Dr. Claude Bouchard. John W. Barton, Sr. Chair in Genetics and Nutrition Louisiana State University
|
|
- Oswald Murphy
- 5 years ago
- Views:
Transcription
1 Dr. Claude Bouchard John W. Barton, Sr. Chair in Genetics and Nutrition Louisiana State University
2 2014 SEC Symposium A GENETIC PREDISPOSITION IS AMONG THE DRIVERS OF THE OBESITY EPIDEMIC: IMPLICATIONS FOR OBESITY PREVENTION PROGRAMS Claude Bouchard Pennington Biomedical Research Center
3 Multiple Drivers of Weight Gain and Obesity
4 A Mile-High View of These Drivers Physics Physiology Behavior Environment
5 Physics: First Law of Thermodynamics Energy can change form but it can not be created or destroyed. The increase in energy of a closed system is equal to the heat supplied to the system (dietary calories) minus the work done by it (energy expenditure). Thus weight gain (a gain in energy) occurs in the presence of increased caloric intake and/or decreased energy expenditure.
6 The Role of Physiology So the laws of physics apply but it is not the whole story. For instance, the processing of metabolic fuel can vary in efficiency depending on hormonal and physiological markers. Insulin, glucorticoids, leptin, steroids and other hormones influence nutrient partitioning and the profile of metabolic fuel oxidized or stored Likewise, hepatic, muscular and adipose tissue metabolic states influence the fate of metabolic fuels
7 A Comprehensive Model
8 Social Environment Physical Environment Energy Intake Energy Expenditure Energy Partitioning Fat Accretion Adipogenesis Obesity Overweight Behaviors Biology Adapted from Bouchard C, Rankinen T, 2008
9 Social Environment More recreational eating Food pricing Pressure to consume Eating on the run Fewer meals at home Larger portions Agricultural policies Society of spectators instead of participants Powerful, constant advertising Food labeling Less access to nutritious foods Pressure to be sedentary Nutrition-poor school meals & snacks Physical Environment Environmental pollutants Urban design Building design Energy Intake Energy Expenditure Peripheral regulators of appetite Metabolic fluxes & futile cycles CNVs, mobile elements, etc. Common & rare SNPs Population density & sprawl Energy Partitioning Fat Accretion Adipogenesis Viruses Biology Absence of sidewalks Reliance on automobiles CNS regulators of appetite RMR Gene gene & gene environment interactions Obesity Gut microbiota Overweight Maternal-fetal nutrition Calorie-dense foods Regulators of adipogenesis Smoking cessation Certain medications PA, metabolic rates Lipid oxidation rates Less time in strenuous activity High-fat diets Epigenetics & programming Corn fructose syrup More time in sedentarism Absence of breast-feeding Behavior Larger portions Bouchard C, unpublished
10 Obesogenic Environment Social Environment Built Environment Obesogenic Behavior Biology: defective or predisposing Energy Intake Energy Expenditure Energy Partitioning Fat Accretion Adipogenesis Obesity Overweight Bouchard C, unpublished
11 A Definition of GxE Interaction A gene-behavior interaction effect is present when the response to an a change in behavior is conditional on the genotype of the individual
12 Weight, kg Body Weight Changes in MZ Twins in Response to Overfeeding Body weight (p < 0.02): F = 3.4; R = 0.55 Fat mass (p < 0.05): F = 3.0; R = 0.50 AVF (p < 0.01): F = 6.1; R = Bouchard C et al, New Engl J Med, Twin A Twin B Weight, kg
13 Weight loss, kg Fat loss, kg Weight & Fat Mass Loss in Obese Twins on a 28-day VLC Diet* Twin A R= 0.85 F=12.8 (p<0.001) Twin B Weight loss, kg *1.6 MJ/day, 14 pairs of female MZ twins Twin A R= 0.88 F=17.0 (p<0.001) Fat loss, kg Twin B Hainer V et al, Int J Obes, 2000
14 Obesogenic Environment Obesogenic Behavior Social Environment Built Environment Biology: defective or predisposing Maternal influences Nutritional state Obesity Diabetes or GDM Smoking, etc. In utero effects Wiring Hormone sensitivity DNA methylation Histone modification Energy Intake Energy Expenditure Energy Partitioning Fat Accretion Adipogenesis Obesity Overweight Bouchard C, unpublished
15 Understanding the Meaning of Heritability Coefficients
16 Heritability Estimates of Obesity Traits Heritability is a population parameter h 2 (narrow sense) is the proportion of the phenotypic variance due to additive genetic factors Then h 2 is the upper limit of a trait variance that can be explained by DNA variants Not to be confounded with H 2 (broad sense), which includes not only the additive genetic variance but also dominance, gene-gene interactions, gene-environment interactions
17 Overview of the Heritability Estimates for BMI or Adiposity Heritability, % Nuclear families Adoption studies Twin studies 50-90
18 Heritability of an Aggregated Trait Has Poor Actionable Potential As we have seen, BMI level or risk of obesity is the end product of a constellation of influences. Hence the advantage to focus instead on endophenotypes or intermediary traits
19 Heritability Estimates for Intermediate Traits Relevant to Obesity Heritability in % Energy intake / kg 5-20 Fat intake (%) 20 RMR / kg FFM 40 TEM (%) 40 Level of activity 25 Energy partitioning 20
20 Genes and Obesity
21 Current Compendium of Obesity Genes Derived from GWAS (October 2013) Common Form from GWAS ADAMTS9 GNPDA2 LRP1B NRXN3 SPRY2 BDNF GP2 LY86 NUDT3 TBX15 CADM2 GPRC5B LYPLAL1 OLFM4 TFAP2B CDKAL1 GRB14 MAF PCSK1 THNSL2 CPEB4 HECTD4 MAP2K5 PRKD1 TMEM160 DNAJC27 HOXB5 MC4R PTBP2 TMEM18 DNM3 HOXC13 MSRA QPCTL TNNI3K ETV5 IRS1 MTCH2 RPL27A VEGFA FAIM2 ITPR2 MTIF3 RSPO3 ZNF608 FANCL KCTD15 NEGR1 SEC16B ZNRF3 FLJ35779 KLF9 NFE2L3 SH2B1 FTO LINGO2 NISCH SLC39A8
22 Number of individuals Combined Effect of Risk Alleles at 32 SNPs on Average BMI Atherosclerosis Risk in Communities (ARIC) study, n = 8,120 individuals of European descent Mean BMI (kg/m 2 ) Speliotes EK et al, Nature Genetics, 2010 Number of weighted risk alleles
23 Effect of Maternal or Fetal Homozygosity for a Minor Allele at Candidate Genes on Birth Weight HNF1B < 900 g GCK > 600 g Transcription HNF4A > 790 factor g CRHBP When the < 148 GCK g hepatocyte nuclear Corticotrophin-releasing mutation is factor GCK Transcription 1B < 550 is critical g for hormone-binding present in protein the development Glucokinase factor hepatocyte ADCY5 + CCNL1 of serves as < 113 g pancreas. In 21 babies participates mother in the but not a nuclear glucose factor sensor 4A is ADCY5 MTCH2 in with mutated HNF1B, regulation in of the the fetus, the involved encodes pancreas in < regulation 26 g adenylate and is a birth weight was low hypothalamic-pituitaryadrenal axis. birth weight is Mitochondrial rate-limiting FTO of insulin > 22 secretion. cyclase g enzyme carrier 5, in 2 and in all cases. In 13 of higher When by about gene glucose Accounts sequence metabolism. for about the variants Fat mass was have and tested obesity in about them with unaffected mother is 600 homozygous g. 24,000 GCK 4% of mutations MODY cases. been associated with mothers, 69% with gene birth SNP weights was in were for the minor However, allele when present Birth weight the fetus at a higher investigated normal SGA at fasting in range. more than Homozygotes birth. SNP, birth the weight mutation is is glucose but increased not carried by 790 by g the in SNPs in both genes were associated with birth 28,000 newborns. for the minor and T2DM. in the weight in three ethnic groups. reduced In whites, on present average 9% in both are mother HNF4A homozygotes reduce birth by CCNL1 Homozygosity allele had fetus results encodes The for a in birth low the lower and rare birth homozygotes high birth weights for birth reflect weight-lowering 148 g but mother is also alleles and weight for a mutation. by about 54% 550 g. reduced cyclin-l1, allele weight resulted by weight of carriers reduced which were variation in about by plays a 22 in g 26 g. at fetal two insulin SNPs, secretion resulting resulting a all birth three weight fetus, ethnic 113 birth groups g a higher about macrosomic. role 900 in birth RNA weight. g. from splicing. the GCK lower fetal than genotype the 24% and with the investigated. one fetal allele weight or less. is response to maternal hyperglycemia. normal.
24 Take-Home Messages
25 In Summary Observational data suggest that there is a significant genetic component to obesity There are significant genetic components to multiple intermediate traits causally related to body weight and adiposity Several gene defects can cause obesity; they are rare and account for <10% of the early-onset, severe obesity cases. About 100 DNA variants with small effect sizes have been associated with obesity In brief, genetic predisposition not genetic determinism
26 In Closing Observational and experimental data strongly suggest that the response to manipulations of energy balance by: caloric restriction, reduced sugar and dietary fat, reduction of sedentary behavior and increased PA level is conditioned by genomic variants that remain to be identified and mechanisms that are unknown at this time
27 Pennington Biomedical Research Center
The Genetic Basis of Obesity
The Genetic Basis of Obesity Kaitlin Samocha Wikimedia user: GAThrawn22 DNA and Genes cell DNA gene protein AGCTACCGTTATCCAATGCGCGAGCTATTA A C G T Wikimedia users: Mikael Häggström, GAThrawn22, cacycle
More informationEffects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population
Effects of Obesity Related Genetic Variations on Visceral and Subcutaneous Fat Distribution in a Chinese Population Tao Wang #, Xiaojing Ma #, Danfeng Peng, Rong Zhang, Xue Sun, Miao Chen, Jing Yan, Shiyun
More informationGeneralization of adiposity genetic loci to US Hispanic women
Generalization of adiposity genetic loci to US Hispanic women The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters. Citation Published
More informationGenome-Wide Association for Abdominal Subcutaneous and Visceral Adipose Reveals a Novel Locus for Visceral Fat in Women
Genome-Wide Association for Abdominal Subcutaneous and Visceral Adipose Reveals a Novel Locus for Visceral Fat in Women Caroline S. Fox 1,2,3. *, Yongmei Liu 4. *, Charles C. White 1,5, Mary Feitosa 6,
More informationHeritability and genetic correlations explained by common SNPs for MetS traits. Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK
Heritability and genetic correlations explained by common SNPs for MetS traits Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK The Genomewide Association Study. Manolio TA. N Engl J Med 2010;363:166-176.
More informationSupplementary Online Content
Supplementary Online Content Lyall DM, Celis-Morales C, Ward J, et al. Association of body mass index with cardiometabolic disease in the UK Biobank: a mendelian randomization study. JAMA Cardiol. Published
More informationSupplemental Table 1 Age and gender-specific cut-points used for MHO.
Supplemental Table 1 Age and gender-specific cut-points used for MHO. Age SBP (mmhg) DBP (mmhg) HDL-C (mmol/l) TG (mmol/l) FG (mmol/l) Boys 6-11 90th * 90th * 1.03 1.24 5.6 12 121 76 1.13 1.44 5.6 13 123
More informationBest Practice & Research Clinical Endocrinology & Metabolism
Best Practice & Research Clinical Endocrinology & Metabolism 26 (2012) 211 226 Contents lists available at SciVerse ScienceDirect Best Practice & Research Clinical Endocrinology & Metabolism journal homepage:
More informationARTICLE. Diabetologia (2012) 55: DOI /s
Diabetologia (2012) 55:105 113 DOI 10.1007/s00125-011-2320-4 ARTICLE Association studies of novel obesity-related gene variants with quantitative metabolic phenotypes in a population-based sample of 6,039
More informationSUPPLEMENTARY INFORMATION
Genetic variation near IRS1 associates with reduced adiposity and an impaired metabolic profile Tuomas O Kilpeläinen, M Carola Zillikens, Alena Stančáková, Francis M Finucane, Janina S Ried et al.* * A
More informationReport Date: 11/20/2017
Name: Sample Report Report Date: 11/20/2017 Consult with a licensed healthcare professional before making changes based upon any information contained within this report. These recommendations and explanations
More informationGenetic Terms DNA. Proteins. Genes. Variations. Epigenetics. Alleles
Name: SAMPLE REPORT Consult with a licensed healthcare professional before making changes based upon any information contained within this report. These recommendations and explanations are based upon
More informationNew Perspectives on the Pathogenesis of Obesity
New Perspectives on the Pathogenesis of Obesity Cardiometabolic Congress Mark A. Herman April 23, 2013 No Financial Disclosures Agenda Definitions and the Scope of the Problem Physiological Determinants
More informationGenetic susceptibility to type 2 diabetes and obesity: from genome-wide association studies to rare variants and beyond
Diabetologia (2014) 57:1528 1541 DOI 10.1007/s00125-014-3270-4 REVIEW Genetic susceptibility to type 2 diabetes and obesity: from genome-wide association studies to rare variants and beyond Niels Grarup
More informationHow to Design Studies, Collect Data, and Analyze Data in Nutritional Epidemiology Lu Qi, MD, PhD
How to Design Studies, Collect Data, and Analyze Data in Nutritional Epidemiology Lu Qi, MD, PhD Regents Distinguished Chair and Professor, Tulane University School of Public Health and Tropical Medicine
More informationChapter 10 Lecture. Health: The Basics Tenth Edition. Reaching and Maintaining a Healthy Weight
Chapter 10 Lecture Health: The Basics Tenth Edition Reaching and Maintaining a Healthy Weight OBJECTIVES Define overweight and obesity, describe the current epidemic of overweight/obesity in the United
More informationThe Worldwide Epidemic of Overweight and Obesity - Environmental Causes and Control
The Worldwide Epidemic of Overweight and Obesity - Environmental Causes and Control IDed IFT Summit Conference New Orleans, Louisiana, Feb. 15, 2004 Outline The epidemic Hypotheses about the causes Environment
More informationWorkshop. Factors influencing food intake? How decrease food choice related morbidity/mortality
Workshop Factors influencing food intake? How decrease food choice related morbidity/mortality Modifiable behavioral traits? Strength /weakness Limits to success of interventions? Describe current research
More informationPreface Acknowledgments Introduction Introductory Concepts Definitions and Context Chronological Age and Age Groups Why Study These Phenomena?
Preface Acknowledgments Introduction Introductory Concepts Definitions and Context Chronological Age and Age Groups Why Study These Phenomena? Types of Studies Principles of Measurement and Observation
More informationType 2 diabetes, though poorly understood, is known to be a disease
Review article Genomic Medicine W. Gregory Feero, M.D., Ph.D., and Alan E. Guttmacher, M.D., Editors Genomics, Type 2 Diabetes, and Obesity Mark I. McCarthy, M.D. Type 2 diabetes, though poorly understood,
More informationThe omics approach in measuring the double burden of malnutrition
IAEA Headquarter, Vienna, Austria, 3-5 October 2017 Joint IAEA-WHO-UNICEF workshop on analysis of biological pathways to better understand the double burden of malnutrition and to inform action planning
More informationSponsored Document Sponsored Document Sponsored Document
Sponsored document from Maturitas Genetics and epigenetics of obesity Blanca M. Herrera a, Sarah Keildson a, and Cecilia M. Lindgren a,b, a Wellcome Trust Centre for Human Genetics, University of Oxford,
More informationCordoba 01/02/2008. Slides Professor Pierre LEFEBVRE
Cordoba 01/02/2008 Slides Professor Pierre LEFEBVRE Clinical Research in Type 2 Diabetes : Current Status and Future Approaches Pierre Lefèbvre* University of Liège Belgium Granada, Spain, February 2008
More informationContribution of 32 GWAS-Identified Common Variants to Severe Obesity in European Adults Referred for Bariatric Surgery
Contribution of 32 GWAS-Identified Common Variants to Severe Obesity in European Adults Referred for Bariatric Surgery Reedik Mägi 1,2., Sean Manning 3,4,5., Ahmed Yousseif 3, Andrea Pucci 3,6, Ferruccio
More informationGENETIC INFLUENCES ON APPETITE AND CHILDREN S NUTRITION
GENETIC INFLUENCES ON APPETITE AND CHILDREN S NUTRITION DR CLARE LLEWELLYN Lecturer in Behavioural Obesity Research Health Behaviour Research Centre, University College London Tuesday 8 th November, 2016
More informationTHE PERENNIAL STRUGGLE TO LOSE WEIGHT AND MAINTAIN: WHY IS IT SO DIFFICULT?
THE PERENNIAL STRUGGLE TO LOSE WEIGHT AND MAINTAIN: WHY IS IT SO DIFFICULT? Robert Ferraro, MD Medical Director Southwest Endocrinology Associates, PA Diabetes and Weight Management Center OBESITY The
More informationThe genetics of human obesity
Ann. N.Y. Acad. Sci. ISSN 0077-8923 ANNALS OF THE NEW YORK ACADEMY OF SCIENCES Issue: The Year in Diabetes and Obesity The genetics of human obesity Qianghua Xia 1 and Struan F.A. Grant 1,2,3 1 Division
More informationThe global epidemic of obesity
The global epidemic of obesity Obesity is a genetic disorder Heterogeneity of the genetics of obesity ENVIRONMENT GENE MONOGENIC FORMS -> Early-onset, severe obesity -> Syndromic forms of obesity POLYGENIC
More informationWhat is Metabolic About Metabolic Surgery? The New ADA Recommendations
What is Metabolic About Metabolic Surgery? The New ADA Recommendations Obesity Symposium September 16, 2017 Timothy Howland, MD Lourdes Endocrinology Bariatric from the Greek root bar- ("weight" as in
More informationHEALTHY WEIGHT. ADN del Peso Saludable PERSON TESTED: MARTIN BEDOYA BENAVIDES
HEALTHY WEIGHT ADN del Peso Saludable PERSON TESTED: MARTIN BEDOYA BENAVIDES REFERENCE #: 8539094 DATE OF BIRTH: 1/18/1980 REPORT DATE: March 07, 2018 YOUR PERSONALIZED REPORT CONGRATULATIONS! You will
More informationMetabolic Syndrome. DOPE amines COGS 163
Metabolic Syndrome DOPE amines COGS 163 Overview - M etabolic Syndrome - General definition and criteria - Importance of diagnosis - Glucose Homeostasis - Type 2 Diabetes Mellitus - Insulin Resistance
More informationSu Yon Jung 1*, Eric M. Sobel 2, Jeanette C. Papp 2 and Zuo-Feng Zhang 3
Jung et al. BMC Cancer (2017) 17:290 DOI 10.1186/s12885-017-3284-7 RESEARCH ARTICLE Open Access Effect of genetic variants and traits related to glucose metabolism and their interaction with obesity on
More informationGenome-Wide Population-Based Association Study of Extremely Overweight Young Adults The GOYA Study
Genome-Wide Population-Based Association Study of Extremely Overweight Young Adults The GOYA Study Lavinia Paternoster 1,2 *, David M. Evans 1,2, Ellen Aagaard Nohr 3, Claus Holst 4, Valerie Gaborieau
More informationTHE FIRST NINE MONTHS AND CHILDHOOD OBESITY. Deborah A Lawlor MRC Integrative Epidemiology Unit
THE FIRST NINE MONTHS AND CHILDHOOD OBESITY Deborah A Lawlor MRC Integrative Epidemiology Unit d.a.lawlor@bristol.ac.uk Sample size (N of children)
More informationSubject Index. postprandial glycemia and suppression in serum 51 recommendations 119, 120 supplementation pros and cons 118, 119
Acarbose, diabetes prevention trials 32, 33, 40 42 Accelerator hypothesis accelerators beta cell autoimmunity 140, 141, 147, 150, 151 insulin resistance 140, 142 144, 150 obesity 145 148 diabetes risk
More informationThe Physiology of Weight Regulation: Implications for Effective Clinical Care
Roundtable on Obesity Solutions The Physiology of Weight Regulation: Implications for Effective Clinical Care Lee M. Kaplan, MD, PhD Obesity, Metabolism & Nutrition Institute Massachusetts General Hospital
More informationPERSON TESTED: REFERENCE #: DATE OF BIRTH: REPORT DATE:
HEALTHY WEIGHT PERSON TESTED: Jane Doe REFERENCE #: 123456 DATE OF BIRTH: 3/7/1998 REPORT DATE: 5/25/17 REPORT SUMMARY CATEGORY RATING GENES Weight Loss Ability with Diet and Exercise BELOW AVERAGE FTO,
More informationMetabolic Programming. Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD
Metabolic Programming Mary ET Boyle, Ph. D. Department of Cognitive Science UCSD nutritional stress/stimuli organogenesis of target tissues early period critical window consequence of stress/stimuli are
More informationPERSON TESTED: REFERENCE #: DATE OF BIRTH: REPORT DATE:
HEALTHY WEIGHT PERSON TESTED: Jacky Dave REFERENCE #: 123256 DATE OF BIRTH: 05/07/1988 REPORT DATE: 12/25/2017 YOUR PERSONALIZED REPORT CONGRATULATIONS! You will receive insights about your body that have
More informationLike mother, like offspring Does maternal overweight predict health outcomes?
Like mother, like offspring Does maternal overweight predict health outcomes? Patricia Iozzo, MD, PhD Institute of Clinical Physiology National Research Council (CNR), Pisa, Italy Brussels 16 October 2017
More informationDEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE. Goals
DEVELOPMENTAL ORIGINS OF DIABETES AND CARDIOVASCULAR DISEASE Goals Evolutionary paradox of obesity/diabetes Thrifty gene hypothesis Thrifty phenotype hypothesis Effects of small for gestational age (SGA)
More informationThe Inheritance of Complex Traits
The Inheritance of Complex Traits Differences Among Siblings Is due to both Genetic and Environmental Factors VIDEO: Designer Babies Traits Controlled by Two or More Genes Many phenotypes are influenced
More informationBIOL212 Biochemistry of Disease. Metabolic Disorders - Obesity
BIOL212 Biochemistry of Disease Metabolic Disorders - Obesity Obesity Approx. 23% of adults are obese in the U.K. The number of obese children has tripled in 20 years. 10% of six year olds are obese, rising
More informationObjectives 10/11/2013. Diabetes- The Real Cost of Sugar. Diabetes 101: What is Diabetes. By Ruth Nekonchuk RD CDE LMNT
Diabetes- The Real Cost of Sugar By Ruth Nekonchuk RD CDE LMNT Objectives To explain diabetes To explain the risks of diabetes To enumerate the cost of diabetes to our country To enumerate the cost of
More informationAssociation analyses of 249,796 individuals reveal 18 new loci associated with body mass index
Association analyses of 249,796 individuals reveal 18 new loci associated with body mass index 21 Nature America, Inc. All rights reserved. Obesity is globally prevalent and highly heritable, but its underlying
More informationMetabolic Endocrine Curriculum. Coordinator: Prof. Gianni Marone PHD THESIS
UNIVERSITY OF NAPLES FEDERICO II DOCTORATE PROGRAM IN CLINICAL AND EXPERIMENTAL MEDICINE Metabolic Endocrine Curriculum XXIX CYCLE (2014-2017) Coordinator: Prof. Gianni Marone PHD THESIS Understanding
More informationSupplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits.
Supplementary Table 1. Candidate loci that were associated with diabetes- and/or obesity-related traits. All With Fst in the With long With SNP(s) at the 5' top 5% bracket haplotypes regulatory region
More informationNIH Public Access Author Manuscript Obesity (Silver Spring). Author manuscript; available in PMC 2013 December 01.
NIH Public Access Author Manuscript Published in final edited form as: Obesity (Silver Spring). 2013 June ; 21(6): 1256 1260. doi:10.1002/oby.20319. Obesity-susceptibility loci and the tails of the pediatric
More informationEndocrine Disrupters as Obesogens
Endocrine Disrupters as Obesogens Is the environment making us fat? Bruce Blumberg, Ph.D. Department of Developmental and Cell Biology Department of Pharmaceutical Sciences Developmental Biology Center
More informationHuman Genetics (Learning Objectives)
Human Genetics (Learning Objectives) Recognize Mendel s contribution to the field of genetics. Review what you know about a karyotype: autosomes and sex chromosomes. Understand and define the terms: characteristic,
More informationMaximizing the Role of WIC Nutritionists in Prevention of DM2 among High Risk Clients ESTHER G. SCHUSTER, MS,RD,CDE
Maximizing the Role of WIC Nutritionists in Prevention of DM2 among High Risk Clients ESTHER G. SCHUSTER, MS,RD,CDE Heavy Numbers Surgeon General report: 68% of adults in U. S. are overweight or obese
More informationGenetic predisposition to obesity leads to increased risk of type 2 diabetes
Diabetologia (2011) 54:776 782 DOI 10.1007/s00125-011-2044-5 ARTICLE Genetic predisposition to obesity leads to increased risk of type 2 diabetes S. Li & J. H. Zhao & J. Luan & C. Langenberg & R. N. Luben
More informationAn Introduction to Quantitative Genetics I. Heather A Lawson Advanced Genetics Spring2018
An Introduction to Quantitative Genetics I Heather A Lawson Advanced Genetics Spring2018 Outline What is Quantitative Genetics? Genotypic Values and Genetic Effects Heritability Linkage Disequilibrium
More informationCS2220 Introduction to Computational Biology
CS2220 Introduction to Computational Biology WEEK 8: GENOME-WIDE ASSOCIATION STUDIES (GWAS) 1 Dr. Mengling FENG Institute for Infocomm Research Massachusetts Institute of Technology mfeng@mit.edu PLANS
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationPersonalized therapeutics in diabetes
Personalized therapeutics in diabetes Leen M. t Hart Molecular Cell Biology & Molecular Epidemiology Leiden University Medical Center Epidemiology & Biostatistics VU University Medical Center Diabetes
More informationFTO Polymorphisms Are Associated with Obesity But Not with Diabetes in East Asian Populations: A Meta analysis
BIOMEDICAL AND ENVIRONMENTAL SCIENCES 22, 449 457 (2009) www.besjournal.com FTO Polymorphisms Are Associated with Obesity But Not with Diabetes in East Asian Populations: A Meta analysis BO XI #, + AND
More informationEligibility The NCSF online quizzes are open to any currently certified fitness professional, 18 years or older.
Eligibility The NCSF online quizzes are open to any currently certified fitness professional, 18 years or older. Deadlines Course completion deadlines correspond with the NCSF Certified Professionals certification
More informationIndia is one of the diabetes capitals of the world and at the same time the capital
Yajnik Undernutrition and Overnutrition During Pregnancy in India: C. S. Yajnik, MD, FRCP India is one of the diabetes capitals of the world and at the same time the capital for low birth weight (LBW)
More informationNIH Public Access Author Manuscript Int J Obes (Lond). Author manuscript; available in PMC 2015 July 01.
NIH Public Access Author Manuscript Published in final edited form as: Int J Obes (Lond). 2014 July ; 38(7): 887 905. doi:10.1038/ijo.2014.49. An evolving scientific basis for the prevention and treatment
More informationBIOLOGICAL D E T E R M I N AN T S O F H E AL T H ( )
BIOLOGICAL D E T E R M I N AN T S O F H E AL T H ( 3. 1. 5 ) BIOLOGICAL Body weight Blood pressure Birth weight Impaired glucose regulation Genetics Blood Cholesterol BODY WEIGHT The body weight of an
More informationObesity in aging: Hormonal contribution
Obesity in aging: Hormonal contribution Hormonal issues in obesity and aging Hormonal role in regulation of energy balance Genetic component in hormonal regulation Life style contribution to hormonal changes
More informationRick Fox M.A Health and Wellness Specialist
Metabolic Diseases Rick Fox M.A Health and Wellness Specialist Metabolic Diseases Metabolism is the process your body uses to get or make energy from the food you eat. Food is made up of proteins, carbohydrates
More informationHeredity and Health-Related Fitness
Heredity and Health-Related Fitness A Note From the Editors In the February Issue of the Physical Activity and Fitness Research Digest we noted the importance of heredity as a factor affecting the development
More information2 International Conference on Predictive, Preventive and Personalized Medicine and Molecular Diagnostics
Dr. Cristina Patassini 2 International Conference on Predictive, Preventive and Personalized Medicine and Molecular Diagnostics Las Vegas, 3-5 november 2014 Obesity worldwide According to the World Health
More informationIndividualising the Diet for Obesity based on Genetic Testing
Individualising the Diet for Obesity based on Genetic Testing Marilyn Glenville PhD Former President, Food and Health Forum, The Royal Society of Medicine Personalised Nutrition Personalised nutrition
More informationOvernutrition During Pregnancy
Kate Schlag, Berkeley School of Public Health Spring 2014 Overnutrition During Pregnancy And Its Link to Childhood Obesity The purpose of this fact sheet is to discuss the mechanisms by which overnutrition
More informationEnergy Balance and Weight Management: Finding Your Equilibrium
Chapter 9 Energy Balance and Weight Management: Finding Your Equilibrium Key Terms 1. appetite: A psychological desire to eat that is related to the pleasant sensations often associated with food. 2. extreme
More informationTOTAL FITNESS and WELLNESS. Exercise, Diet, and Weight Control
1 TOTAL FITNESS and WELLNESS Third Edition 2 Chapter 8 Exercise, Diet, and Weight Control 3 4 5 6 7 8 9 Outline Define obesity and discuss potential causes Relationship between obesity and health risk
More informationMaturity-onset diabetes of the young (MODY) is a heterogeneous group
Over the years, different forms of maturity-onset diabetes of the young (MODY) have been identified, with mutations in a number of different genes associated with a MODY-like phenotype. Depending on the
More informationAppetite control, Food Choice and Physical Activity Implications for Energy Balance and Weight Control
Appetite control, Food Choice and Physical Activity Implications for Energy Balance and Weight Control John Blundell Chair of PsychoBiology University of Leeds Energy Balance and Active Living: Perspectives
More informationGenes, Aging and Skin. Helen Knaggs Vice President, Nu Skin Global R&D
Genes, Aging and Skin Helen Knaggs Vice President, Nu Skin Global R&D Presentation Overview Skin aging Genes and genomics How do genes influence skin appearance? Can the use of Genomic Technology enable
More information3/20/2011. Body Mass Index (kg/[m 2 ]) Age at Issue (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Mokdad A.H.
U.S. Adults: 1988 Nineteen states with 10-14% 14% Prevalence of Obesity (*BMI > 30, or ~ 30 lbs overweight for 5 4 woman) Metabolic John P. Cello, MD Professor of Medicine and Surgery, University of California,
More informationPersonal Report. Prepared for: John Smith
Personal Report Prepared for: John Smith REPORT SUMMARY MENTAL & PHYSICAL FOUNDATION Intrinsic Motivation to Exercise Less Likely BDNF Addictive Behavior / Stimulus Control More Likely DRD2/ANNK1 Power
More informationCurrent Connections Between Genetics and Obesity
Digital Commons at Loyola Marymount University and Loyola Law School Undergraduate Library Research Award ULRA Awards Current Connections Between Genetics and Obesity Nicole Lopes Loyola Marymount University
More informationBMI. Summary: Chapter 7: Body Weight and Body Composition. Obesity Trends
Chapter 7: Body Weight and Body Composition Obesity Trends What Is a Healthy Body Weight? There is no ideal body weight for each person, but there are ranges for a healthy body weight A healthy body weight
More informationCONTENTS. Introduction. SourcesandSuggestedReadings Preface xi Acknowledgments xiii Credits xiv. Chapter 1 Introductory Concepts...
CONTENTS Preface xi Acknowledgments xiii Credits xiv Introduction Chapter 1 Introductory Concepts...................... 3 Definitions and Context 4 Chronological Age and Age Groups.......................
More informationEarly life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016.
Early life determinants of Non-Alcoholic Fatty Liver Disease and NASH DR JULIANA MUIVA-GITOBU KENYA PAEDIATRIC ASSOCIATION CONFERENCE APRIL 2016. Outline Definition NAFLD and NASH Magnitude of the problem
More informationBody Weight and Body Composition
Body Weight and Body Composition Chapter 7 Obesity Trends What Is a Healthy Body Weight? There is no ideal body weight for each person, but there are ranges for a healthy body weight A healthy body weight
More informationControl of body weight & composition. Nutrition 202 Advanced Nutritional Energetics R. D. Sainz Lecture 14
Control of body weight & composition Nutrition 202 Advanced Nutritional Energetics R. D. Sainz Lecture 14 1 Control of body weight & composition diet physical activity drugs genetics From: Heymsfield,
More information10/19/2017. How Nutritional Genomics Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH
Disclosures Joyanna Hansen How Affects You in Nutrition Research and Practice Joyanna Hansen, PhD, RD & Kristin Guertin, PhD, MPH Consultant Nutricia North America Research Support Academy of Nutrition
More informationGestational Diabetes: Long Term Metabolic Consequences. Outline 5/27/2014
Gestational Diabetes: Long Term Metabolic Consequences Gladys (Sandy) Ramos, MD Associate Clinical Professor Maternal Fetal Medicine Outline Population rates of obesity and T2DM Obesity and metabolic syndrome
More informationMonthly WellPATH Spotlight November 2016: Diabetes
Monthly WellPATH Spotlight November 2016: Diabetes DIABETES RISK FACTORS & SELF CARE TIPS Diabetes is a condition in which the body does not produce enough insulin or does not use the insulin produced
More informationNutrition. By Dr. Ali Saleh 2/27/2014 1
Nutrition By Dr. Ali Saleh 2/27/2014 1 Nutrition Functions of nutrients: Providing energy for body processes and movement. Providing structural material for body tissues. Regulating body processes. 2/27/2014
More informationDiabetes is a condition with a huge health impact in Asia. More than half of all
Interventions to Change Health Behaviors and Prevention Rob M. van Dam, PhD Diabetes is a condition with a huge health impact in Asia. More than half of all people with diabetes live today in Asian countries,
More informationObesity in Children. JC Opperman
Obesity in Children JC Opperman Definition The child too heavy for height or length Obvious on inspection 10 to 20% over desirable weight = overweight More than 20% = obese Use percentile charts for the
More informationA S Y N T H E S I Z E D H A N D B O O K ON G E S T A T I O N A L D I A B E T E S
A S Y N T H E S I Z E D H A N D B O O K ON G E S T A T I O N A L D I A B E T E S P R E F A C E Dear reader, This is a synthesized handbook conceived to serve as a tool to health personnel in the screening,
More information11/17/2009. HPER 3970 Dr. Ayers (courtesy of Dr. Cheatham)
Weight Management Chapter 11 HPER 3970 Dr. Ayers (courtesy of Dr. Cheatham) Weight Loss Introduction Many athletes, although not overweight, seek to lose body weight (especially body fat) Increase Power
More informationIndex. Page references in bold refer to figures and page references in italic refer to tables.
Page references in bold refer to figures and page references in italic refer to tables. Adrenaline, high-fat response in post-obese 142 Alcohol absorption 11-12 balance equation 17 and obesity 10-11 thermogenesis
More informationGoal: To identify the extent to which different aspects of psychopathology might be in some way inherited
Key Dates TH Mar 30 Unit 19; Term Paper Step 2 TU Apr 4 Begin Biological Perspectives, Unit IIIA and 20; Step 2 Assignment TH Apr 6 Unit 21 TU Apr 11 Unit 22; Biological Perspective Assignment TH Apr 13
More informationMBB317. Dr D MANGNALL OBESITY. Lecture 2
MBB317 Dr D MANGNALL OBESITY Lecture 2 When the structure of the insulin receptor was first discovered it was assumed that the active beta subunit tyrosine kinase would phosphorylate some intracellular
More informationPCSK1, MC4R, FTO, MAP2K5, GNPDA2
/, 2017, Vol. 8, (No. 55), pp: 93593-93607 The role of established East Asian obesity-related loci on pediatric leptin levels highlights a neuronal influence on body weight regulation in Chinese children
More informationBody Composition. Lecture Overview. Measuring of Body Composition. Powers & Howely pp Methods of measuring body composition
Body Composition Powers & Howely pp 344-356 Lecture Overview Methods of measuring body composition Two-component system Body fatness for health & fitness Obesity and weight control Diet, exercise, and
More informationUnderstanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes. October 2015; SAGLB.DIA
Understanding phenotypes of prediabetes: essential to influencing progression to type 2 diabetes October 2015; SAGLB.DIA.15.10.0821 Acknowledgement The content of this slide deck summarizes the key points
More informationOverview. o Limitations o Normal regulation of blood glucose o Definition o Symptoms o Clinical forms o Pathophysiology o Treatment.
Pål R. Njølstad MD PhD KG Jebsen Center for Diabetes Research University of Bergen, Norway Depertment of Pediatrics Haukeland University Hospital Broad Institute of Harvard & MIT Cambridge, MA, USA Hypoglycemia
More informationThis document has been downloaded from TamPub The Institutional Repository of University of Tampere
This document has been downloaded from TamPub The Institutional Repository of University of Tampere Publisher's version The permanent address of the publication http://urn.fi/urn:nbn:fi:uta- 201412222517
More informationHERITABILITY OF BODY WEIGHT: AN EVIDENCE FOR OBESITY?
Int. J. Pharm. Med. & Bio. Sc. 2014 Manjula Shantaram and Balakrishna Shetty, 2014 Review Article ISSN 2278 5221 www.ijpmbs.com Vol. 3, No. 1, January 2014 2014 IJPMBS. All Rights Reserved HERITABILITY
More informationUnderstanding & Interpreting Body Composition Measures
BODY COMPOSITION Understanding & Interpreting Body Composition Measures Body composition = component of health-related fitness & = component of metabolic fitness Unlike other health-related fitness Not
More information