del 2 routine SBT del = nuc. deletion ins = nuc. insertion PTC = premature termination codon Cw*0401/Cw*0409N if B*4403 is present DRB5*0102/0108N if possible haplotype is DRB1*1502-DQB1*

18 Detection of C*04:09N (common) and A*31:14N(rare) allele in single pass A*31:01:02 (red line) shows interrupted coverage at the beginning of Exon 4, while A*31:14N (blue line), which differs from A*31:01:02 with one base insertion, show continuous coverage. C*04:01:01:01 (red line) shows interrupted coverage at the end of Exon 7, while C*04:09N(blue line), which differs from C*04:01:01:01 with one base deletion, show continuous coverage. Advantages of NGS Detecting Null Alleles is Clinically Important Current methods assume that most alleles are expressed even when only partial gene region are tested For some well-known and common null alleles, additional specialized testing is required when potentially present No ad hoc testing for rare or new null alleles. Assumptions may be wrong The NGS comprehensive approach described here can detect null alleles routinely in single pass The application of NGS for Optimal Donor Selection (unrelated donors) Criteria for donor selection: Minimal number of mismatches GvH HvG Equally mismatched donors: Quality of the mismatch Permissible (C*03:03?C*03:04) DPB1 TCE-Permissive Low expression GvH target (C, DPB1) 17

19 Nature Genetics 41, (2009) A genome-wide association study identifies variants in the HLA-DP locus associated with chronic hepatitis B in Asians Yoichiro Kamatani, Sukanya Wattanapokayakit, Hidenori Ochi, Takahisa Kawaguchi, Atsushi Takahashi, Naoya Hosono, Michiaki Kubo, Tatsuhiko Tsunoda, Naoyuki Kamatani, Hiromitsu Kumada, Aekkachai Puseenam, Thanyachai Sura, Yataro Daigo 1, Kazuaki Chayama, Wasun Chantratita, Yusuke Nakamura & Koichi Matsuda A Novel Variant Marking HLA-DP Expression Levels Predicts Recovery from Hepatitis B Virus Infection Rasmi Thomasa, Chloe L. Thio, Richard Apps,Ying Qa, Xiaojiang Gao, Darlene Marti, Judy L. Stein, Kelly A. Soderberg, M. Anthony Moody, James J. Goedert, Gregory D. Kirk, W. Keith Hoots, Steven Wolinsky and Mary Carrington Variation in the 3 untranslated region of HLA-DPB1 is associated with spontaneous clearance of hepatitis B virus in both Japanese and U.S. populations. The mechanism facilitating viral clearance may be related to the A G single-nucleotide polymorphism rs , which marks HLA-DP cellsurface expression. The rs g allele is associated with high expression of HLA-DP, and the rs a allele is associated with low expression. The 496GG genotype, which confers recessive susceptibility to HBV persistence, also associates in a recessive manner with significantly higher levels of HLA-DP surface protein and transcript level expression in healthy donors, suggesting that differences in expression of HLA-DP may increase the risk of persistent HBV infection. HLA-DP surface protein levels correlate with the 496A/G genotype in the 3 UTR region of HLA- DPB1. Rasmi Thomas et al. J. Virol. 2012;86:

20 HLA-DPB1 mrna levels correlate significantly with the 496A/G variant in the 3 UTR region of HLA- DPB1. Rasmi Thomas et al. J. Virol. 2012;86: DPB1 Genomic Structure, Associated DPB1 Single-Nucleotide- Polymorphism Haplotypes, and Resulting HLA-DP Expression. Fleischhauer K. N Engl J Med 2015;373: High HLA-DP Expression and Graft-versus-Host Disease Effie W. Petersdorf, M.D., Mari Malkki, Ph.D., Colm O huigin, Ph.D., Mary Carrington, Ph.D., Ted Gooley, Ph.D., Michael D. Haagenson, M.S., Mary M. Horowitz, M.D., Stephen R. Spellman, M.B.S., Tao Wang, Ph.D., and Philip Stevenson, M.S. N Engl J Med 2015; 373: August 13, 2015DOI: /NEJMoa

21 The linkage of HLA-DPB1 and rs was used to assign the rs allele to the mismatched HLA-DPB1 allele in recipients and donors. rs is included in the haplotype to show that rs a haplotypes can encode either rs a or G. Multivariable Models of Transplant Outcomes for rs g-linked HLA-DPB1 Mismatches Relative to rs a-linked HLA-DPB1 Mismatches in Recipients. N = 744 rs a recipients; 693 rs g recipients. Hazard Ratios for Outcomes of HLA-DPB1 Mismatches in Transplant Recipients, According to the rs Allele Linked to the Mismatch. Petersdorf EW et al. N Engl J Med 2015;373:

22 Probability of Grade II, III, or IV Acute Graft-versus-Host Disease. Petersdorf EW et al. N Engl J Med 2015;373: Our Work in Characterization of DP variation Cloning and Sequencing: 16 DPA1 52 DPB1 DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA DPB1*02:01:02 L_AA DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA DPB1*02:01:02v1 L_AA DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA DPB1*04:01:31 L_AA DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464:01 DPB1*04:01:01:02 L_AA DPB1*398:01 DPB1*19:01e1 H_GA DPB1*39:01x1 DPB1*30:01 DPB1*58:01e1 DPB1*17:01e1 L_AA DPB1*17:01x1 DPB1*11:01:01e1 H_GA DPB1*27:01e1 DPB1*13:01:01/DPB1*107:01e1 H_GA DPB1*85:01e1 H_GA DPB1*01:01:01e1 H_GA DPB1*296:01e1 DPB1*15:01:01e1 H_GA DPB1*18:01e1 H_GA DPB1*05:01:01e1 H_GA DPB1*414:01e1 DPB1*463:01 DPB1*16:01:01 H_GG DPB1*21:01e1 DPB1*06:01e1 H_GG DPB1*09:01:01e1 H_GG DPB1*104:01e1 DPB1*03:01:01 H_GG DPB1*14:01:01e1 H_GG exon 2 to exon4 phylogenetic analysis rs rs HLA-DP Expression levels A A Low A G High G G High 21

23 Low High DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA DPB1*02:01:02 L_AA DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA DPB1*02:01:02v1 L_AA DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA DPB1*04:01:31 L_AA DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464:01 DPB1*04:01:01:02 L_AA DPB1*398:01 DPB1*19:01e1 H_GA DPB1*39:01x1 DPB1*30:01 DPB1*58:01e1 DPB1*17:01e1 L_AA DPB1*17:01x1 DPB1*11:01:01e1 H_GA DPB1*27:01e1 DPB1*13:01:01/DPB1*107:01e1 H_GA DPB1*85:01e1 H_GA DPB1*01:01:01e1 H_GA DPB1*296:01e1 DPB1*15:01:01e1 H_GA DPB1*18:01e1 H_GA DPB1*05:01:01e1 H_GA DPB1*414:01e1 DPB1*463:01 DPB1*16:01:01 H_GG DPB1*21:01e1 DPB1*06:01e1 H_GG DPB1*09:01:01e1 H_GG DPB1*104:01e1 DPB1*03:01:01 H_GG DPB1*14:01:01e1 H_GG Intron 2 Deletion Low High DPB1*02:01:04e1 L_AA DPB1*02:01:02v5 L_AA DPB1*02:01:02v6 L_AA DPB1*02:01:02 L_AA DPB1*02:01:02v3 L_AA DPB1*02:01:02v7 L_AA DPB1*02:02 L_AA DPB1*02:01:02v2 L_AA DPB1*02:01:02v1 L_AA DPB1*02:01:02v4 L_AA DPB1*04:02:01:01 L_AA DPB1*04:02:01:02 L_AA DPB1*04:01:01:01v1 L_AA DPB1*04:01:31 L_AA DPB1*04:01:31 L_AA DPB1*04:01:01:01v4 L_AA DPB1*04:01:01:01v5 L_AA DPB1*04:01:01:01 L_AA DPB1*04:01:01:01v3 L_AA DPB1*464:01 DPB1*04:01:01:02 L_AA DPB1*398:01 DPB1*19:01e1 H_GA DPB1*39:01x1 DPB1*30:01 DPB1*58:01e1 DPB1*17:01e1 L_AA DPB1*17:01x1 DPB1*11:01:01e1 H_GA DPB1*27:01e1 DPB1*13:01:01/DPB1*107:01e1 H_GA DPB1*85:01e1 H_GA DPB1*01:01:01e1 H_GA DPB1*296:01e1 DPB1*15:01:01e1 H_GA DPB1*18:01e1 H_GA DPB1*05:01:01e1 H_GA DPB1*414:01e1 DPB1*463:01 DPB1*16:01:01 H_GG DPB1*21:01e1 DPB1*06:01e1 H_GG DPB1*09:01:01e1 H_GG DPB1*104:01e1 DPB1*03:01:01 H_GG DPB1*14:01:01e1 H_GG E2 264 X(AAGG) E3 282 E4 111 I bp I3 F_DPB1 DPB1 Fragment E2/E4 (5.1kb) R_DPB1 Figure 1: Schematic illustration of DPB1*04:01:01:01 allele. Exons are represented by black boxes. E2 E4 Exons 2 4. I2 I3 introns 2 3 and STRs location. The numbers represent the exon length in base pairs. primers F_DPB1 and R_DPB1 were used to amplify the DPB1 fragment E2/E4. 22

24 STR Analysis : Short - Short DPB1* 01:01:01e1, 05:01:01e1 STR Analysis : Short - Long DPB1* 02:01:02, 13:01:01e1 STR Analysis : Long - Long DPB1* 02:01:02, 02:01:02v3 23

25 Clinical HLA Typing by NGS in Transplantation Extended gene sequence coverage Identification of functional variants (known and novel) Self and non-self alleles (proteins) Evaluation of antibody reactivity in light of self and non-self antigens Accurate assessment of patient-donor compatibility (match grade) Identification of expression determinants and expression variants Optimization of donor selection (Hematopoietic and Solid Organ Transplantation) Bone Marrow Registry: all loci typed at full or extended coverage Immediate identification of eligible donors or indication that no donor is available Shortened Donor Search Process Early Decisions about treatment options and alternative therapies Acknowledgements Lisa Creary Konstantinos Barsakis Kalyan Mallemapati, Sridevi Gangavarapu Dolly Tyan Michael Mindrinos, Sujatha Krishnakumar, Chunlin Wang, Ming Li, Mark Davis, Ronald Davis Stanford HIDPL Sirona Genomics Immucor 24

26 2/10/2016 Evaluation of MIA FORA NGS HLA test and software Lisa Creary, PhD Department of Pathology Stanford Blood Center Research & Development Group Disclosure Alpha and Beta Studies Sirona Genomics Reagents, *Equipment, and Software supplied by Sirona Genomics *Thermal cyclers, Biomek 4000, and Illumina MiSeq NGS-HLA typing requirements for the Stanford Blood Center Unambiguous phased genotypes Automated methods Accurate unedited genotype calls Easy to perform Easy intuitive software Cost effective No reflexive testing 3-4 day TAT 1

27 2/10/2016 MIA FORA NGS HLA TECHNOLOGY Comprehensive coverage of class I (HLA-A, -B, -C) and class II (DPA, -DPB, -DQA, -DQB, -DRB1, -DRB3, - DRB4, -DRB5) genes using long range PCR Multiplexed x24 samples per Illumina MiSeq run Unambiguous phased genotypes at the 4-field level of resolution in a single pass Detection of novel and null alleles Automated and Manual methods developed MIA FORA NGS HLA typing solution Low Throughput kit: 24 samples PCR Master mixes x 1 box, 9 tubes Post PCR x 1 box, 12 tubes x 1 96-well plate (indexes) Compact Easy Storage Alpha Study Conducted from March 2015 to May 2015 On-site training by Sirona Genomics Biomek 4000 programs written and installed by Sirona Genomics Evaluated control DNA samples (x12) supplied by Sirona Genomics using both manual and automated methods Evaluated 138 Stanford Blood Center DNA samples x 2 runs using the manual protocol x 4 runs using the automated protocol 2

28 Pool 2/10/2016 Liquid handling workstations Pre-PCR Post-PCR Perkin Elmer NGS Express Biomek 4000 Long Range Amplification , 5.6 Single PCR condition used for all loci Optimized extensively to preserve allele balance and prevent allele dropout Sirona Workflow Day 1 (~5 hours) Long Range PCR Samples 1-8 Samples 9-16 Samples Quantification, Balancing and Pooling amplicons Day 2 3 Library prep Enzymatic Fragmentation, End repair, A tailing Index adaptor ligation Pooling, Size Selection, qpcr Day 4 (24 hours) Sequencing Day 5 (4 hours) HLA genotype Assignment 2 x 150 bp paired end reads 3

29 2/10/2016 Alpha study Concordance results of Sirona Control DNA samples Total alleles N = 216 A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5 Manual 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% Automated 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% 100% Unambiguous typing at 2-field level of resolution using both manual and automated methods Alpha Study Stanford Blood Center Samples Unedited Genotype Calls Overall Concordance 99.1% Edited Genotype Calls Overall Concordance 99.9% Identical Identical 25.3 Ambiguous Reference, Unambiguous NGS 25.4 Ambiguous Reference, Unambiguous NGS 73.0 Ambiguous Reference, Ambiguous NGS 73.6 Ambiguous Reference, Ambiguous NGS Unambiguous Reference, Ambiguous NGS Unambiguous Reference, Ambiguous NGS Total Samples Alleles with SBT/SSP/SSO reference genotypes Number of NGS alleles Alpha Study Stanford Blood Center Samples Unedited genotypes Edited genotypes A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5 A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5 4

30 2/10/2016 Alpha Study Sources of discordance (Edited Results) NGS Novel alleles (exon variants) BS-25: DQA1*05:05:01:01_Exon 3 Variant, insertion of T, codon 135, frameshift mutation. S-70: DQB1*05:01:01:01_Exon 1 Variant, C to T, Ser to Ser, codon -6. S-100: Novel allele by SBT reported as C*03@/C*14 hybrid. Novel allele by NGS is hybrid of C*07:02:01:01 exon 1-intron2/C*14:02:01 exon 3-3 UTR. Improvements at end of Alpha study Laboratory work Increased pooling amount of DRB amplicons to improve balancing Software database Cloned and sequenced all alleles of IHWG 50 cell lines Included reference sequences for all DPA1 and DPB1 alleles Genotype calling algorithms enhanced to improve accuracy of automatic calls Beta Study Conducted from August 2015 to October 2015 Evaluated 69 Stanford Blood Center DNA samples x 3 runs using the automated protocol 5

31 2/10/2016 Beta Study Stanford Blood Center Samples Unedited Genotype Calls Overall Concordance 99.3% Edited Genotype Calls Overall Concordance 99.5% Identical Ambiguous Reference, Unambiguous NGS Ambiguous Reference, Ambiguous NGS Unambiguous Reference, Ambiguous NGS Identical Ambiguous Reference, Unambiguous NGS Ambiguous Reference, Ambiguous NGS Unambiguous Reference, Ambiguous NGS Disconcordant Disconcordant Total Samples Alleles with SBT/SSP/SSO Number of NGS reference genotypes alleles Beta Study Stanford Blood Center Samples Unedited genotypes Edited genotypes A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5 0 A B C DPA1 DPB1 DQA1 DQB1 DRB1 DRB3 DRB4 DRB5 Beta Study Reasons for discordance (Edited Results) NGS Novel alleles (exon variants) BS-72: A*23:01:01_Exon 4 Variant, C to T, Ala to Val, codon 211. SBC-200: B*40:02:01e1_Exon 3 Variant, T to G, Leu to Arg, codon 95. SBC-202: DQB1*05:01:01:01_Exon 1 Variant, C to T, Ser to Ser, codon -6. SBC-207: DPA1*02:02:02e1_Exon 3 Variant, C to G, Pro to Ala, codon 96. SBC-223: DQB1*05:01:01:01_Exon 1 Variant, C to T, Ser to Ser, codon -6. 6

32 2/10/2016 MIA FORA NGS Software Accurate phase defined unambiguous HLA genotypes Three complementary algorithms: 1) Expected-Maximization to rank alleles based on coverage metrics: Coverage calculated from competitive alignment of PE reads with HLA reference sequences from the IMGT/HLA database and in-house reference sequences 2) Phasing assembly algorithm 3) Bayesian consensus algorithm High Performance server, multiple user access MIA FORA NGS Software MIA FORA NGS Software 7

33 2/10/2016 MIA FORA NGS Software Confidence >=90 Confidence >=70 Confidence >=50 Confidence >=0 non-cwd CWD Overwritten Automatic Call Not found in LD DB Found in LD DB 1/2 1/2 Number of contigs different from that of alleles Number of contigs same as that of alleles? Inconsistence between genotype derived from phased and EM result. SBT/SSO vs NGS Resolving an allele ambiguity Reference genotype: A*23:01/A*23:17, A*29:02 NGS genotype: A*23:17, A*29:02 A*23:01:01 x1 M/M in exon 5 S-225 SBT/SSO vs NGS Resolving a phase ambiguity and identifying a novel allele BS-72 Reference genotype: A*03:78, A*23:01 A*03:78 / A*03:01:01:01 1 nt difference in Exon 4 8

34 2/10/2016 SBT/SSO vs NGS Resolving a phase ambiguity and identifying a novel allele BS-72, Reference genotype: A*03:78/A*03:01:01:01, A*23:01 NGS genotype: A*03:01:01:01, A*23:01:01_Exon4 variant, C > T, Ala >Val, codon 211 A*23:01:01 x1 M/M in exon 4 SBT/SSO vs NGS Identifying a novel allele S-101, Reference Type Result: B*13@, B*38@, one allele is an exon 4 variant? NGS Result: B*13:02:01, B*38:02:01 _Exon 4 variant A to G, Lys to Arg, codon 186. DRB4*01:03:01:02Ne1 S-214 Genomic reference sequence 9

35 2/10/2016 S-16 Evidence of a second allele Unmapped reads that do not align to DRB1*01:03:01:01 Second allele: DRB1*01:01:01:01 Evidence of a second allele S-36 Unmapped reads that do not align to DPA1*01:03:01:04 Second allele: DPA1*02:01:01_x2 intron 1 variants Summary MIA FORA workflows (manual and automated) are very easy to follow Pooling amplicons early on the process reduces hands on time, decrease costs, minimizes deck space used on automated workstations High concordance (99.9%) with reference genotypes Wide gene coverage using 2 x 150 bp paired end reads minimized phased ambiguities for all loci except for some DPB1 allele combinations MIA FORA NGS able to distinguish all genotypes at 3-fields and for the majority of genotypes at 4-field level resolution Software continually improved during Alpha and Beta trials to improve accuracy of automatic calls 10

36 2/10/2016 Acknowledgments Stanford Blood Center Prof Dolly Tyan Prof Marcelo Fernandez-Vina Sridevi Gangavarapu Sirona Genomics Michael Mindrinos Sujatha Krishnakumar Chunlin Wang Ming Li Tommy Liu Jennifer Simonovich Raquel Kuehn Marilyn Fukushima Farbod Babrzadeh 11

37 2/10/ Questions 2 Immucor HLA-NGS Market Entry October 3rd, Immucor, Inc. announced the collaboration with Sirona Genomics - Stanford Genome Technology Center, Stanford University, Palo-Alto, CA December 3 rd, 2015 MIA FORA HLA-NGS Product launched February 3 rd, CE Mark approval for MIA FORA 3 1

38 2/10/2016 MIA FORA delivers whole Gene NGS HLA typing 1. Complete sequence coverage of entire gene Eliminate assumption of uncovered sequence Identification of new alleles, including Null alleles Not applicable for exon based NGS 2. Provide results with no ambiguities in a single pass No secondary testing required to resolve questionable results Shorten turnaround time and reduce cost of testing by eliminating needs for additional testing Not applicable for exon based NGS 3. Provide high Depth of Coverage for accurate base calling Depth of Coverage=The number of sequence read for a particular base e.g. 100 X coverage means, on average, each base was sequenced 100 times 4 Why Illumina Platform? Most widely used NGS platform Very high sequence quality (lowest error) Paired-end sequencing is built into the platform Multiple platforms give high flexibility NextSeq and MiSeq Sample preparation is user-friendly Sample preparation protocols are independent of Illumina 5 Sequencing Power for Every Scale HIGH THROUGHPUT WGS WES T-OME NextSeq 500 HiSeq 2500 HiSeq X Ten PERSONAL SCALE FEW SAMPLES RUN SERIOUS PRODUCTION SCALE! PRODUCTION SCALE MANY SAMPLES RUN MiSeq NextSeq 500 HiSeq 2500 LOW THROUGHPUT TGRS WGS (MICROBES) 6 2

39 2/10/2016 MIA FORA NGS Workflow Long Range PCR Hands on time ~30min Amplification ~6hrs Quantification of PCR Products Hands on time ~1hr Gene Balancing Hands on time ~1hr Library Construction Hands on time ~2hrs Total time ~5hrs Size Selection Hands on time ~10min Total time ~45min Library Amplification Hands on time ~10min Total time ~1.5hrs Library Quantification Hands on time ~30min Total time ~2hrs Sequencing Hands on time ~10min Total time ~24hrs Data processing 4hrs for 24 samples Data Analysis 1hr for 24 samples *Automation Protocols Available for Biomek 4000 (Beckman Coulter)* 7 MIA FORA NGS Turn Around Time From Sample to Results Day 1 Long range PCR (6hrs) Day 2 Gene Balancing (2hrs) Library Construction (5hrs) Day 3 Size Selection (45min) Library Amplification (1.5hrs) Library Quantification (2hrs) MiSeq Run (24hrs) Data Processing (4hrs) Day 4-5 Data Analysis (1hr) 8 9 3

40 2/10/2016 MIA FORA Kit Configuration Sample Size Up to 24 samples/kit to generate typing of 11 genes Class I: HLA-A, -B, -C Class II: HLA- DQA1, -DQB1, -DPA1, -DPB1, -DRB1,3,4,5 10 MIA FORA Kit Configuration Kit Consists of Three Components 1. PCR module (ROU/CE) Nine tubes of All-In-One master mix to cover all 11 genes Single amplification condition for all 11 genes 2. Library module (RUO/CE) Reagents for Fragmentation, End Repair, A-Tailing, Adaptor Ligation, and Library Amplification Pre-aliquot Adaptor Index plate (24 indexes) 3. Software (RUO/CE) Standalone workstation with Pre-loaded software 11 MIA FORA PCR Module Simple Assembly & One Cycling Condition for All Genes Components Competitor 1 Competitor 2 Immucor Primer mix Primer Master Mix Buffer Master mix DNA dntp mix Enzyme *Q-solution DNA **Enzyme DNA Cycling Conditions 1 Competitor 2 Competitor Immucor One condition for DQB1 requires One condition for all genes separate cycling all genes condition *Required for DQB1 **Different amount required for DQB 12 4

41 2/10/2016 Low Drop-out Rate Unique gene balance program Minimizes amplification bias among different gene. Allows for earlier pooling of all loci creating a simpler assay with fewer technical errors Product Details Low Throughput Type-LT 24 SAMPLES Run on a MiSeq platform 5 days High Throughput 4 plates 96 samples Run on a NextSeq platform 7 days

42 2/10/2016 Automation with Beckman Coulter Biomek FX Pre- and post-pcr Software Features o Extended Sequence Analysis Software provide analytical redundancy (3 algorithms) to accurately confirm allele assignment Exceeding ASHI requirement o Haplotype Identification MIA FORA NGS achieves a high level of resolution at allele level Provide accurate haplotype identification Flag novel haplotype for further analysis 18 6

43 2/10/2016 Product Availability MiSeq December 2015 RUO available for US January 2016 CE mark in Europe Canadian License after CE marking in 2016 NextSeq Summer Conclusions Why MIA FORA? All-in-One PCR master mix for simple assembly Single Cycling Condition for all genes Proprietary PCR mix to prevent allele drop out Gene Balancing program for balanced allele coverage Highest coverage for both class I and class II genes Short hands on time Almost zero ambiguities Three algorithms for the most accurate base calling and allele assignment 20 Continuing Education Each complete Attendance Roster: Registration deadline is February 26, 2016 Certificates will be sent via only to those who have registered by March 15, 2016 No registration for CE will be accepted after February 26,

44 2/10/2016 Continuing Education PACE/California DHS Florida BPR ABHI CECs: Contact Hours Attendance Roster: 22 Questions? Please also feel free to questions to Carly Callender: 23 Thank you! 24 8