been disclosed. Mammalian ANPs so far identified are 28-resi-

Transcription

1 Moleular loning of Hamster Brain and Atrial Natriureti Peptide DNAs ardiomyopathi Hamsters are Useful Models for Brain and Atrial Natriureti Peptides Naohisa Tamura, * Yoshihiro Ogawa, * Hiroshi Itoh, * Hiroshi Arai, * Shin-ihi Suga, * Osamu Nakagawa, * Yasato Komatsu, * Ihiro Kishimoto,* Kauhiko Takaya,* Takaaki Yoshimasa,* Shoo Shiono, and Kauwa Nakao* *Seond Division, Department of Mediine, Kyoto University Faulty of Mediine, Kyoto 66, Japan; and Shionogi Researh Laboratories, Shionogi & o. Ltd., Osaka 553, Japan Abstrat Brain and atrial natriureti peptides (BNP and ANP) are ardia hormones with diureti, natriureti, and vasodilatory ativities. ardiomyopathi hamsters are widely used animal models of heart failure. Due to the strutural divergene of BNP among speies, examination on pathophysiologial roles of BNP using ardiomyopathi hamsters is so far impossible. We therefore isolated hamster BNP and ANP DNAs, and investigated synthesis and seretion of these peptides in normal and ardiomyopathi hamsters. The OOH-terminal 32-residue peptide of loned hamster preprobnp with 122 amino aids, preeded by a single arginine residue, supposedly represents hamster BNP showing < 5% homology to rat BNP. Alpha-hamster ANP, 28-residue peptide, is idential to a-rat ANP. In hamsters, BNP and ANP our mainly in the ventrile and the atrium, respetively. The 32-wk-old hypertrophi ardiomyopathi B114.6 strain exhibited ventriular hypertrophy. The 32- wk-old dilated ardiomyopathi B strain remained at the stage without apparent heart failure. In B114.6 and B strains at this age, ventriular BNP and ANP gene expressions are augmented, and the plasma BNP onentration is elevated to 136 and 18 fmol/ml, respetively, three times greater than the elevated plasma ANP onentration, whih well mimis hanges of the plasma BNP and ANP onentrations in human heart failure. ardiomyopathi hamsters, therefore, are useful models to investigate the impliation of BNP in human ardiovasular diseases. (J. lin. Invest : ) Key words: ardia hypertrophy ongestive heart failure * gene expression * radioimmunoassay * tissue - distribution Address orrespondene to Kauwa Nakao, Seond Division, Department of Mediine, Kyoto University Faulty of Mediine, 54 Shogoin Kawahara-ho, Sakyo-ku, Kyoto 66, Japan. Reeived for publiation 6 Deember 1993 and in revised form 4 May Abbreviations used in this paper: AMI, aute myoardial infartion; ANP, atrial natriureti peptide; BNP, brain natriureti peptide; HF, ongestive heart failure; NP, -type natriureti peptide; DOA, deoxyortiosterone aetate; HOM, hypertrophi obstrutive ardiomyopathy; HP-GP, high-performane gel permeation hromatography; LI, like immunoreativity; SHR, spontaneously hypertensive rats. J. lin. Invest. The Amerian Soiety for linial Investigation, In /94/9/159/1 $2. Volume 94, September 1994, Introdution Sine the disovery of atrial natriureti peptide (ANP)' in the heart (1), it has been demonstrated that ANP is synthesied in and sereted from the heart, impliated in body fluid homeostasis and blood pressure ontrol as a ardia hormone (2). In normal hearts, ANP is produed mainly in the atrium and only slightly ours in the ventrile, whereas in patients with ongestive heart failure (HF) and animal models of ventriular hypertrophy, ANP synthesis and seretion are greatly augmented in the ventrile (3-6). Brain natriureti peptide (BNP), a seond natriureti peptide, was originally isolated from the porine brain (7). This peptide shows a sequene homology to ANP (7) and has peripheral and entral ations similar to those of ANP (8, 9). We previously demonstrated that BNP is present at the highest onentration in the heart rather than in the brain, and also that BNP is synthesied in and sereted from the heart and ats as a ardia hormone (1, 11). Furthermore, we dislosed that BNP ours mainly in the ventrile, whih ontrasts with ANP, a ardia hormone from the atrium (12, 13). BNP synthesis and seretion are augmented in diseased ventriles (12-19). We previously reported that the plasma BNP onentration (.9 fmol/ml) is only one sixth of the plasma ANP onentration in normal humans, whereas it is elevated several hundredfold (- 3 fmol/ml) and exeeds the plasma ANP onentration ( 2 fmol/ml) in patients with severe HF (12). In addition, in the early phase of aute myoardial infartion (AMI), the plasma BNP onentration is rapidly and prominently inreased, while the plasma ANP onentration is slightly altered (2). These findings suggest that BNP has pathophysiologial roles distint from those of ANP. The pathophysiologial impliation of BNP has so far been studied using spontaneously hypertensive rats (SHR), deoxyortiosterone aetate (DOA)-salt rats, and experimental AMI rats (13, 15).2 In these experimental rat models, however, the plasma BNP onentration remains muh lower than the elevated plasma ANP onentration simultaneously determined, whih is quite different from our observations on human heart diseases ( 12). It is therefore diffiult to assess the signifiane of BNP in human heart diseases using these rat models. In addition, these animals are not suitable models for HF. ardiomyopathi hamsters have been widely used in studies on pathogenesis, therapy, and prevention of heart failure (21-23). Strutures of hamster ANP and BNP, however, have never been dislosed. Mammalian ANPs so far identified are 28-resi- 2. Hama, N., H. Itoh, G. Shirakami,. Nakagawa, S. Suga, Y. Ogawa, T. Yoshimasa, Y. Hashimoto, M. Yamaguhi, R. Hori, and K. Nakao, manusript submitted for publiation. Natriureti Peptides in Hamsters 159

2 due peptides, and their amino aid sequenes are idential exept for a single residue substitution at the 12th position (Ile in rodents, Met in humans) ( 1, 24), whih enabled investigators to detet ANP-like immunoreativities (-LIs) in hamster tissues using the RIA for rat ANP (5, 25). In ardiomyopathi hamsters, it has been demonstrated that ANP synthesis and seretion are augmented in the ventrile and that the plasma ANP-LI onentration is inreased (5, 25). In ontrast, the struture of BNP is divergent among speies. The major irulating forms of BNP are 26, 45, and 32-residue peptides in pigs, rats, and humans (9), respetively. We ould not detet any BNP-LIs in hamster tissues and plasma samples using RIAs for rat and human BNPs (11, 12), suggesting that the struture of hamster BNP is also quite different from those of BNPs of other speies. Therefore, to investigate the pathophysiologial signifiane of BNP using ardiomyopathi hamsters, it is essential to larify the struture of hamster BNP. In this ontext, in the present study, we isolated the fulllength hamster BNP DNA and examined the synthesis and seretion of BNP in normal golden Syrian hamsters. We also isolated the full-length hamster ANP DNA. Then we ompared the synthesis and seretion of both natriureti peptides in hearts of hypertrophi (BI14.6) and dilated (BI53.58) ardiomyopathi hamsters with those in the heart of the ontrol hamster (FIB). The present study indiates that ardiomyopathi hamsters are useful animal models to investigate the pathophysiologial signifiane of BNP and ANP in human ardiovasular diseases. Methods Preparation of hamster BNP-speifi DNA probe. To obtain a hamster BNP-speifi DNA probe, we performed the PR. First strand DNA was generated from ventriular total RNA of golden Syrian hamsters (Mesorietus auratus) by the oligo(dt)-primed reverse transription (26). The PR was arried out under the standard onditions (27). The reation mixture was inubated at 94 for.5 min at first, then it was run through 31 yles of denaturing (.5 min at 94), annealing (.5 min at 6'), and extension (1 min at 72). The reation was finished with a 4-min inubation at 72. The sense and antisense primers were 5 '-TGGTGAGGAGGTATATTTGG-3' and S '-AGAGTGATGAGTGAGAGGAGGT7T-3' (SalI and PstI sites are underlined), orresponding to regions around the signalsequene leavage sites and just 3' to the stop odons of rat, porine, and human BNP DNAs (28-3), respetively. Nuleotide sequenes of these regions are highly onserved in BNP DNAs from these speies (28-3). The PR resulted in a.3-kb hamster BNP DNA fragment (Fig. I A). loning of hamster BNP and ANP DNAs. A hamster heart DNA library was onstruted from 5,g of poly(a) + RNA of golden Syrian hamster hearts. Double-stranded DNA, synthesied by the method of Gubler and Hoffman (26), was loned into the phage vetor XZAPII (Stratagene, La Jolla, A), whih resulted in - 2 x 16 primary reombinants. To isolate the full-length hamster BNP and ANP DNAs, we sreened approximately 4 x 15 plaques eah from the library using the obtained hamster BNP DNA fragment and HinlI-Stul fragment of rat ANP DNA (4) as probes, respetively. Sreening was arried out as previously reported (27). Positive phage lones were exised in vivo as reommended by the supplier, allowing the DNA to be analyed in the pbluesript vetor (Stratagene). DNA sequening. DNA sequening was arried out by the dideoxy hain-termination method (26). The final sequene was determined from both DNA strands. Table L Profiles of ardiomyopathi (BI14.6 and BI53.58) and ontrol (FIB) Hamsters Strains FIB B114.6 B Body wt (g) ±5* 121+5* Vt wt (mg) Vt/BW (xlo-3) * 2.69±.12 All values are expressed as the mean+sm from three individual animals. * P <.5, ompared with values in the FIB strain. Vt wt, ventriular wt; Vt/BW, ventriular wt to body wt ratio. Peptides. Hamster BNP [ ], hamster BNP [ ], rat BNP, human BNP, porine BNP, and -type natriureti peptide (NP) were synthesied by the solid phase method. a-rat ANP and a-human ANP were purhased from Peptide Institute, In. (Minoh, Japan). Development of RIA for hamster BNP. Hamster BNP[83-96] was onjugated to bovine thyroglobulin (Sigma hemial o., St. Louis, MO) using the arbodiimide oupling proedure (31). Three adult female Japanese white rabbits were immunied with the onjugate as previously reported (31 ). levation of the antibody titer was observed in one rabbit, and its serum was used as the antiserum against hamster BNP (HR-1). Hamster BNP[65-96] was radioiodinated by the hloramine T method (31). The speifi ativity of '25I-hamster BNP[65-96] ranged from 5 to 1 pi/pg. The RIA for hamster BNP was performed following the method of the RIA for the OOH-terminal fragment of ANP (31). The antiserum HR-1 was used at a final 1:5 X 14 dilution. Animals. 28-wk-old male golden Syrian hamsters (Shimiu xperimental Supplies, Kyoto, Japan) were used to examine BNP and ANP gene expressions and BNP and ANP onentrations in hamster tissues. Furthermore, to examine the synthesis and seretion of these peptides in ardiomyopathi hamsters, 32-wk-old male hypertrophi (BIO14.6) and dilated (BI53.58) ardiomyopathi strains, and their age-mathed ontrol (FIB) strain were obtained from Bio Breeders In. (Watertown, MA). They were housed in a temperature-, humidity-, and light-ontrolled room with free aess to water and standard food (-2, Japan LA, Tokyo, Japan; Nai.85/1 g). Table I shows brief profiles of ardiomyopathi and ontrol hamsters used in the present study. In the present study, the B114.6 strain showed ventriular hypertrophy, as judged by the ventriular wt/body wt ratio (Table I), without any apparent signs of HF. The B strain exhibited no signs of ventriular hypertrophy and HF. Plasma samplings and tissue preparations. After hamsters were anesthetied by intraperitoneal injetions of pentobarbital (6 mg/kg), blood was sampled from the jugular vein and immediately transferred to hilled polypropylene tubes, ontaining Na2DTA (1 mg/ml) and aprotinin (Ohkura Pharmaeutial In., Kyoto, Japan; 1, kallikrein inativator U/ml), and entrifuged at 4. Hearts, brains, and other tissues were immediately removed from hamsters as previously desribed (13). To prevent atrial ontamination, the apial half of the ventrile was used as the ventriular sample. Plasma and tissue samples were froen in liquid nitrogen, and stored at -7 until use. Northern blot analysis. Total RNA was extrated by the guanidinium thioyanate method (26), and Northern blot analysis was arried out with the 32P-labeled full-length hamster BNP DNA (Fig. 1 A) and 217-bp BglII fragment of hamster ANP DNA (Fig. 2 A) as probes, as previously desribed (13). A human,/-atin genomi probe (Wako Pure hemial Industries Ltd., Osaka, Japan) was used to monitor the amount of total RNA in eah sample. Relative amounts of mrna speies were determined by laser densitometri sanning, and the BNP mrna and ANP mrna onentrations were expressed relative to those of the right atrium of the FIB strain (amounts of BNP mrna and ANP 16 Tamura et al.

3 A bp v Z ~~~~~~~~~~~- IV Hamster BNP (polyda) DNA M I I (oyd) PR produt Sequening strategy (2 I- i(a1ma)n tl A Hamster ANPI bp I.I IK DNA 1> Sequening -> strategy - II < 4 -- <~~~~~~~~~I '. - B -54 GAAOAGAGAAGAAGAAAAATGGATAATTTOTOA -I M L A K V L S 6 V VI F L L F L Y L S I ATATTAAOTOTOTGGOTGGTTTOTTTOTTTTTTTATTOTA 6 P16 1Ps 3 S 5 K #I GTGGGAAGTATATTOGGAGTAAOTTGGAAAATAAG M O T L L L L R K A A V A A L 121 ATOAGATTOTAGATOTGAGOGAAAAGOAGAGGGGTGGTOGGOGAGT 11 4 SO L K D V I T K A P L S T L G S 161 TGAAGOAAAOAGTATAAAAAOATTAAAGATTGGGTTAAGA S T L N V L K L A N S K K MH N S 241 AOATATGTTGAGAAATTGAAATAAGAAOATMATAATTGGGTG F G R I R I G S F S R L G N V L K 31 TTTGGGAGAGGATAGAAGAATGGTATTATGTTGGGTGAATGTGTOAAG 3 66 R I $ 361 GGTATTAGGATGAGTAGTGAGAAGGTTGATATGGOOOTT AATGTGGGATTTTGAAGTGATTATTTATTTATTTATTTTTATTTATTT TTTGGTTGTTTTTAAAGATGTTTTTATTTGAGAAGATTTTATGGTGTAAT AAAAAG-6 W(dA) 549 Figure 1. Struture of hamster BNP DNA. (A) The restrition enyme map of hamster BNP DNA (lone phambnp15), loation of hamster BNP-speifi DNA probe obtained by PR, and sequening strategy. The oding region is boxed, and regions enoding the signal peptide (m) and BNP (U) are indiated. Positions of the translation start and stop odons, "ATITA" motifs, and a polyadenylation signal (AA- TAAA) are indiated. The nuleotide number of the first nuleotide of the ATG translation start odon is designated as + 1. Seleted restrition enyme sites are shown with nuleotide numbers in round brakets. (B) Nuleotide and dedued amino aid sequenes of hamster BNP DNA. Amino aids are expressed in one letter ode. The translation stop odon is indiated by * * *. "ATITA" motifs and a polyadenylation signal are underlined with solid and double lines, respetively. The signalsequene leavage site (arrow) and putative proessing site for BNP (arrowhead) are indiated. These sequene data are available from DDBJ/MBL/GenBank under aession number D mrna in 1. jig of total RNA from the right atrium of the FIB strain were defined as 1. unit). Measurements of BNP-LI and ANP-LI onentrations. Tissue and plasma extrations were arried out as previously reported (13). The BNP-LI and ANP-LI onentrations were measured by the RIA for hamster BNP and the RIA for the OOH-terminal fragment of ANP (31), respetively. The ross-reativity of hamster BNP[65-96] in the RIA for ANP was <.1%. Reoveries of 1 fmol of hamster BNP[65-96] and a-rat ANP added to 1-ml plasma were 8 and 7%, respetively. High-performane gel permeation hromatography (HP-GP). HP-GP was performed on a TSK-GL G2 SW olumn (7.5 X 6 mm, Toyo Soda, Tokyo, Japan), as previously reported (31 ). The flow rate was.3 ml/min, and the fration volume was.36 ml. Statistial analysis. All data were expressed as the mean+sm B -15 AGAGAGAGAGAGAOAGAGAoAGAAGAOAGAGAOAAOAOAGA AAAOGAGAGOATGAOAOAGAAGGAOATAGATOTQGAAAOG -I M O S f S I T V OP Pf L L A fw P ATOGOTTTTATAOTOOOTTTTTTTOOTTTTOOTTOGO L P 1 -I 1 N 1G A4 N P V Y A V I6 S N T O L MD P K 61 ATATTOGAOGAATOTOTAAOTOAGTOTAAAAGATTOATOGATTTAAO II ON 1 6K M P 1 V V P P 121 AATOTOOAATTOGOAOAGAAGATOOTTAGAAGATAGOTOTOAAO 1S 4 s A l NOO A PG A A 11 PI V 161 OTOAGTOAOAOAATOATOAAGOAGOOOAOOTAOTTTTOAGOTO 24 A P W T G V N P P 6 T L A S 241 OTTOGATOGAOGAOTAAATAGAGOAATOOGTATOOOOAO 2 P W P S A S A I I K K 1 6 A I I A 31 TGOGATOATAOATTGTTTTGAAAAOAAATGAGOOTTOTAOT too too A P R6S L R A S S F R I R I GA 361 GTGGAGTAOOAGOTAGTOTTOOGOTAGOATAAGOATTGOAO S G L G N S F 6 I R 6R N 421 AGAGGGATAGGATGTAATAGTTGGTAGAAGATAAAOAOOGAOGAAAGA AGAGATTOTGOOGOAGATTOAGAAOAAAGGTGGTGTGTAOAO TTGGTTATTGTATGAGOTGTGGGAAATGTGGAGTGTOTTTTTT 6 61 ATTATAGAATOTAATGTAGATGAGTOGTTTTOGGGGGTTTTAG TGATATTAAAGTAGATTATTTAGAAAGAGTTGGAAAAATTTTTTTGA ATAAATTAAAAG-Ol@ IdA) 736 Figure 2. Struture of hamster ANP DNA. (A) The restrition enyme map of hamster ANP DNA (lone phamanp4) and sequening strategy. (B) Nuleotide and dedued amino aid sequenes of hamster ANP DNA. Symbols are the same as in Fig. 1. These sequene data are available from DDBJ/MBL/GenBank under aession number D from three individual animals. The statistial signifiane of differenes in mean values was assessed by unpaired Student's t test. Results Isolation and harateriation ofhamster BNP DNA. Approximately 4 x 1O plaques were sreened and 76 primary positives were obtained. The longest lone, phambnpl5, ontained a 63-bp insert with an open reading frame of 366 bp (Fig. 1). The oding region of hamster BNP DNA was 78, 64, and 63% homologous to those of rat, porine, and human BNP DNAs (28-3), respetively. The nuleotide sequene from + 89 to was idential to that of the hamster BNP DNA fragment obtained by the PR (Fig. 1 A). The 3'-untranslated region ontained a typial polyadenylation signal, "AATAAA" (32), and 4 opies of "ATITA" motif impliated in mrna instability (33) (Fig. 1). Analysis of the dedued amino aid sequene revealed that hamster preprobnp onsists of 122 amino aids (Fig. 1 B). The NH2-terminal hydrophobi 26-residue peptide represented Natriureti Peptides in Hamsters 161

4 A i1 hamster rat BNP: BNP: MODLRKVLS-RVVLFLLFLYLSPLGSHSHPLGSP--OOg MIDLaKVLPO-M ILLLLFLINL SP LG IGH SHPLG SP-_-_SOa Porine B4P: MGPRMALP LILLLFLIHLLLLLGIRSHPLGIGAGLASIO human BNP: DPIOTA-PSRALLLLLLFLHLAFLGGRSHPLGSPGSASD SP SKMO TLLD LLRK-A AVA--RGO L LKD- D SPOsTMIOIKLL---LIRK-SIIMA-aIR-aOLs s IK-D-a_ LP---GIOQLLDR--L-RDRVSILOA-RTD LPLROQD L-TSGLaQ--RNHLQ-GKLSLQVO-TSLPL-a VI VTKAPLOS--TLGSODSTL-H-VL K-L ---GPITIK L L K-R-V L RTS o DSA-FR--I-a - R -L --RGLIT-AWARAAPT-GVLGPRSSI FOVL---RGI SPR-P T-GVWKSRVA-TGIRGHRKM---VVLYTLRAP 6465 _ 7 s 9 96 R NSKK-_-HN[SGFGORIDRIGSFSRLGNVLKRY R NISI-_K I-_MIAHSISISFGOK IDORIIGAV S RLGDG L RLF - P K T M - RFDlSlG F GOR R LID R I G S LOSIG L G IN V L R R Y R J-S P K MV GSGFGR K M RI S S[JGLGK V[JR R H B hamnter ANP: ;;G S F S IV GFFLL A PGHIG ANPVSAvsNTDLMDFK mouaa ANP:IMGIS ITILGFIFLIVILI-IAFHLIPGHIG ANPIVIYvSIAVSNITIDLMDFKI rat AN:MGSFSIKFLLAWPHGNVSVNDMF human ANP: MS S F S T TT v ssl LLAFL GOT RAPNAV S NAD LMD F KI NLLDHLKMPLDVVPALODAPAASLPV N L LD H LK M P V D VMP P OA L Sa T A-G AA LSS L P VP NLLHLKMP V PA LI OaTDAI -IGAA LS S LS V P NLLLHLDKHPL PN-GAAL S PLP S OK L RA L L AA OK L RA L LAG DGGA L G R -G P WD PWT G VNPP QOR DGG T L G S-SPWD PSDR S ALL K PWT G V N PP LIRDG S A-SR R SOPWD PSDR S ALL K IPWTGV N PSIORDG GALGR-G PWD PSDRSALLKSKLRALLAG PWT G V SPA O GR D R S A L L K S K L R AL LTA, v 129 PRS LRRSSFGGR IDR IGAOSGLGNSFRYRR PRS LRR SFGGR ID R I GAOSGLGNS FRYRR PRSLRRSSFGGRIDRIGAOSGLGNSFRYRR PRSLRRSSFGGRMDRIGAOSGLGNSFRY Figure 3. Alignment of amino aid sequenes of preprobnps and preproanps. (A) Alignment of amino aid sequenes of hamster, rat, porine, and human preprobnps. onserved amino aids are boxed, and two ysteine residues to form an intramoleular disulfide-linkage are onneted by the solid line. A dash indiates a spae introdued to maximie homology. Amino aids of hamster preprobnp are numbered above the sequene (the NH2 terminus of probnp is designated as +1). The signal-sequene leavage site (arrow), proessing sites for rat BNP, porine BNP-32, porine BNP, human BNP (v), and putative proessing site for hamster BNP (v) are indiated. (B) Alignment of amino aid sequenes of hamster, mouse, rat, and human preproanps. a signal peptide (Fig. 1 B). The OOH-terminal sequene of preprobnp ontained two ysteine residues (ys74 and ys') to form a 17-residue ring struture, whih ommonly ours in members of the natriureti peptide family (24, 28-3, 34, 35) (Fig. 3). The OOH-terminal 32-residue peptide of hamster preprobnp (hamster BNP[65-96]) was preeded by a single arginine residue, whih is the proteolyti proessing site for porine, rat, and human BNPs (28-3) (Fig. 3 A). The amino aid sequene of hamster preprobnp was 63, 46, and 43% homologous to rat, porine, and human preprobnps (28-3), respetively. Isolation and harateriation ofhamsteranp DNA. From approximately 4 x 15 plaques, 255 primary positives were obtained. The longest lone, phamanp4, ontained a 843-bp insert with an open reading frame of 459 bp (Fig. 2). The oding region of hamster ANP DNA was 89, 9, and 81% homologous to those of rat, mouse, and human ANP DNAs P (24, 34, 35), respetively. The 3 '-untranslated region ontained a typial polyadenylation signal, "AATAAA" (32). Hamster preproanp onsisted of 153 amino aids (Fig. 2 B). The NH2-terminal 24-residue peptide was a signal peptide (Fig. 2 B). a-hamster ANP sequene of 28 amino aids was loated at the OOH-terminal region of preproanp, and was flanked by Pro98-Mrg99 and Arg '2-Arg129 dipeptides whih are proteolyti proessing sites for rat and mouse a-anps (Fig. 3 B) (34, 35). Alpha-hamster ANP was idential to a-rat ANP (Fig. 3 B) (34). Hamster preproanp was 9, 9, and 81% homologous to rat, mouse, and human preproanps (24, 34, 35), respetively. BNP and ANP gene expressions in hamster tissues. Northern blot analysis identified a single.8-kb BNP mrna speies both in the atrium and ventrile (Fig. 4 A). The BNP mrna onentration in the ventrile was about half of that in the atrium. Taking aount of tissue weight, 8% of the total ontent of BNP mrna in the whole heart was of ventriular origin. In ontrast,.9-kb ANP mrna was deteted mainly in the atrium (Fig. 4 B). The onentration and total ontent of ANP mrna in the ventrile were only 2% and < 2% of those in the atrium, respetively. No signifiant amounts of BNP and ANP transripts were deteted in other tissues inluding the brain (Fig. 4). Development of RIA for hamster BNP. A typial standard urve of hamster BNP[65-96] and dilution urves of rossreativities of related peptides in the RIA for hamster BNP are shown in Fig. 5 A. The minimal detetable quantity in the RIA was 1 fmol/tube and the 5% binding interept was 7 fmol/ tube. In the RIA for hamster BNP, ross-reativities of rat BNP, human BNP, a-anp, and NP were <.1%, while porine BNP showed a ross-reativity of 35% on a molar basis. The intra- and inter-assay oeffiients of variation were 7.5% (n = 1) and 4.8% (n = 6), respetively. Distributions and moleular forms of BNP-LI and ANP-LI in hamster tissues. Serial dilution urves of extrats of the atrium, ventrile, lung, and plasma were parallel to the standard urve (Fig. 5 B). In 28-wk-old golden Syrian hamsters, the BNP-LI onentration in the ventrile (112±9 pmol/g, n = 3) was 4% of that in the atrium (3.11±.52 nmol/g), while the ANP-LI onentration in the ventrile (9.78±1.61 pmol/g) was only.1% of that in the atrium (8.34±.64 nmol/g). In the brain, ANP-LI was deteted (.55±.14 pmol/g), while BNP- LI was not deteted (<.2 pmol/g). In the lung, BNP-LI was deteted (4.35±.56 pmol/g), while ANP-LI was not deteted (<.7 pmol/g). In the liver and kidney, BNP-LI and ANP- LI were not detetable. The plasma BNP-LI and ANP-LI onentrations were below the detetion limits of the respetive RIAs (BNP-LI, < 15 fmol/ml; ANP-LI, < 1 fmol/ml). The HP-GP revealed that BNP-LI in the atrial and ventriular extrats of 28-wk-old golden Syrian hamsters omprised a single omponent with an approximate mol wt of 14 kd (orresponding to probnp). ANP-LI in the atrium was eluted as a single peak at the elution position of the preursor form of rat ANP (y-rat ANP, 14 kd). In the ventrile, the major omponent of ANP-LI was eluted at the elution position of y- rat ANP, and there was also a minor omponent of ANP-LI eluted at the position of a-hamster ANP. These HP-GP profiles of BNP-LI and ANP-LI in the heart of the golden Syrian hamster were essentially similar to those in the heart of the FiB strain illustrated below in Fig Tamura et al.

5 A 1 1 B I, P:P i a2) > =n ~-i Mr > - -L 4 Origin m:w-xx ) 4 Origin _ bat*{ Z s *. BNP mrna S 4 18S ANP mrna _428 S 1418S Figure 4. Northern blot analysis of BNP mrna (A) and ANP mrna (B) in tissues of 28-wk-old golden Syrian hamsters. One,.g eah of total RNAs from the atrium and ventrile, and 1 Ag eah of total RNAs from the brain, lung, liver, and kidney were used. BNP and ANP gene expressions in ardiomyopathi hamster hearts. Representative data of Northern blot analyses of BNP and ANP mrnas in hearts of 32-wk-old ardiomyopathi hamsters (BIO14.6 and BIO53.58 strains) and age-mathed ontrol hamsters (FIB strain) are depited in Fig. 6. Atin transript levels were equivalent among different RNA samples (data not shown). In the heart of the ontrol FIB strain, the rank order of the BNP mrna onentration was right atrium = left atrium > left ventrile > right ventrile, and that of the ANP mrna onentration was right atrium = left atrium > left ventrile > right ventrile (Fig. 6). The BNP mrna and ANP mrna onentrations in the left ventrile were one order of magnitude higher than those in the right ventrile, respetively (Fig. 6). The BNP mrna and ANP mrna onentrations in the three strains are summaried in Fig. 7 A. The BNP mrna onentration in the ventrile was 5% of that in the atrium, and the total ontent of BNP mrna in the ventrile was 87% of that in the whole heart. By ontrast, the ANP mrna onentration in the ventrile was only 2% of that in the atrium, and the total ontent of ANP mrna in the ventrile was 2% of that in the whole heart. These observations were similar to those on the golden Syrian hamster. In the present study, the 32-wk-old hypertrophi ardiomyopathi BIO14.6 strain exhibited apparent ventriular hypertrophy as judged from the ventriular wt/body wt ratio (Table I) and no signs of HF. In this strain, as ompared with the FIB strain, the BNP mrna onentration was elevated 1.5-fold in the atrium and fourfold in the ventrile (Fig. 7 A). As a result, the BNP mrna onentration in the ventrile exeeded that in the atrium, and the total ontent of BNP mrna in the ventrile reahed to 95% of that in the whole heart. On the other hand, although unhanged in the atrium, the ANP mrna onentration was inreased more than 1-fold in the ventrile (Fig. 7 A). The ANP mrna onentration in the ventrile was one forth of that in the atrium, and the total ontent of ANP mrna in the ventrile reahed to 8% of that in the whole heart. The 32-wk-old dilated ardiomyopathi BI53.58 strain used in the present study did not show ventriular hypertrophy (Table I) and HF. In this strain, the BNP mrna onentration was elevated 3-4-fold in the atrium and ventrile (Fig. 7 A). The BNP mrna onentration in the ventrile was two thirds of that in the atrium, and 85% of the total BNP mrna ontent in the whole heart was expressed in the ventrile. The pattern of inrease in ANP mrna onentration in the BI53.58 strain was similar to that in the BI14.6 strain. onentrations and moleular forms of BNP-LI and ANP- LU in ardiomyopathi hamster hearts. In the heart of the FIB strain, the BNP-LI onentration in the ventrile (35±8 pmol/ g) was 5% of that in the atrium (72±3 pmol/g), and the ANP-LI onentration in the ventrile (2.1±.5 pmol/g) was only.1% of that in the atrium (2.53±.2 nmol/g) (Fig. 7 B). The distribution pattern of BNP-LI and ANP-LI in the heart of the FIB strain was similar to that in the golden Syrian hamster heart. The BNP-LI and ANP-LI onentrations in the left ventrile were 3 and 1 times as high as those in the right ventrile, respetively. In the heart of the hypertrophi ardiomyopathi BI14.6 strain, as ompared with the FIB strain, the BNP-LI onentration was elevated fourfold in the ventrile, while unhanged in the atrium (Fig. 7 B). The ANP-LI onentration was inreased more than 11 -fold in the ventrile, while it tended to be dereased in the atrium. A B/BoI (%) 1 I~ _ ~oa _ ~ 8 a e hamster BNP ( ~65-96) o rat BNP 6 x porine BNP 4 X * human BNP * a-anp o NP lo 13 lo, Peptide (fmol/tube) B B/B M A,XI2XlOXSx16x x4 x2 xl G oataiutf x ventrie 2 * lung A pisma f3 14 Hamster BNP (fmol/tube) Figure 5. A typial standard urve of hamster BNP[65-96] and ross-reativity profiles of its related peptides (A) and dilution urves of extrats of various samples (B) in the RIA for hamster BNP with the antiserum HR-l. Natriureti Peptides in Hamsters 163

6 BNP mrna FIB < t > > -I* ANPmRNA '*JIrP B < <> > Q: IJ -J a* W B < > > r4 Q Figure 6. Northern blot analysis of BNP mrna and ANP mrna in hearts of 32-wk-old ardiomyopathi hamsters (BI14.6 and B strains) and age-mathed ontrol hamsters (FIB strain). Representative ases are shown. One jlg of total RNA is applied to eah lane, and atin transript levels are equivalent among different RNA samples (data not shown). RA, right atrium; LA, left atrium; RV, right ventrile; LV, left ventrile. In the heart of the dilated ardiomyopathi B strain, the BNP-LI onentration was elevated fivefold in the ventrile, while unhanged in the atrium (Fig. 7 B). The ANP-LI onentration was elevated eightfold in the ventrile, while it was dereased by 68% in the atrium. In the heart of the ontrol FIB strain, moleular forms of BNP-LI and ANP-LI were similar to those in the golden Syrian hamster; both BNP and ANP were stored as prohormones (Fig. 8). Also in the hearts of the BI14.6 and BI53.58 strains, moleular forms of BNP-LI and ANP-LI were essentially similar to those in the FIB strain (Fig. 8). onentrations and moleular forms in ardiomyopathi hamster plasma. In the FIB strain, the plasma BNP-LI and ANP-LI onentrations were below the detetion limits of the respetive RIAs (BNP-LI, < 15 fmol/ml; ANP-LI, < 1 fmol/ ml; Fig. 7 ). In the B114.6 strain, as ompared with the FIB strain, the plasma ANP-LI onentration was inreased at least fourfold to 47±17 fmol/ml, whereas the plasma BNP-LI onentration was remarkably elevated more than ninefold to A vb.2 U Sgo UBy ao.2 U Q S ā ) B Atrium Ventrile a Atrium Ventrile IU.2 S U -a - b- - a on.2 a N. - U *1 FIB B114.6 B Figure 7. Summary of mrna and peptide onentrations of BNP and ANP in atria and ventriles and the plasma BNP-like immunoreativity (-LI) and ANP-LI onentrations in 32-wk-old ardiomyopathi hamsters (BI14.6 and BI53.58 strains) and agemathed ontrol hamsters (FIB strain). (A) The BNP mrna and ANP mrna onentrations in the atrium and ventrile, expressed relative to those in the right atrium of the FIB strain (amounts of BNP mrna and ANP mrna in 1. tg total RNA from the right atrium of the FIB strain are defined as 1. U). The data are expressed as the mean ±SM from three individual animals. (B) The BNP-LI and ANP-LI onentrations in the atrium and ventrile. () The BNP-LI and ANP-LI onentrations in the plasma. Signifiantly different from the ontrol FIB strain, *P < Tamura et al.

7 FiB B Atrium.) o A b- -J m o t Fration -% u3 4 I o -i To O D) d ż Im las Fration o 4 Q 2 d. 4 1' mrm o 6 7 Q) o '* 4, Ventrile - L Z 2 Im o le 1 IL.@ _O o13) v X 4 " Ji -J d. 2 _ m) xs IL ywlll > 7- m d > 14 AN * * _* o AKKA. I II.4 o. 2 IL 4 Figure 8. A Fration I 7 n Fration 6 HP-GP profiles of BNP-like immunoreativity (-LI) and ANP-LI in atria and ventriles of the ontrol FIB strain and the hypertrophi ardiomyopathi B114.6 strain. Arrows denote seleted positions of a series of myoglobins of a polypeptide moleular weight alibration kit (Pharmaia, Uppsala, Sweden), void volume (Vo), and total volume (V,), and the elution position of a-hamster ANP (a-hamanp). n 7 136±13 fmol/ml, three times higher than the elevated plasma ANP-LI onentration (Fig. 7 ). In the B strain, the plasma BNP-LI onentration was elevated more than sevenfold to 18±19 fmol/ml, as ompared with the FIB strain, whih is three times higher than the elevated plasma ANP-LI onentration (36±13 fmol/ml, Fig. 7 ). Furthermore, we also measured plasma BNP and ANP onentrations in a hamster from the B strain with signs of overt HF (generalied edema, pleural effusion, and asites), whih were 285 and 15 fmol/ml, respetively. In the plasma of the B114.6 strain, BNP-LI and ANP-LI were omposed of small mol-wt forms orresponding to hamster BNP[65-96] and a-hamster ANP, respetively (Fig. 9). In the plasma of the B strain, BNP-LI and ANP-LI also onsisted of hamster BNP[65-96] and a-hamster ANP, respetively. Disussion BNP is a ardia hormone whih ours mainly in the ventrile ( 12, 13). BNP synthesis and seretion are extremely augmented in human failing ventriles (12, 14, 18, 19). ardiomyopathi hamsters are widely used animal models of heart failure (21-23). However, the struture of hamster BNP has never been dislosed. Due to the extraordinary strutural divergene of BNP among speies, it was impossible to examine the pathophysiologial signifiane of BNP using ardiomyopathi hamsters. In this ontext, we first isolated the full-length hamster BNP DNA and eluidated the struture of hamster BNP. We ould not lone hamster BNP DNA by the ross-hybridiation method using rat, porine, and human BNP DNA fragments as probes (not shown). By the PR tehnique as desribed in Methods, we suessfully obtained a hamster BNPspeifi DNA probe. Using the obtained probe, we isolated the full-length hamster BNP DNA. We determined that the obtained lone is a hamster BNP DNA lone, based on the following reasons. First, in the OOH-terminal region of the dedued amino aid sequene, there are two ysteine residues to form a 17-residue ring struture whih ommonly ours in the natriureti peptide family (Fig. 3). Seond, in the 3'- untranslated region of the obtained DNA, there are four opies of "ATTTlA" motif impliated in mrna instability (33) (Fig. Natriureti Peptides in Hamsters 165

8 .-% a <,, 2 Lō %--. 1 I1- o R* be > * 4- * u Fration I- I--O *g A) L- i o Figure 9. HP-GP profiles of BNP-like immunoreativity (-LI) and ANP-LI in the plasma of the hypertrophi ardiomyopathi B114.6 strain. Arrows denote seleted positions of a series of myoglobins of a polypeptide moleular weight alibration kit (Pharmaia), void volume (VO), and total volume (V,), and elution positions of a-hamster ANP (a-hamanp) and hamster BNP[65-96] (hambnp[65-96]). 1). This "ATITA" motif is also present in the 3 '-untranslated region of rat, porine, and human BNP DNAs (28-3), while it is absent in ANP DNAs (24, 34, 35). Third, in the oding region, the nuleotide sequene of the obtained DNA is 78% homologous to that of rat BNP DNA (28). Fourth, by Northern blot analysis using the loned DNA as a probe, the gene expression is deteted in the ventrile as well as in the atrium, and not deteted in extraardia tissues, whih is onsistent with the tissue-speifi BNP gene expression in rats and humans (9). It is highly likely that the OOH-terminal 32-residue peptide of hamster preprobnp (hamster BNP[65-96], Fig. 1 B) is hamster BNP. Hamster BNP[65-96] is preeded by a single arginine residue, whih is the proteolyti proessing site for porine, rat, and human BNPs (28-3) (Fig. 3 A). Furthermore, our HP-GP study indiates that BNP-LI in ardiomyopathi hamster plasma is eluted as a single peak at the elution position of hamster BNP[65-96] (Fig. 9). Isolation and sequene determination of hamster BNP are ongoing in our laboratory. In the present study, we also isolated the full-length hamster ANP DNA, and eluidated that a-hamster ANP of 28 amino aids is idential to a-rat ANP. The 28-amino aid sequene of hamster preproanp was flanked by Pro98-Arg99 and Mg 'n- Arg 29 dipeptides whih are proteolyti proessing sites for rat and mouse a-anps (Fig. 3 B) (34, 35). Moreover, a previous HPL study showed that the major peak of ANP-LI in hamster plasma orresponds to the elution position of a-rat ANP (25). The nuleotide and dedued amino aid sequenes of the oding region of hamster ANP DNA are 9% homologous to those of rat and mouse ANP DNAs. By ontrast, the nuleotide and dedued amino aid sequenes of the oding region of hamster BNP DNA was 78 and 63% homologous to those of rat BNP DNA, respetively. Moreover, the amino aid sequene of hamster preprobnp is < 5% homologous to those of porine and human preprobnps. These observations further support the notion that the struture of BNP is onsiderably divergent among speies. Thus, the loning of hamster BNP DNA is essential to investigate the signifiane of BNP using ardiomyopathi hamsters. In the golden Syrian hamster, the BNP mrna onentration in the ventrile is about half of that in the atrium (Fig. 4 A). Taking aount of tissue weight, however, the total ontent of BNP mrna in the ventrile reahes to 8-85% of that in the whole heart, while 8% of the total ANP mrna ontent in the whole heart is expressed in the atrium. Beause the ventrile seretes BNP by the onstitutive pathway with muh smaller storage pool as ompared with the atrium as we have previously reported (13), the BNP-LI onentration should be lower in the ventrile than in the atrium even if the ventrile is the major soure of BNP. Taken together, the ventrile is the major site of the BNP synthesis, while ANP ours mainly in the atrium. These results are onsistent with those in rats and humans (12, 13). To determine onlusively whether BNP is sereted mainly from the ventrile in hamsters or not, further studies suh as perfusion of the hamster heart with or without the atrium ( 13) will be required. In the present study, HP-GP demonstrated that BNP-LI in the ardia extrat omprises a single 14-kD omponent in hamsters (Fig. 8) as in pigs ( 1), whereas the major omponent of BNP-LI in ardia extrats of rats and humans is BNP (3 kd) (11, 12). These observations indiate that the proessing pattern in the ardia tissue, as well as the struture, of BNP is divergent among speies. On the other hand, the proessing pattern of ANP in the hamster heart is the same as those in hearts of rats and humans; ANP-LI in the ardia extrat omprises a single omponent orresponding to y-anp (11, 12). Although BNP was originally isolated from the porine brain, neither BNP mrna (Fig. 4 A) nor BNP-LI is deteted in the hamster brain. These observations are onsistent with previous findings showing that the tissue distribution of BNP is also divergent among speies; BNP-LI is deteted in the porine brain, but not in the rat brain (1, 11). In extraardia tissues of the hamster, BNP-LI is deteted in the lung. Beause ANP-LI is not deteted in the hamster lung, we an exlude the possibility of atrial ontamination. While we ould not detet BNP transript in the hamster lung by Northern blot analysis in the present study (Fig. 4 A), it is reported that BNP transript an be deteted in the rat lung by the PR tehnique (36). Taken together, it is possible that the BNP gene is expressed in the hamster lung at a low level not detetable by Northern blot analysis. To assess the pathophysiologial signifiane of BNP and ANP, we examined the synthesis and seretion of these natriureti peptides in the hypertrophi (BIO14.6) and dilated (BIO53.58) ardiomyopathi strains. In the present study, we used the FIB strain as the ontrol, beause the FIB strain is a non-myopathi strain widely used as the ontrol in studies on ardiomyopathi hamsters (5, 22). We used the BI14.6 strain to assess impliations of BNP and ANP in ventriular hypertrophy. In the BIO14.6 strain, spotty ellular myolysis in the heart ours at 6 wk of age. Ventriular hypertrophy ensues in a progressive manner after wk, and beomes most prominent at 3-4 wk of age. 166 Tamura et al.

9 HF ours in a substantial proportion of animals after wk, and beomes prominent from 4 wk of age (23). In the present study, the 32-wk-old B114.6 strain exhibits ventriular hypertrophy, and shows no signs of HF. In our BIO14.6 hamsters, the plasma ANP-LI onentration was elevated as ompared with the FIB strain, but remained < 5 fmol/ml (Fig. 7 ). It is reported that the plasma ANP-LI onentration is elevated to 1 fmol/ml in ardiomyopathi hamsters with moderate to sever HF (5, 25). The low plasma ANP-LI onentration is, therefore, onsistent with the observation that the 32-wk-old B114.6 strain used in the present study does not manifest HF. In ontrast, the BNP gene expression is augmented fourfold in the ventrile (Fig. 7 A), and the plasma BNP-LI onentration is elevated at least ninefold to more than 1 fmol/ml (Fig. 7 ). levations in the plasma BNP-LI and ANP-LI onentrations an be good markers of ventriular hypertrophy without overt HF. The fold inrease of the plasma BNP-LI onentration was greater than that of the plasma ANP- LI onentration (Fig. 7 ). The elevation in the plasma BNP- LI is, therefore, a more sensitive marker of ventriular hypertrophy than the plasma ANP-LI onentration. The observation on the BI14.6 strain in the present study well aords with that on patients with hypertrophi obstrutive ardiomyopathy (HOM) (16). In patients with HOM, although there are no signs of apparent HF and the plasma ANP onentration remains at 3 fmol/ml, the plasma BNP onentration is inreased to 2 fmol/ml. We also examined the B strain to assess the signifiane of both natriureti peptides in ventriular overload. In the BI53.58 strain, signifiant ardia hypertrophy does not our. The ventriular dilatation and HF appear from 3-36-wk of age, earlier than in the BI14.6 strain (22). As the disease progresses, myolyti lesions are inreased in number and sie, and those in healing stage resolve into ollagenous fibrillar sar (21). The ventriular filling pressure is inreased, and the peak ventriular pressure and peak rate of ventriular pressure development are depressed (23). In the present study, the 32-wkold B strain does not show overt HF. The plasma BNP-LI onentration reahes to 1 fmol/ml (Fig. 7 ), although HF is still not overt and the plasma ANP-LI onentration remains at < 5 fmol/ml (Fig. 7 ). Our results, therefore, suggest that the elevated plasma BNP-LI onentration sensitively reflets ventriular overload preeding impairment of systemi irulation. The profile of elevations of the plasma BNP- LI and ANP-LI onentrations in the BI53.58 strain used in the present study well mimis that of the plasma BNP and ANP onentrations in patients with ventriular overload. In the early phase of AMI, the plasma BNP onentration is extremely elevated to 1 fmol/ml even in patients without overt HF, while the plasma ANP onentration is only slightly elevated (- 3 fmol/ml) (2). Among the FIB, B114.6, and B strains, the pattern of the plasma BNP-LI onentration is well parallel to that of the total ontent of BNP mrna in the heart. In the FIB, B114.6, and B strains, plasma BNP-LI onentrations are < 15, 136, and 18 fmol/ml, respetively, and total ontents of BNP mrna in hearts are 5, 3, and 21 U, respetively. Among the three strains, the pattern of the total ontent of BNP- LI in the heart is also parallel to that of the plasma BNP- LI onentration. The plasma BNP-LI onentration, therefore, diretly reflets the BNP synthesis in the heart. In the present study, in both ardiomyopathi strains, the ANP-LI onentration in the atrium was signifiantly dereased, while the ANP mrna onentration in the atrium was unhanged (Fig. 7). This observation indiates the aelerated seretion of ANP from atrial storage pool, whih is onsistent with the previous reports on DOA-salt rats and ardiomyopathi hamsters (15, 25). By ontrast, both of the BNP-LI and BNP mrna onentrations in the atrium were 1.5-fold inreased in both ardiomyopathi strains (Fig. 7), whih suggests that the synthesis and seretion of BNP are regulated differently from those of ANP in the atrium. There are some reports showing that the plasma ANP onentration is higher than the plasma BNP onentration in patients with HF. In these studies, the plasma BNP onentration is measured with extration by ommerially available antiserum against BNP (17-19). We established the sensitive RIA for human BNP with the monolonal antibody whih does not require plasma extration and reported previously that the plasma BNP onentration is extremely elevated and exeeds the plasma ANP onentration in patients with severe HF (12). To assess the pathophysiologial signifiane of BNP, SHR, DOA-salt rats, and experimental AMI rats are so far used as animal models (13, 15).2 In these rat models, the plasma BNP onentration remains at a relatively low level as ompared with the elevated plasma ANP onentration, whih is quite different from our observations on patients with HF (12). Moreover, these experimental rat models are not animal models of HF. It was, therefore, diffiult to assess the signifiane of BNP in human heart failure using these rat models. By ontrast, in the present study, in both ardiomyopathi hamsters, the plasma BNP-LI onentration is elevated to more than 1 fmol/ml and muh higher than the elevated plasma ANP-LI onentration, whih strongly suggests that ardiomyopathi hamsters are useful experimental animal models to investigate the pathophysiologial signifiane of BNP in ardiovasular diseases. Further examinations on BNP synthesis and seretion in ardiomyopathi hamsters at various linial stages are required in the future. In onlusion, we isolated the full-length hamster BNP and ANP DNA lones and studied BNP and ANP gene expressions in normal and ardiomyopathi hamsters. The present study eluidated that ardiomyopathi hamsters are good animal models to investigate the pathophysiologial signifiane of BNP. Aknowledgments We thank Ms. M. Shida, H. Kitoh, and A. Takakoshi for their seretarial assistane. This work was supported in part by researh grants from the Japanese Ministry of duation, Siene and ulture, the Japanese Ministry of Health and Welfare, Uehara Memorial Foundation, the Salt Siene Researh Foundation (9241), Smoking Researh Foundation, Yamanouhi Foundation for Researh on Metaboli Disorders. Referenes 1. De Bold, A. J Atrial natriureti fator: a hormone produed by the heart. Siene (Wash. D). 23: Sugawara, A., K. Nakao, N. Morni, M. Sakamoto, M. Suda, M. Shimokura, Y. Kiso, M. Kihara, Y. Yamori, K. Nishimura, J. Soneda, T. Ban, and H. Imura a-human atrial natriureti polypeptide is released from the heart and irulates in the body. Biohemt. Biophys. Res. ommun. 129: Natriureti Peptides in Hamsters 167

10 3. Burnett, J.., Jr., P.. Kao, D.. Hu, D. W. Heser, D. Heublein, J. P. Granger, T. J. Opgenorth, and G. S. Reeder Atrial natriureti peptide elevation in ongestive heart failure in the human. Siene (Wash. D). 231: Arai, H., K. Nakao, Y. Saito, N. Morii, A. Sugawara, T. Yamada, H. Itoh, S. Shiono, M. Mukoyama, H. Ohkubo, S. Nakanishi, and H. Imura Augmented expression of atrial natriureti polypeptide (ANP) gene in ventriles of spontaneously hypertensive rats (SHR) and SHR-stroke prone. ir. Res. 62: dwards, B. S., D. M. Akermann, M.. Lee, G. S. Reeder, L.. Wold, and J.. Burnett, Jr Identifiation of atrial natriureti fator within ventriular tissue in hamsters and humans with ongestive heart failure. J. lin. Invest. 81: Saito, Y., K. Nakao, H. Arai, K. Nishimura, K. Okumura, K. Obata, G. Takemura, H. Fujiwara, A. Sugawara, T. Yamada, H. Itoh, M. Mukoyama, K. Hosoda,. Kawai, T. Ban, H. Yasue, and H. Imura Augmented expression of atrial natriureti polypeptide gene in ventrile of human failing heart. J. lin. Invest. 83: Sudoh, T., K. Kangawa, N. Minamino, and H. Matsuo A new natriureti peptide in porine brain. Nature (Lond.). 332: Yoshimura, M., H. Yasue,. Morita, N. Sakaino, M. Jougasaki, M. Kurose, M. Mukoyama, Y. Saito, K. Nakao, and H. Imura Hemodynami, renal, and hormonal responses to brain natriureti peptide infusion in patients with ongestive heart failure. irulation. 84: Nakao, K., Y. Ogawa, S. Suga, and H. Imura Moleular biology and biohemistry of the natriureti peptide system I. J. Hypertens. 1: Saito, Y., K. Nakao, H. Itoh, T. Yamada, M. Mukoyama, H. Arai, K. Hosoda, G. Shirakami, S. Suga, N. Minamino, K. Kangawa, H. Matsuo, and H. Imura Brain natriureti peptide is a novel ardia hormone. Biohem. Biophys. Res. ommun. 158: Ogawa, Y., K. Nakao, M. Mukoyama, G. Shirakami, H. Itoh, K. Hosoda, Y. Saito, H. Arai, S. Suga, M. Jougasaki, T. Yamada, Y. Kambayashi, K. Inouye, and H. Imura Rat brain natriureti peptide: tissue distribution and moleular form. ndorinology. 126: Mukoyama, M., K. Nakao, K. Hosoda, S. Suga, Y. Saito, Y. Ogawa, G. Shirakami, M. Jougasaki, K. Obata, H. Yasue, Y. Kambayashi, K. Inouye, and H. Imura Brain natriureti peptide as a novel ardia hormone in humans: evidene for an exquisite dual natriureti peptide system, atrial natriureti peptide and brain natriureti peptide. J. lin. Invest. 87: Ogawa, Y., K. Nakao, M. Mukoyama, K. Hosoda, G. Shirakami, H. Arai, Y. Saito, S. Suga, M. Jougasaki, and H. Imura Natriureti peptides as ardia hormones in normotensive and spontaneously hypertensive rats: the ventrile is a major site of synthesis and seretion of brain natriureti peptide. ir. Res. 69: Hosoda, K., K. Nakao, M. Mukoyama, Y. Saito, M. Jougasaki, G. Shirakami, S. Suga, Y. Ogawa, H. Yasue, and H. Imura xpression of brain natriureti peptide gene in human heart: prodution in the ventrile. Hypertension. 17: Kohno, M., T. Horio, M. Yoshiyama, and T. Takeda Aelerated seretion of brain natriureti peptide from the hypertrophied ventriles in experimental malignant hypertension. Hypertension. 19: Hasegawa, K., H. Fujiwara, K. Doyama, M. Miyarnae, T. Fujiwara, S. Suga, M. Mukoyama, K. Nakao, H. Imura, and S. Sasayama Ventriular expression of brain natriureti peptide in hypertrophi ardiomyopathy. irulation. 88: Lang,.., A. M. J. hoy, and A. D. Struthers Atrial and brain natriureti peptides: a dual natriureti peptide system potentially involved in irulatory homeostasis. lin. Si. (Lond.). 83: Rihards, A. M., I. G. roier, T. G. Yandle,. A. spiner, H. lkram, and M. G. Niholls Brain natriureti fator: regional plasma onentrations and orrelations with haemodynami state in ardia disease. Br. Heart J. 69: Wei, -M., D. M. Heublein, M. A. Perrella, A. Lerman, R. J. Rodeheffer,. G. A. MGregor, W. D. dwards, H. V. Shaff, and J.. Burnett, Jr Natriureti peptide system in human heart failure. irulation. 88: Morita,., H. Yasue, M. Yoshimura, H. Ogawa, M. Jougasaki, T. Matsumura, M. Mukoyama, and K. Nakao Inreased plasma levels of brain natriureti peptide in patients with aute myoardial infartion. irulation. 88: Bajus, Hereditary ardiomyopathy: a new disease model. Am. Heart J. 77: Homburger, F Myopathy of hamster dystrophy: history and morphologi aspets. Ann. NY Aad. Si. 317: Strobek, J.., S. M. Fator, A. Bhan, M. Sole,.. Liew, F. Fein, and. H. Sonnenblik Hereditary and aquired ardiomyopathies in experimental animals: mehanial, biohemial, and strutural features. Ann. NY Aad. Si. 317: Oikawa, S., M. Imai, A. Ueno, S. Tanaka, T. Noguhi, H. Nakaato, K. Kangawa, A. Fukuda, and H. Matsuo loning and sequene analysis of DNA enoding a preursor for human atrial natriureti polypeptide. Nature (Lond.). 39: Thibault, G., M. Nemer, J. Drouin, J. P. Lavigne, J. Ding,. harbonneau, R. Garia, J. Genest, G. Jasmin, M. Sole, and M. antin Ventriles as a major site of atrial natriureti fator synthesis and release in ardiomyopathi hamsters with heart failure. ir. Res. 65: Ausubel, F. M., R. Brent, R.. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl nymati manipulation of DNA and RNA. In urrent protools in moleular biology, John Wiley & Sons, In., New York Ogawa, Y., K. Nakao,. Nakagawa, Y. Komatsu, K. Hosoda, S. Suga, H. Arai, K. Nagata, N. Yoshida, and H. Imura Human -type natriureti peptide: harateriation of the gene and peptide. Hypertension. 19: Kojima, M., N. Minamino, K. Kangawa, and H. Matsuo loning and sequene analysis of DNA enoding a preursor for rat brain natriureti peptide. Biohem. Biophys. Res. ommun. 159: Porter, J. G., A. Arfsten, T. Palisi, R. M. Sarborough, J. A. Lewiki, and J. J. Seilhamer loning of a DNA enoding porine brain natriureti peptide. J. Biol. hem. 264: Sudoh, T., K. Maekawa, M. Kojima, N. Minamino, K. Kangawa, and H. Matsuo loning and sequene analysis of DNA enoding a preursor for human brain natriureti peptide. Biohem. Biophys. Res. ommun. 159: Nakao, K., A. Sugawara, N. Morii, M. Sakamoto, M. Suda, J. Soneda, T. Ban, M. Kihara, Y. Yamori, M. Shimokura, Y. Kiso, and H. Imura Radioimmunoassay for a-human and rat atrial natriureti polypeptide. Biohem. Biophys. Res. ommun. 124: Birnstiel, M. L., M. Busslinger, and K. Strub Transription termination and 3' proessing: the end is in site. ell. 41: Shaw, G., and R. Kamen A onserved AU sequene from the 3' untranslated region of GM-SF mrna mediates seletive mrna degradation. ell. 46: Yamanaka, M., B. Greenberg, L. Johnson, J. Seilhamer, M. Brewer, T. Friedemann, J. Miller, S. Atlas, J. Laragh, J. Lewiki, and J. Fiddes loning and sequene analysis of the DNA for the rat atrial natriureti fator preursor. Nature (Lond.). 39: Seidman,.., K. D. Bloh, K. A. Klein, J. A. Smith, and J. G. Seidman Nuleotide sequenes of the human and mouse atrial natriureti fator genes. Siene (Wash. D). 226: Dagnino, L., J. Drouin, and M. Nemer Differential expression of natriureti peptide genes in ardia and extraardia tissues. Mol. ndorinol. 5: Tamura et al.