How to Design Studies, Collect Data, and Analyze Data in Nutritional Epidemiology Lu Qi, MD, PhD

Size: px
Start display at page:

Download "How to Design Studies, Collect Data, and Analyze Data in Nutritional Epidemiology Lu Qi, MD, PhD"

Transcription

1 How to Design Studies, Collect Data, and Analyze Data in Nutritional Epidemiology Lu Qi, MD, PhD Regents Distinguished Chair and Professor, Tulane University School of Public Health and Tropical Medicine Adjunct Professor, Harvard School of Public Health

2 Nutritional Epidemiology Hippocrates ( BC), the father of Western medicine, put it: If we could give every individual the right amount of nourishment and exercise, not too little and not too much, we would have found the safest way to health. Oral cancer in betel nut chewers in Travancore: its aetiology, pathology and treatment. Lancet 1933 Modern Nutritional Epidemiology Recent 30 years

3 Dr. Walter Willett

4 Nutritional Epidemiology Lifestyle Metabolic Changes Diet Genetic Other factors Human health

5 Study design 1. Descriptive levels of nutrient intakes, temporal trend 2. Observational epidemiology a. Case-control b. Cohort 3. Experimental randomized clinical trials 4. Mechanistic - e.g. biomarkers, metabolomics

6 Exposures in Nutritional Epidemiology 1. Nutrients (vitamins, minerals, amino acids, etc.) 2. Foods and beverages (fruits & vegetables, alcohol, sugary drink) 3. Dietary patterns (combinations of foods and nutrients) 4. Biomarkers (blood, urine, hair, nail, etc.) 5. Others: additives (antioxidants, coloring and stabilizing agents), contaminants, chemicals formed in cooking or processing

7 Diet assessment methods Current diet Usual diet Diet record 24 hr recall Food frequency questionnaire FFQ

8 Diet Assessment Primer

9 24-hour recall Recall and report food and beverage intake in preceding 24 hours Usually performed through in person, phone interview Standard questions, detail information Open-ended response structure Usually takes mins to complete

10 24 hr recall: strengths Easily administered, quick interview, cheap Long-term memory not required High response rate Low literacy skill required Can obtain detailed information Analytic flexibility Does not interfere with eating behavior

11 24 hr recall: limitations Require well trained interviewers to collect information using standard and consistent approach Participant memory may affect accuracy How many needed to represent usual diet? May not adequately account for day-to-day variation Difficulty in recalling quantities

12 24-hr recall: application Describe average diet of a group/population, e.g. The National Health and Nutrition Examination Survey (NHANES) Evaluate the effectiveness of an intervention study to change diet Compare mean intake over time Assess total dietary intake and/or particular aspects of the diet

13 Self-administered tools

14 Food/Diet Record Self-reported record of food and beverage intake over a period of days (3-7 days) Detail description of food, preparation method, and quantities Quantities assessed by: actual weighing, volume measurement, estimation assisted by photographs

15

16 Diet Records: strengths Often regarded as gold standard Quantitatively accurate information Less likely to omit food Long-term memory not required

17 Diet Records: Limitations Substantial training of participants Literate and highly motivated participants Participant fatigue and reduced cooperation (maximum 7 consecutive days) May alter usual eating habits Still may not represent usual intake Burdensome coding (may need to contact participants for clarification) High cost, not suitable to large cohorts The Baltimore Longitudinal Study of Aging, a longitudinal study

18 Diet Record: application Clinical and research setting to monitor compliance to dietary intervention Validation study of other dietary assessment methods

19 Food Frequency Questionnaires (FFQ) Conceptual Basis 1. Long-term intake is important 2. It may be better to have crude information over a long period than precise information for a short period 3. It is easier to recall usual intake Structure: a. food list b. frequency information Choice of Foods: Limited vs comprehensive typically ranges from 80 to 120

20 Food list Frequency

21 Administration of FFQ 1. Self-administered (e.g., mail, pre-interview) 2. Personal interview 3. Telephone interview 4. Web-based

22 FFQ: strengths 1. Convenient for large population studies, selfadministered 2. Easy for participants to complete 3. Provides long-term dietary intake data 4. Provides data on foods directly 5. Provide better information on nutrients with large within-person variation than other methods

23 FFQ: limitations 1. Total energy intakes may be not correctly estimated, affected by list of foods 2. Culture-specific 3. Errors are not random- likely biased by current intake

24 Comparing dietary assessment instruments

25 Up and coming technology in diet assessment

26 Analysis of nutrition data Nutrients Dietary patterns Foods/ beverages

27 Analysis of nutrients Ley SH, et al. Lancet. 2014

28 Analysis of foods and beverages Ley SH, et al. Lancet. 2014

29 Curr Opin Lipidol. 2002

30 Ley SH, et al. Lancet. 2014

31 Healthy Eating Index. The Healthy Eating Index (HEI) is a measure of diet quality that assesses conformance to the Dietary Guidelines for Americans. USDA's primary use of the HEI is to monitor the diet quality of the U.S. population and the low-income subpopulation.

32 High component scores indicate intakes close to the recommended ranges or amounts; low component scores indicate less compliance with the recommended ranges or amounts

33 Schwingshackl L, J Acad Nutr Diet. 2015

34 Change-change analysis

35 Etiological findings from epidemiological studies usually use just one exposure measure Dietary intakes change over time, at different age Dietary intakes are affected by disease conditions, such obesity

36 2011 NHS, n=121,701 HPFS, n=51,529 NHS 2, n=116,686

37

38

39 Diet/lifestyle Body weight

40

41 Temporal change of SSB consumption NEJM. 2009

42 Nature 2012

43 Sugar sweetened beverage (SSB) as the #1 source for diet added sugar NHANES,

44 Epidemiology evidence Weight gain Obesity

45

46 Decrease intake of less healthful foods containing high amounts of fat and/or sugar High calcium and protein contents of yogurt influence appetite and energy intake Yogurt increases the circulating concentration of the anorectic peptides glucagon-like peptide (GLP)-1 and peptide YY (PYY)

47 Certain yogurts contain probiotics that are good bacterial strains that may affect gut microbiota and benefit a person's health

48 Gene-diet interactions

49

50 26,000 big mac!

51 Temporal change of obesity in the US 60% remains not obese! 30% remains lean!

52 Foods Health

53 Genetics loads the gun and environment pulls the trigger. Dr. Francis Collins

54 Genetic effect on obesity Nat. Genet genetic loci identified

55 Linked to food intake and energy expenditure

56 March 18, 2014

57 Why fried foods

58 Prospective cohort study of 9850 men and women, followed for 6 ys Average yearly change in body weight, and incidence of overweight/obesity

59 Foods become crunchy, aromatic, palatable, and rich in fat and calories after frying Chicken 1 leg or ~4 ounce Roasted Calories 181 Fried Calories 284 Potato ~3 ounce Baked Calories 170 Fried Calories 271

60 DietGen Consortium NHS: Nurses Health Study; 121,700 women; followed from women with GWAS HPFS: Health Professionals Follow-up Study; 51,529 men; followed from men with GWAS WGHS: Women Genome Health Study; 25,000 women; followed from ,421 women with GWAS

61 Fried food intakes Participants were asked to report their average weekly frequency of fried food consumption at home and away from home with 4 to 5 possible responses (ranging from never to daily). In the current analysis, three categories of frequency of fried food consumption were coded consistently across questionnaires from all cohorts (<1/wk, 1-3/wk, and 4/wk).

62 Genetic susceptibility to obesity NUDT3 ETV5 ZNF608 GIPR FTO FLJ35779 MC4R TFAP2B PRKD1 MTIF3 GRS genetic risk score MTCH2 POMC BDNF GPC5B NRXN3 PCSK1 TMEM160 TMEM18 SH2B1 32 obesity genes 1 point = 1 risk allele FAIM2 LRRN6C GNPDA2 MAP2K5 RPL27A

63

64 Genetic risk score and BMI by fried food consumption

65 Individual SNP-fried food consumption interactions FTO SEC16B NEGR1 GNPDA2 MC4R

66 Omics and novel risk factors

67 Traditional risk factors

68 Omics and novel risk factors

69 Metabolomics

70 2011 The Framingham Offspring Study Amino acids The Malmö Diet and Cancer study Liquid chromatography-tandem mass spectrometry (LC-MS) 48 metabolites

71 Predict T2D during 12 years of follow-up Aromatic amino acids (AAA) phenylalanine, tyrosine, and tryptophan Associated with insulin resistance

72 Amino acids, old nutrients In 1806, French chemists Louis Nicolas Vauquelin and Pierre Jean Robiquet isolated a compound in asparagus that was subsequently named asparagine About 500 amino acids are known 22 proteinogenic ("protein-building") AA Nine of the 22 standard amino acids are called essential for humans

73

74 1969

75 Branched chain amino acids (BCAAs) BCAAs are among the nine essential amino acids for humans, accounting for 35% of the essential amino acids in muscle proteins Many foods, eg. Egg, turkey Pork, wheat germ, milk Cheese, nuts, wheat germ

76 Diabetes

77 Study design

78 Study design Exposure: dietary BCAA intakes Outcome: incident T2D Statistical model: Cox proportional hazards models Covariates: demographic factors, lifestyle factors, family history of diabetes, baseline disease status, total energy intake, and diabetes diet score Exclusion criteria: baseline CVD, cancer or diabetes patients, implausible energy intake, missing dietary intake information

79 Results Table 1. Baseline age-adjusted characteristics of participants in the NHS (1980), NHS II (1991) and HPFS (1986) Characteristics NHS (N=66125) NHS II (N=86630) HPFS (N=39017) Q1 Q3 Q5 Q1 Q3 Q5 Q1 Q3 Q5 N Age, years BMI, kg/m Physical activity, METs/wk Current smoking, % Alcohol intake, g/d Postmenopausal, % Zheng Y, Qi L. Int J Epidemiology 2016

80 Associations between Dietary Intakes and Plasma Levels of Total BCAA P for correlation <0.03 Zheng Y, Qi L. Int J Epidemiology 2016

81 Relative Risk, 95% CI Diet BCAAs and type 2 diabetes in the NHS Q1 Q2 Q3 Q4 Q5 Leucine Zheng Y, Qi L. Int J Epidemiology 2016

82 Relative Risk, 95% CI Diet BCAAs and type 2 diabetes in the HPFS Q1 Q2 Q3 Q4 Q5 Leucine Zheng Y, Qi L. Int J Epidemiology 2016

83 Relative Risk, 95% CI Diet BCAAs and type 2 diabetes in the NHS, NHS 2 and HPFS Q1 Q2 Q3 Q4 Q5 BCAAs (Leucine + isoleucine + valine) Zheng Y, Qi L. Int J Epidemiology 2016

84 Diabetes

85 The Pounds Lost Trial The Preventing Overweight Using Novel Dietary Strategies trial A 2-year intervention 811 overweight or obese adults Four diets varying in macronutrients Sacks et al, NEJM, 2009

86 Diet intervention groups Low fat Low protein Diet Group Fat (%) Protein (%) Carbohydrate (%) High fat High protein

87 Metabolomic measurement of amino acids Baseline 6 months 24 months

88 Correlation heat map for changes of amino acids in POUNDS LOST 6 months 2 years Zheng Y, Qi L. AJCN 2016

89 Tyr Ala Pro Leu/Ile Val Gly OH-Prol Phe Glu Aba Sarc Met Arg PiPA Ser MeHis Trp Lys Tau Cit Orn His Asp Gln Thr -log10(p) Weight loss diets on changes in amino acids in POUNDS LOST AAA β Level1 coeff BCAA 2.5 Significant threshold p= Zheng Y, Qi L. AJCN 2016

90 The DIRECT trial The Dietary Intervention Randomized Control Trial A 2-year Intervention trial 322 overweight or obese subjects Three diets: Low-fat (high carbohydrate) Low-carbohydrate (high fat) Mediterranean Shai et al, NEJM, 2008 (Ben-Gurion University of the Negev, Israel)

91 Comparison of the two trials DIRECT Pounds Lost Participants Overweight or obese Overweight or obese Intervention 2 Years 2 Years Diets Low vs high CHO/fat Low vs high CHO/fat Maximum weight loss 6 months 6 months Weight regain 6 m to 2 y 6 m to 2 y

92 Weight loss diets on changes in amino acids in DIRECT trial AAA BCAA BCAA Zheng Y, Qi L. AJCN 2016

93 Systems Nutritional Epidemiology From genomics to other -omics Epigenome

The Genetic Basis of Obesity

The Genetic Basis of Obesity The Genetic Basis of Obesity Kaitlin Samocha Wikimedia user: GAThrawn22 DNA and Genes cell DNA gene protein AGCTACCGTTATCCAATGCGCGAGCTATTA A C G T Wikimedia users: Mikael Häggström, GAThrawn22, cacycle

More information

Optimizing Protein in a Carbohydrate World

Optimizing Protein in a Carbohydrate World Optimizing Protein in a Carbohydrate World Donald K. Layman, Ph.D. Professor Emeritus Department of Food Science & Human Nutrition University of Illinois at Urbana Champaign The confused consumer 1 Myth:

More information

Amino Acids. Amino Acids. Fundamentals. While their name implies that amino acids are compounds that contain an NH. 3 and CO NH 3

Amino Acids. Amino Acids. Fundamentals. While their name implies that amino acids are compounds that contain an NH. 3 and CO NH 3 Fundamentals While their name implies that amino acids are compounds that contain an 2 group and a 2 group, these groups are actually present as 3 and 2 respectively. They are classified as α, β, γ, etc..

More information

1. Describe the relationship of dietary protein and the health of major body systems.

1. Describe the relationship of dietary protein and the health of major body systems. Food Explorations Lab I: The Building Blocks STUDENT LAB INVESTIGATIONS Name: Lab Overview In this investigation, you will be constructing animal and plant proteins using beads to represent the amino acids.

More information

Branched-chain and aromatic amino acids and T2D in the PREDIMED Study

Branched-chain and aromatic amino acids and T2D in the PREDIMED Study Branched-chain and aromatic amino acids and T2D in the PREDIMED Study Miguel Ruiz-Canela, PharmD, MPH, PhD www.unav.es/preventiva www.predimed.es www.predimedplus.com www.ciberobn.es Outline 1.Introduction

More information

Chapter 02 Choose A Healthy Diet

Chapter 02 Choose A Healthy Diet Chapter 02 Choose A Healthy Diet Multiple Choice Questions 1. The science of food and how the body uses it in health and disease is called: A. the dietary guidelines. B. the food guide pyramid. C. nutrition.

More information

Development of the Eating Choices Index (ECI)

Development of the Eating Choices Index (ECI) Development of the Eating Choices Index (ECI) GK Pot 1, CJ Prynne 1, M Richards 2, AM Stephen 1 1 MRC Human Nutrition Research, Cambridge UK 2 MRC Unit for Lifelong Health and Ageing, London UK Background

More information

Outline. Ø Standard Recommendations. Ø Minimum / Optimal / Maximum CONFUSION? Ø Quality Ø Impact of Shifting from Animal to Plant-Based Proteins

Outline. Ø Standard Recommendations. Ø Minimum / Optimal / Maximum CONFUSION? Ø Quality Ø Impact of Shifting from Animal to Plant-Based Proteins Protein 101 Outline Ø Standard Recommendations Ø Minimum / Optimal / Maximum CONFUSION? Ø Quality Ø Impact of Shifting from Animal to Plant-Based Proteins Dietary Reference Intakes (DRI) Dietary Guidelines

More information

Research Shows Healthy Living is Longer Living

Research Shows Healthy Living is Longer Living December 2018 Research Shows Healthy Living is Longer Living Research shows that living a healthy lifestyle can add a Researchers from the Harvard T.H. Chan School of Public Health conducted a study of

More information

Nutrition. Physical Factors: A. Cut Down on Foods that are High in Fat

Nutrition. Physical Factors: A. Cut Down on Foods that are High in Fat Nutrition All aspects of sports conditioning are important for maximum physical development. Nutrition is one component most programs overlook. The following section will provide information to change

More information

BCH 445 Biochemistry of nutrition Dr. Mohamed Saad Daoud

BCH 445 Biochemistry of nutrition Dr. Mohamed Saad Daoud BCH 445 Biochemistry of nutrition Dr. Mohamed Saad Daoud 1 Energy Needs & Requirements Food is the only source of body which undergoes Metabolism and liberate / Generates Energy required for vital activities

More information

ENDURANCE SPORTS NUTRITION

ENDURANCE SPORTS NUTRITION ENDURANCE SPORTS NUTRITION Complex carbohydrates with low glycemic index Simple carbohydrates with high glycemic index + complex carbs + proteins + electrolytes Simple carbs + complex carbs + proteins

More information

Clinical Update: Popular diets

Clinical Update: Popular diets Clinical Update: Popular diets Scott D. Isaacs, MD, FACP, FACE Adjunct Instructor of Medicine, Emory University School of Medicine Medical Director, Atlanta Endocrine Associates Member, AACE Board of Directors

More information

Page 8/6: The cell. Where to start: Proteins (control a cell) (start/end products)

Page 8/6: The cell. Where to start: Proteins (control a cell) (start/end products) Page 8/6: The cell Where to start: Proteins (control a cell) (start/end products) Page 11/10: Structural hierarchy Proteins Phenotype of organism 3 Dimensional structure Function by interaction THE PROTEIN

More information

SUPPORT STAFF TRAINING TOOLS MAINTAINING HEALTH. THE HEALTHY MENU (Including the MyPlate Information)

SUPPORT STAFF TRAINING TOOLS MAINTAINING HEALTH. THE HEALTHY MENU (Including the MyPlate Information) SUPPORT STAFF TRAINING TOOLS MAINTAINING HEALTH THE HEALTHY MENU (Including the MyPlate Information) Training Program Specialists, LLC 9864 E. Grand River, Suite 110-320 Brighton, Michigan 48116 Phone:

More information

Live the Mediterranean Lifestyle with Barilla. The Mediterranean Nutrition Model

Live the Mediterranean Lifestyle with Barilla. The Mediterranean Nutrition Model Live the Mediterranean Lifestyle with Barilla The Mediterranean Nutrition Model Whole Grains Legumes Live the Mediterranean Lifestyle with Barilla Table of Contents: MEDITERRANEAN NUTRITION MODEL Health

More information

CIA-Harvard Menus of Change National Leadership Summit. Protein 101

CIA-Harvard Menus of Change National Leadership Summit. Protein 101 CIA-Harvard Menus of Change National Leadership Summit June 10, 2014 Cambridge, MA General Session III Protein 101 Christopher Gardner, PhD, Professor of Medicine, Stanford Prevention Research Center,

More information

Dr. Claude Bouchard. John W. Barton, Sr. Chair in Genetics and Nutrition Louisiana State University

Dr. Claude Bouchard. John W. Barton, Sr. Chair in Genetics and Nutrition Louisiana State University Dr. Claude Bouchard John W. Barton, Sr. Chair in Genetics and Nutrition Louisiana State University 2014 SEC Symposium A GENETIC PREDISPOSITION IS AMONG THE DRIVERS OF THE OBESITY EPIDEMIC: IMPLICATIONS

More information

PERFORMANCE FUELING GUIDELINES

PERFORMANCE FUELING GUIDELINES PERFORMANCE FUELING GUIDELINES Although good eating habits cannot substitute for physical training and genetic endowment, proper daily diet, training and game diet, plus appropriate supplemental choices

More information

The omics approach in measuring the double burden of malnutrition

The omics approach in measuring the double burden of malnutrition IAEA Headquarter, Vienna, Austria, 3-5 October 2017 Joint IAEA-WHO-UNICEF workshop on analysis of biological pathways to better understand the double burden of malnutrition and to inform action planning

More information

Exploring the Evidence on Dietary Patterns: The Interplay of What We Eat and Health

Exploring the Evidence on Dietary Patterns: The Interplay of What We Eat and Health NUTRI-BITES Webinar Series Exploring the Evidence on Dietary Patterns: The Interplay of What We Eat and Health January 25, 2018 Presenter: Kellie O. Casavale, PhD, RD Nutrition Advisor, Division of Prevention

More information

Supplementary Online Content

Supplementary Online Content Supplementary Online Content Yang Q, Zhang Z, Gregg EW, Flanders WD, Merritt R, Hu FB. Added sugar intake and cardiovascular diseases mortality among US adults. JAMA Intern Med. Published online February

More information

PERSON TESTED: REFERENCE #: DATE OF BIRTH: REPORT DATE:

PERSON TESTED: REFERENCE #: DATE OF BIRTH: REPORT DATE: HEALTHY WEIGHT PERSON TESTED: Jane Doe REFERENCE #: 123456 DATE OF BIRTH: 3/7/1998 REPORT DATE: 5/25/17 REPORT SUMMARY CATEGORY RATING GENES Weight Loss Ability with Diet and Exercise BELOW AVERAGE FTO,

More information

Reaching Consumers by Focusing on the Positives: It s all Yolkay. Tia M. Rains, PhD Executive Director, Egg Nutrition Center

Reaching Consumers by Focusing on the Positives: It s all Yolkay. Tia M. Rains, PhD Executive Director, Egg Nutrition Center Reaching Consumers by Focusing on the Positives: It s all Yolkay Tia M. Rains, PhD Executive Director, Egg Nutrition Center Americans are changing their definition of nutrition My approach to health is

More information

CS612 - Algorithms in Bioinformatics

CS612 - Algorithms in Bioinformatics Spring 2016 Protein Structure February 7, 2016 Introduction to Protein Structure A protein is a linear chain of organic molecular building blocks called amino acids. Introduction to Protein Structure Amine

More information

21 st November

21 st November 21 st November 2013 Structure What do consumers eat? Prawn nutrition Dietary reference values (HP diets) Appetite control Future research sustainability and health UK Protein intake top 10 (from NDNS survey)

More information

HEALTHY WEIGHT. ADN del Peso Saludable PERSON TESTED: MARTIN BEDOYA BENAVIDES

HEALTHY WEIGHT. ADN del Peso Saludable PERSON TESTED: MARTIN BEDOYA BENAVIDES HEALTHY WEIGHT ADN del Peso Saludable PERSON TESTED: MARTIN BEDOYA BENAVIDES REFERENCE #: 8539094 DATE OF BIRTH: 1/18/1980 REPORT DATE: March 07, 2018 YOUR PERSONALIZED REPORT CONGRATULATIONS! You will

More information

Amino acids-incorporated nanoflowers with an

Amino acids-incorporated nanoflowers with an Amino acids-incorporated nanoflowers with an intrinsic peroxidase-like activity Zhuo-Fu Wu 1,2,+, Zhi Wang 1,+, Ye Zhang 3, Ya-Li Ma 3, Cheng-Yan He 4, Heng Li 1, Lei Chen 1, Qi-Sheng Huo 3, Lei Wang 1,*

More information

Chapter 4: Nutrition. ACE Personal Trainer Manual Third Edition

Chapter 4: Nutrition. ACE Personal Trainer Manual Third Edition Chapter 4: Nutrition ACE Personal Trainer Manual Third Edition Introduction SCAN group of dieticians who practice in sports and cardiovascular nutrition [SCAN]; locate local SCAN dieticians by contacting

More information

The Science of Protein. The Continued Exploration of the Impact of High-Quality Protein on Optimal Health

The Science of Protein. The Continued Exploration of the Impact of High-Quality Protein on Optimal Health The Science of Protein The Continued Exploration of the Impact of High-Quality Protein on Optimal Health 1 The Following Will Be Discussed 1. What is Protein? 2. Evolution of Protein Research 3. Protein

More information

8/27/2012. Mississippi s Big Problem. An Epidemic Now Reaching Our Children. What Can We Do?

8/27/2012. Mississippi s Big Problem. An Epidemic Now Reaching Our Children. What Can We Do? Mississippi s Big Problem. An Epidemic Now Reaching Our Children What Can We Do? Richard D. deshazo, MD Billy S. Guyton Distinguished Professor Professor of Medicine & Pediatrics University of Mississippi

More information

Protein and Amino Acid Analysis. Chemistry M3LC

Protein and Amino Acid Analysis. Chemistry M3LC Protein and Amino Acid Analysis Chemistry M3LC Proteins Proteins are made up of amino acids: H2N-CHR-COOH + H3N-CHR-COO - neutral form zwitterionic form There are twenty standard amino acids: A ala alanine

More information

MSUD. Maple Syrup Urine Disease. TEMPLE Tools Enabling Metabolic Parents LEarning. Information for families after a positive newborn screening

MSUD. Maple Syrup Urine Disease. TEMPLE Tools Enabling Metabolic Parents LEarning. Information for families after a positive newborn screening Maple Syrup Urine Disease MSUD Information for families after a positive newborn screening ADAPTED Adapted by BY the THE Dietitians DIETITIANS Group GROUP BIMDG British Inherited Metabolic Diseases Group

More information

The Current and Emerging Knowledge and Research on Non-Nutritive Sweeteners. November 16, 2018 (1-2 PM EST)

The Current and Emerging Knowledge and Research on Non-Nutritive Sweeteners. November 16, 2018 (1-2 PM EST) The Current and Emerging Knowledge and Research on Non-Nutritive Sweeteners November 16, 2018 (1-2 PM EST) Agenda 1:00 PM Welcome and Introduction Andrew Zajac, U.S. Food and Drug Administration 1:05 PM

More information

BASIC NUTRITION NUTRITION /17/2017. Agenda

BASIC NUTRITION NUTRITION /17/2017. Agenda BASIC NUTRITION Haley Quade, M A, RD, CD Tarrah M ccreary, M S, RD, SNS Agenda Gain a basic understanding of general nutrition Become familiar with the Dietary Guidelines for Americans current standards

More information

Chapter 3: Macronutrients. Section 3.1 Pages 52-55

Chapter 3: Macronutrients. Section 3.1 Pages 52-55 Chapter 3: Macronutrients Section 3.1 Pages 52-55 Diet Terms Nutrients The substances in food that gives us structural materials and energy. Macronutrients Nutrients that are required in large amounts.

More information

PERSON TESTED: REFERENCE #: DATE OF BIRTH: REPORT DATE:

PERSON TESTED: REFERENCE #: DATE OF BIRTH: REPORT DATE: HEALTHY WEIGHT PERSON TESTED: Jacky Dave REFERENCE #: 123256 DATE OF BIRTH: 05/07/1988 REPORT DATE: 12/25/2017 YOUR PERSONALIZED REPORT CONGRATULATIONS! You will receive insights about your body that have

More information

The real cost of obesity: Disparities in diet quality and health

The real cost of obesity: Disparities in diet quality and health The real cost of obesity: Disparities in diet quality and health Adam Drewnowski, PhD Director, Center for Public Health Nutrition Director, NIH Roadmap Center for Obesity Research Professor of Epidemiology

More information

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000).

Proteins are sometimes only produced in one cell type or cell compartment (brain has 15,000 expressed proteins, gut has 2,000). Lecture 2: Principles of Protein Structure: Amino Acids Why study proteins? Proteins underpin every aspect of biological activity and therefore are targets for drug design and medicinal therapy, and in

More information

3 Day Diet Analysis for Nutrition 219

3 Day Diet Analysis for Nutrition 219 Name 3 Day Diet Analysis for Nutrition 219 Keep a record of everything you eat and drink for 3 days. Be specific. Was it white or wheat bread, 1% or 2% milk, 1 cup or 1½ cups, did you fry it in oil or

More information

WEEK 1 GOAL SETTING & NUTRITION 101. with your Supermarket Registered Dietitian

WEEK 1 GOAL SETTING & NUTRITION 101. with your Supermarket Registered Dietitian WEEK 1 GOAL SETTING & NUTRITION 101 with your Supermarket Registered Dietitian Welcome to Week 1! We are excited you have decided to join us on this wellness journey! Please note that you should consult

More information

National Pecan Shellers Association Annual Meeting Amelia Island, FL - February 7, 2013 Tufts Pecan Research: An Overview

National Pecan Shellers Association Annual Meeting Amelia Island, FL - February 7, 2013 Tufts Pecan Research: An Overview National Pecan Shellers Association Annual Meeting Amelia Island, FL - February 7, 2013 Tufts Pecan Research: An Overview Diane L. McKay, PhD, FACN Jean Mayer USDA Human Nutrition Research Center on Aging

More information

Objectives. Define satiety and satiation Summarize the satiety cascade Describe potential dietary interventions aimed at improving satiety

Objectives. Define satiety and satiation Summarize the satiety cascade Describe potential dietary interventions aimed at improving satiety Foods that Fill Monica Esquivel PhD RDN Assistant Professor, Dietetics Program Director Department of Human Nutrition, Food and Animal Sciences November 8, 2017 Objectives Define satiety and satiation

More information

The Meaning of Essential. Building Blocks of Your Wellness

The Meaning of Essential. Building Blocks of Your Wellness The Meaning of Essential Building Blocks of Your Wellness The Age Of Convenience According to nutrition experts, the average Western diet contains too much sugar and too little fiber. 2 The combination

More information

Objective: You will be able to explain how the subcomponents of

Objective: You will be able to explain how the subcomponents of Objective: You will be able to explain how the subcomponents of nucleic acids determine the properties of that polymer. Do Now: Read the first two paragraphs from enduring understanding 4.A Essential knowledge:

More information

LAB#23: Biochemical Evidence of Evolution Name: Period Date :

LAB#23: Biochemical Evidence of Evolution Name: Period Date : LAB#23: Biochemical Evidence of Name: Period Date : Laboratory Experience #23 Bridge Worth 80 Lab Minutes If two organisms have similar portions of DNA (genes), these organisms will probably make similar

More information

Global Burden of Disease Attributable to Sugar Sweetened Beverages

Global Burden of Disease Attributable to Sugar Sweetened Beverages Global Burden of Disease Attributable to Sugar Sweetened Beverages Dariush Mozaffarian, MD DrPH Dean, Friedman School of Nutrition Science & Policy Press Conference Mexico City, Mexico November 11, 2014

More information

Laura Hernandez, MBA RD LD Registered Dietitian KC Bariatric Shawnee, KS

Laura Hernandez, MBA RD LD Registered Dietitian KC Bariatric Shawnee, KS Laura Hernandez, MBA RD LD Registered Dietitian KC Bariatric Shawnee, KS Protein: What Is It? The word protein is derived from the Greek word prōteios which means primary or of prime importance. Proteins

More information

NUTRITION for the ATHLETE

NUTRITION for the ATHLETE NUTRITION for the ATHLETE Quick Facts... Athletes achieve peak performance by training and eating a variety of foods. They gain most from the amount of carbohydrates stored in the body. That s why it s

More information

Chewing the fat about fat!

Chewing the fat about fat! Chewing the fat about fat! When we talk about fat, most people think of fatty foods, like fries and fatty meats. But fat is an essential nutrient. It plays an important role in the many functions that

More information

Instructions for 3 Day Diet Analysis for Nutrition 219

Instructions for 3 Day Diet Analysis for Nutrition 219 Name Instructions for 3 Day Diet Analysis for Nutrition 219 1. Keep a record of everything you eat and drink for 3 days. Be specific. Was it white or wheat bread, 1% or 2% milk, 1 cup or 1½ cups, did you

More information

Leveraging Prospective Cohort Studies to Advance Colorectal Cancer Prevention, Treatment and Biology

Leveraging Prospective Cohort Studies to Advance Colorectal Cancer Prevention, Treatment and Biology Leveraging Prospective Cohort Studies to Advance Colorectal Cancer Prevention, Treatment and Biology Charles S. Fuchs, MD, MPH Director, Yale Cancer Center Physician-in-Chief, Smilow Cancer Hospital New

More information

Youth4Health Project. Student Food Knowledge Survey

Youth4Health Project. Student Food Knowledge Survey Youth4Health Project Student Food Knowledge Survey Student ID Date Instructions: Please mark your response. 1. Are you a boy or girl? Boy Girl 2. What is your race? Caucasian (White) African American Hispanic

More information

Classification of amino acids: -

Classification of amino acids: - Page 1 of 8 P roteinogenic amino acids, also known as standard, normal or primary amino acids are 20 amino acids that are incorporated in proteins and that are coded in the standard genetic code (subunit

More information

EATING AND EXERCISE. goals, whether they are physical fitness, weight loss, or hormonal/fertility improvement.

EATING AND EXERCISE. goals, whether they are physical fitness, weight loss, or hormonal/fertility improvement. EATING AND EXERCISE Eating a healthy diet and obtaining regular exercise can be a big part of helping you achieve your goals, whether they are physical fitness, weight loss, or hormonal/fertility improvement.

More information

What about Wheat? 7/26/2016. Eating Beyond the Headlines: Sorting Evidence from Emotion

What about Wheat? 7/26/2016. Eating Beyond the Headlines: Sorting Evidence from Emotion Eating Beyond the Headlines: Sorting Evidence from Emotion Neva Cochran, MS, RDN, LD, FAND Texas A&M AgriLife Extension Master Wellness Volunteer Conference July 21, 2016 What about Wheat? Only 1% of the

More information

1) What are the potential consequences for individuals who do not consume enough protein?

1) What are the potential consequences for individuals who do not consume enough protein? Exam Name 1) What are the potential consequences for individuals who do not consume enough protein? 2) To accurately assess the information on a website, its funding source should always be identified.

More information

Building Our Evidence Base

Building Our Evidence Base Plant-Based Diets Neal D. Barnard, MD, FACC Adjunct Associate Professor of Medicine George Washington University School of Medicine Physicians Committee for Responsible Medicine Washington, DC Building

More information

Properties of amino acids in proteins

Properties of amino acids in proteins Properties of amino acids in proteins one of the primary roles of DNA (but far from the only one!!!) is to code for proteins A typical bacterium builds thousands types of proteins, all from ~20 amino acids

More information

Beverage Guidelines: 1 up to 3 Years

Beverage Guidelines: 1 up to 3 Years Beverage Guidelines: nutritionally-equivalent nondairy beverages like soy, rice, or lactose-free milks with medical permission). nutritionally-equivalent nondairy beverages like soy, rice, or lactose-free

More information

The Food Guide Pyramid

The Food Guide Pyramid The Food Guide Pyramid In this lesson, you will Learn About n What influences a person s food choices. n How to use the Food Guide Pyramid to make healthful food choices. The Foods You Choose The foods

More information

Personal Touch Food Service will ensure all consumers have access to varied and nutritious foods consistent with promoting health and wellness.

Personal Touch Food Service will ensure all consumers have access to varied and nutritious foods consistent with promoting health and wellness. Nutrition Guidelines It is well accepted that consumer eating habits are greatly influenced by the types and quantities of foods made available to them. Personal Touch Food Service is committed to supporting

More information

Weighing in on Whole Grains: A review of Evidence Linking Whole Grains to Body Weight. Nicola M. McKeown, PhD Scientist II

Weighing in on Whole Grains: A review of Evidence Linking Whole Grains to Body Weight. Nicola M. McKeown, PhD Scientist II Weighing in on Whole Grains: A review of Evidence Linking Whole Grains to Body Weight Nicola M. McKeown, PhD Scientist II Weighing in on Whole Grains: A review of Evidence Linking Whole Grains to Body

More information

For questions 1-4, match the carbohydrate with its size/functional group name:

For questions 1-4, match the carbohydrate with its size/functional group name: Chemistry 11 Fall 2013 Examination #5 PRACTICE 1 For the first portion of this exam, select the best answer choice for the questions below and mark the answers on your scantron. Then answer the free response

More information

CHOOSE HEALTH: FOOD, FUN, AND FITNESS. Read the Label!

CHOOSE HEALTH: FOOD, FUN, AND FITNESS. Read the Label! POSTER 1-1: REPLACE SWEETENED DRINKS Read the Label! Nutrition Facts 20 oz. cola Serving Size: 1 bottle (591mL) Servings Per Container: 1 Amount Per Serving Calories 240 Calories from Fat 0 % Daily Value

More information

The eatwell plate is based on the Government s Eight Guidelines for a Healthy Diet, which are:

The eatwell plate is based on the Government s Eight Guidelines for a Healthy Diet, which are: The eatwell plate The eatwell plate is a pictorial food guide showing the proportion and types of foods that are needed to make up a healthy balanced diet. The plate has been produced by the Food Standards

More information

By the end of the lesson students will be able to: Healthy Living Unit #1 Healthy Eating. Canada s Food Guide. Healthier Food Choices Are...

By the end of the lesson students will be able to: Healthy Living Unit #1 Healthy Eating. Canada s Food Guide. Healthier Food Choices Are... Healthy Living Unit #1 Healthy Eating Lesson #1 Making Healthier Food Choices Healthier Food Choices Are... follow Eating Well with, By the end of the lesson students will be able to: Apply health knowledge

More information

9/6/2011. Amino Acids. C α. Nonpolar, aliphatic R groups

9/6/2011. Amino Acids. C α. Nonpolar, aliphatic R groups Amino Acids Side chains (R groups) vary in: size shape charge hydrogen-bonding capacity hydrophobic character chemical reactivity C α Nonpolar, aliphatic R groups Glycine (Gly, G) Alanine (Ala, A) Valine

More information

Nutrition Basics. Health, Wellness & Fitness. Brenda Brown

Nutrition Basics. Health, Wellness & Fitness. Brenda Brown Nutrition Basics Health, Wellness & Fitness Brenda Brown bbrown9@asu.edu Why do we eat? Building blocks to fuel our bodies Hunger Don t want to starve Socialization Emotional eating or not eating when

More information

Chemistry 121 Winter 17

Chemistry 121 Winter 17 Chemistry 121 Winter 17 Introduction to Organic Chemistry and Biochemistry Instructor Dr. Upali Siriwardane (Ph.D. Ohio State) E-mail: upali@latech.edu Office: 311 Carson Taylor Hall ; Phone: 318-257-4941;

More information

To help make sense of some of the different dietary approaches out there, the Ministry has reviewed eight popular diets.

To help make sense of some of the different dietary approaches out there, the Ministry has reviewed eight popular diets. Popular diets review The Ministry of Health recommends a nutritionally balanced eating pattern consistent with the Eating and Activity Guidelines for New Zealand Adults for good health. For people wanting

More information

CHAPTER 21: Amino Acids, Proteins, & Enzymes. General, Organic, & Biological Chemistry Janice Gorzynski Smith

CHAPTER 21: Amino Acids, Proteins, & Enzymes. General, Organic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 21: Amino Acids, Proteins, & Enzymes General, Organic, & Biological Chemistry Janice Gorzynski Smith CHAPTER 21: Amino Acids, Proteins, Enzymes Learning Objectives: q The 20 common, naturally occurring

More information

No conflicts of interest or disclosures

No conflicts of interest or disclosures Egg and Dairy Consumption: Impact on CVD Risk No conflicts of interest or disclosures Vasanti Malik, ScD Research Scientist Department of Nutrition Harvard School of Public Health Cardiovascular Disease

More information

MILK. Nutritious by nature. The science behind the health and nutritional impact of milk and dairy foods

MILK. Nutritious by nature. The science behind the health and nutritional impact of milk and dairy foods MILK Nutritious by nature The science behind the health and nutritional impact of milk and dairy foods Weight control Contrary to the popular perception that dairy foods are fattening, a growing body of

More information

Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A

Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Biological systems interact, and these systems and their interactions possess complex properties. STOP at enduring understanding 4A Homework Watch the Bozeman video called, Biological Molecules Objective:

More information

HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis

HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis HOW TO DEFINE GOOD BIOMARKERS OF HEALTH? Suzan Wopereis My personal objective: identification of biomarkers of (optimal) health Biomarker Definition: a characteristic that is objectively measured and evaluated

More information

NUTRITION FOR TENNIS PLAYERS

NUTRITION FOR TENNIS PLAYERS NUTRITION FOR TENNIS PLAYERS Getting your diet right as a tennis player can be a tricky balancing act. Not only do you have to fuel yourself for a match that could last for an hour to three (or more!),

More information

Food. Food Groups & Nutrients

Food. Food Groups & Nutrients Food Food Groups & Nutrients Grains Group Grains Group Defined: Foods made from wheat, rice, oats, barley, etc. Grains Group Defined: Foods made from wheat, rice, oats, barley, etc. Examples: bread,

More information

WHY DO WE NEED FOOD? FOOD AND DIET

WHY DO WE NEED FOOD? FOOD AND DIET WHY DO WE NEED FOOD? FOOD AND DIET Food gives us the energy required for chemical reaction to keep us alive Energy also required for many activities and to maintain body temperature Food also gives us

More information

Biomolecules: amino acids

Biomolecules: amino acids Biomolecules: amino acids Amino acids Amino acids are the building blocks of proteins They are also part of hormones, neurotransmitters and metabolic intermediates There are 20 different amino acids in

More information

ABLE TO READ THE LABEL?

ABLE TO READ THE LABEL? ARE ABLE TO READ THE LABEL? A Consumer s Guide to Navigating Food Labels Food and Drug Safety Program Consumer and Environmental Health Services Phone: 609-826-4935 Fax: 609-826-4990 http://nj.gov/health/eoh/foodweb/

More information

Mediterranean Diet. The word Mediterranean refers to the origins of the diet, rather than to specific foods such as Greek or Italian foods.

Mediterranean Diet. The word Mediterranean refers to the origins of the diet, rather than to specific foods such as Greek or Italian foods. Mediterranean Diet http://patient.info/health/mediterranean-diet The Mediterranean Diet is rich in vegetables, fruit, peas and beans (legumes) and grains. It also contains moderate amounts of chicken and

More information

Lecture 4 Nutrition Part 2 Nutrition 1. Healthy Diet 2. Sugar 3. Consumer Concerns

Lecture 4 Nutrition Part 2 Nutrition 1. Healthy Diet 2. Sugar 3. Consumer Concerns Lecture 4 Nutrition Part 2 1 Nutrition 1. Healthy Diet 2. Sugar 3. Consumer Concerns 2 1 Healthy Diet! 3 Four basic behaviors that constitute a "healthy lifestyle" 1. A good diet, 2. Moderate Exercise,

More information

Meal Menu Approximate Amount Eaten

Meal Menu Approximate Amount Eaten Meal Menu Approximate Amount Eaten Myself 16 Year Old Active Male Teen 3 Year Old Female Child ¼ cup 1 slice 70 Year Old Female Breakfast Special K Cereal(red berries) 1 cup 1 Banana (slices) ¼ cup ¾ cup

More information

Sports Nutrition for Volleyball Athletes

Sports Nutrition for Volleyball Athletes Sports Nutrition for Volleyball Athletes Kaylee Jacks, MS, RD, LD Sports Dietitian Ben Hogan Sports Medicine KayleeJacks@TexasHealth.org 214.345.5034 Benefits of Proper Fueling & Nutrition Enhances overall

More information

Contents: Pre-Game Meals / Snacks Pre-Game Meal and Other Considerations Other Resources or Links

Contents: Pre-Game Meals / Snacks Pre-Game Meal and Other Considerations Other Resources or Links Contents: Pre-Game Meals / Snacks Pre-Game Meal and Other Considerations Other Resources or Links Pre-Game Meals / Snacks; Before a Competition: During a Competition The GOAL: An empty stomach and gastrointestinal

More information

The Great Dairy Debate. Is dairy healthy for you or not? It isn t black and white

The Great Dairy Debate. Is dairy healthy for you or not? It isn t black and white The Great Dairy Debate Is dairy healthy for you or not? It isn t black and white Dairy (sticky note affinity analysis) Benefits Concerns Learning Objectives Identify nutrients found in different dairy

More information

Healthy Aging: Approaches to Reduce Chronic Disease Risk

Healthy Aging: Approaches to Reduce Chronic Disease Risk Healthy Aging: Approaches to Reduce Chronic Disease Risk Alice H. Lichtenstein, D.Sc. Gershoff Professor of Nutrition Science and Policy Tufts University Overview Chronic disease risk in older adults Societal

More information

Lecture 4 Nutrition, Part 2 Nutrition 1. What is a Healthy Diet? 2. Food Labels 3. Sugar 4. Consumer Concerns

Lecture 4 Nutrition, Part 2 Nutrition 1. What is a Healthy Diet? 2. Food Labels 3. Sugar 4. Consumer Concerns Lecture 4 Nutrition, Part 2 1 Nutrition 1. What is a Healthy Diet? 2. Food Labels 3. Sugar 4. Consumer Concerns 2 1 Healthy Diet? 3 Four basic behaviors that constitute a "healthy lifestyle" 1. A good

More information

Towards a New Paradigm in Scientific Notation Patterns of Periodicity among Proteinogenic Amino Acids [Abridged Version]

Towards a New Paradigm in Scientific Notation Patterns of Periodicity among Proteinogenic Amino Acids [Abridged Version] Earth/matriX: SCIENCE TODAY Towards a New Paradigm in Scientific Notation Patterns of Periodicity among Proteinogenic Amino Acids [Abridged Version] By Charles William Johnson Earth/matriX Editions P.O.

More information

NAME/ID: SAMPLE PATIENT SEX: FEMALE ACC #: F DATE: NOV 12, 2015 IMPORTANT INFORMATION

NAME/ID: SAMPLE PATIENT SEX: FEMALE ACC #: F DATE: NOV 12, 2015 IMPORTANT INFORMATION Personal Details Name: SAMPLE PATIENT DOB: Jan 1, 19XX Gender: Female Ethnicity: Caucasian Report Date: Nov 12, 2015 Received Date: Nov 2, 2015 IMPORTANT INFORMATION PAGE 3 Test Performed / Method Genotyping

More information

Nutrition Tips to Manage Your Diabetes

Nutrition Tips to Manage Your Diabetes PATIENT EDUCATION patienteducation.osumc.edu As part of your diabetes treatment plan, it is important to eat healthy, stay active and maintain a healthy body weight. This can help keep your blood sugar

More information

Supplementary Table 1. Association of rs with risk of obesity among participants in NHS and HPFS

Supplementary Table 1. Association of rs with risk of obesity among participants in NHS and HPFS Supplementary Table 1. Association of rs3826795 with risk of obesity among participants in NHS and HPFS Case/control NHS (1990) HPFS (1996) OR (95% CI) P- value Case/control OR (95% CI) P- value Obesity

More information

Some important concepts. 1. glucose requirement is < 130 g/d

Some important concepts. 1. glucose requirement is < 130 g/d A Protein-rich rich Diet as a Cornerstone of a Healthy Lifestyle Donald K. Layman, Ph.D. Professor of Nutrition Dept. Food Science & Human Nutrition University of Illinois at Urbana-Champaign Outline:

More information

HEALTHY EATING. What you need to know for a long and healthy life. March National Nutrition Month

HEALTHY EATING. What you need to know for a long and healthy life. March National Nutrition Month HEALTHY EATING What you need to know for a long and healthy life March National Nutrition Month 890246 This presentation is for informational purposes only. Material within this presentation should not

More information

CHM333 LECTURE 6: 1/25/12 SPRING 2012 Professor Christine Hrycyna AMINO ACIDS II: CLASSIFICATION AND CHEMICAL CHARACTERISTICS OF EACH AMINO ACID:

CHM333 LECTURE 6: 1/25/12 SPRING 2012 Professor Christine Hrycyna AMINO ACIDS II: CLASSIFICATION AND CHEMICAL CHARACTERISTICS OF EACH AMINO ACID: AMINO ACIDS II: CLASSIFICATION AND CHEMICAL CHARACTERISTICS OF EACH AMINO ACID: - The R group side chains on amino acids are VERY important. o Determine the properties of the amino acid itself o Determine

More information

Whole Grains: Dietary Recommendations, Intake Patterns, and Promotion

Whole Grains: Dietary Recommendations, Intake Patterns, and Promotion Just Ask for Whole Grains Conference Kansas City, Missouri November 5, 2007 Whole Grains: Dietary Recommendations, Intake Patterns, and Promotion Dr. Robert C. Post, Deputy Director Center for Nutrition

More information

Following Dietary Guidelines

Following Dietary Guidelines LESSON 26 Following Dietary Guidelines Before You Read List some things you know and would like to know about recommended diet choices. What You ll Learn the different food groups in MyPyramid the Dietary

More information

Women s Wellness Day 2017

Women s Wellness Day 2017 Women s Wellness Day 2017 Precision Medicine The Latest Tests for Detecting Wellness Michael Palladino, ND Rowena Daly, ND Travis Nesbit, MD Ailin Barseghian El-Farra, MD Functional Diagnostics for the

More information

Heritability and genetic correlations explained by common SNPs for MetS traits. Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK

Heritability and genetic correlations explained by common SNPs for MetS traits. Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK Heritability and genetic correlations explained by common SNPs for MetS traits Shashaank Vattikuti, Juen Guo and Carson Chow LBM/NIDDK The Genomewide Association Study. Manolio TA. N Engl J Med 2010;363:166-176.

More information