Reactive oxygen species: Importance for ischemia/reperfusion (injury)

Size: px
Start display at page:

Download "Reactive oxygen species: Importance for ischemia/reperfusion (injury)"

Transcription

1 Physiologisches Institut Reactive oxygen species: Importance for ischemia/reperfusion (injury) Prof. Dr. Rainer Schulz

2 Reactive oxygen species (ROS) in ischemia/reperfusion injury (IRI) ROS GOOD: Endogenous protection BAD: Infarction ROS

3 Potential sources of ROS Cardiomyocytes Other cell types p66 SOD2 Mitochondria CAT SOD1 Giorgio et al., Nat Rev Mol Cell Biol, 8: , 2007; Akki et al., J Mol Cell Cardiol 47: 15 22, 2009

4 Formation of ROS during ischemia Rat cardiomyocytes ROS generation: amytal (2.5 mm, a site I electron transport inhibitor), rotenone (10 μm, a site I electron transport inhibitor), bovine ROS formation during liver SOD (200 U/ml, dismutates superoxide to H2O2), (low-flow) diethyldithiocarbamic ischemia acid (DDC, 1 mm, which appears chelates to Cu be in Cu,Zn-SOD, primarily thereby inhibiting its function), nitro-larginine methyl caused ester [L-NAME, by mitochondria! 200 μm, inhibitor of nitric oxide synthase (NOS)], apocynin (300 μm, an inhibitor of NADPH oxidases). Cytosolic SOD inhibitor Complex I inhibitors NOX inhibitor NOS inhibitor Becker et al., Am J Physiol 277 Heart Circ Physiol 46: H2240 H2246, 1999

5 Dog Formation of ROS during ischemia/reperfusion Reperfusion Ischemia Bolli et al., Proc Natl Acad Sci USA 86: , 1989

6 ROS during IRI contribute to cellular damage contribute to cellular protection Function Morphology Function Morphology (Postischemic Reperfusion, Heart Failure) (Ischemia/Reperfusion Injury)

7 Mice NOX2 and irreversible IRI NOX2-KO Hoffmeyer et al., Circ Res 87: , 2000

8 Mice Catalase (CAT), superoxid dismutase (SOD) and irreversible IRI Cardiomyocytes Cardiomyocytes SOD2 Mitochondria CAT SOD1 Giorgio et al., Nat Rev Mol Cell Biol, 8: , 2007 Loor et al., Biochem Biophys Acta 2011

9 Mice GSH during ischemia/reperfusion GSH Mitochondria

10 GSH and irreversible IRI Pig Kupatt et al., Cardiovasc Res 61: , 2004

11 Aldolase reductase and irreversible IRI

12 ROS and mitochondrial morphology Cell (Cardio)- protection mrna BBA 2011

13 Mice ROS and mitochondrial morphology Loor et al., Biochem Biophys Acta 2011

14 ROS and mitochondrial morphology Kuznetsova et al, Int J Biochem & Cell Biol 41: , 2009

15 OPA1, mitochondrial morphology and IRI Chen et al., Cardiovasc Res 84: 91-99, 2009

16 ROS during IRI and protection from it contribute to cellular damage contribute to cellular protection Function Morphology Function Morphology (Postischemic Reperfusion, Heart Failure) (Ischemia/Reperfusion Injury)

17 Ischemic pre- and post-conditioning Dog Coronary occlusion 30 Infarct size (% area at risk) Control Precon (Ischemia/ Drugs) 60 min 5 10 min 3h 3h P<0.05 Postcon 3h 5 0 control Precon Postcon Zhao et al., Am J Physiol 285: H579-H588, 2004

18 ROS and ischemic preconditioning Garciarena et al., J Appl Physiol 105: , 2008

19 NOX2, ROS and ischemic preconditioning Mice NOX2-KO Bell et al., FASEB J 2005

20 Cylophilin D, ROS and ischemic preconditioning

21 Pre- and Post-conditioning: Signal transduction adenosine bradykinin opioids, UCN ANP BNP adenosine bradykinin opioids, UCN IGF-1 FGF-2 IL-6 type cytokines NO TNFα GPCR PI3K Akt NPR pgc GPCR NPR gp130 JAK TNF-R CB-R adiponectin only adenosine enos NO H11K PI3K Akt ERK STAT3 AMPK NO p38 sgc PKG enos NO P70S6K SIRT1 inos MnSOD aldose reductase ROS MPTP PKC MPTP GSK3β mitochondrium nucleus K ATP mitochondrium Cx43 mitochondrium : age-dependent : species-dependent Heusch, Boengler, Schulz, Circulation 118: , 2008; Boengler, Schulz, Heusch, Cardiovasc Res 2009

22 Heinzel et al., Circ Res 97: , 2005 Connexin 43 (Cx43), ROS and ischemic preconditioning Knockout mice MTR fluorescence [% above control] Infarct size (% area at risk) WT Cx43 +/ 60% 60 50% 40% 30% 20% 10% p< * * 0% WT Cx43 +/ Cx43 +/ Diazoxide Menadione 10 0 PLA Diaz PLA Diaz Mena

23 Rat heart in vitro Mitochondrial uncoupling, ROS and IRI Yue et al., Am J Physiol 281: H590-H595, 2001 Minners et al., Cardiovasc Res 47: 68-73, 2000

24 ROS scavenging and ischemic preconditioning 35 Infarct size [% area at risk] P< Placebo IP10 Ascorbic acid IP10 + Ascorbic acid

25 Ovize et al, Cardiovasc Res 87: , 2010 Ischemic Postconditioning: Signal transduction MKP-1

26 Tsutsumi et al., Life Sci 81: , 2007 Mice ROS scavenging and ischemic postconditioning

27 ROS during IRI and protection from it contribute to cellular damage contribute to cellular protection Function Morphology Function Morphology (Postischemic Reperfusion, Heart Failure) (Ischemia/Reperfusion Injury)

Ischemia and Reperfusion: Pharmacological treatment options

Ischemia and Reperfusion: Pharmacological treatment options Physiologisches Institut Ischemia and Reperfusion: Pharmacological treatment options Prof. Dr. Rainer Schulz Plaque rupture and myocardial ischemia Acute plaque rupture (Stary VI) Ischemic myocardium (ACS,

More information

Cardioprotezione ed invecchiamento

Cardioprotezione ed invecchiamento 55 Congresso SIGG Invecchiamento e longevità: più geni o più ambiente? Firenze, 30/11/2010-04/12/2010 Palazzo dei Congressi SESSIONE DI BIOGERONTOLOGIA Cardioprotezione ed invecchiamento P. Abete, MD,

More information

Reperfusion Injury: How Can We Reduce It?

Reperfusion Injury: How Can We Reduce It? MI/CAD: Practical Question in Management of AMI Patients Reperfusion Injury: How Can We Reduce It? Hyun-Jai Cho, M.D., Ph.D Cardiovascular Center & Department of Internal Medicine Seoul National University

More information

Nox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload

Nox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload Nox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload Giovanna Frazziano, PhD Vascular Medicine Institute Department of Pharmacology and Chemical Biology University of Pittsburgh

More information

Ameliorating Reperfusion Injury During Resuscitation from Cardiac Arrest

Ameliorating Reperfusion Injury During Resuscitation from Cardiac Arrest Ameliorating Reperfusion Injury During Resuscitation from Cardiac Arrest Scott T. Youngquist, MD, MSc Associate Professor, Emergency Medicine University of Utah School of Medicine Medical Director, Salt

More information

Intolerance in Heart Failure

Intolerance in Heart Failure Novel Targets to Attack Exercise Intolerance in Heart Failure - Skeletal Muscle - Volker Adams, PhD ESC, Paris 3. Aug. 211 UNIVERSITÄT LEIPZIG H E R Z Z E N T R U M Nothing to disclose Myers et al. NEJM

More information

Reperfusion injury in STEMI. Therapeutic opportunities David Garcia-Dorado. Barcelona. Spain

Reperfusion injury in STEMI. Therapeutic opportunities David Garcia-Dorado. Barcelona. Spain Reperfusion injury in STEMI. Therapeutic opportunities David Garcia-Dorado. Barcelona. Spain 1. The problem 2. Reperfusion injury after acute coronary occlusion 3. Ischemic conditioning 4. Pharmacological

More information

Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury

Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury K. Ran 1, D.-L. Yang 1, Y.-T. Chang 1, K.-M. Duan 2, Y.-W. Ou 2, H.-P. Wang 3 and Z.-J. Li 1 1 Department of Anesthesiology,

More information

Sean Davidson. The Hatter Cardiovascular Institute University College London, UK

Sean Davidson. The Hatter Cardiovascular Institute University College London, UK Key pathways to ischemia-reperfusion injury Sean Davidson The Hatter Cardiovascular Institute University College London, UK Outline What is ischaemia-reperfusion injury? What causes ischaemia-reperfusion

More information

Prevention of reperfusion injury in STEMI - Contra

Prevention of reperfusion injury in STEMI - Contra Prevention of reperfusion injury in STEMI - Contra Prof David Erlinge, MD, PhD Lund University, Skane University Hospital, Lund Sweden Disclosure statement: Received speakers fees from the Medicines company,

More information

There are numerous reviews on the signal transduction of

There are numerous reviews on the signal transduction of Review Molecular Basis of Cardioprotection Signal Transduction in Ischemic Pre-, Post-, and Remote Conditioning Gerd Heusch Abstract: Reperfusion is mandatory to salvage ischemic myocardium from infarction,

More information

The role of cardiac mitochondria in myocardial ischemia/reperfusion injury. Chad R. Frasier. April, 2012

The role of cardiac mitochondria in myocardial ischemia/reperfusion injury. Chad R. Frasier. April, 2012 The role of cardiac mitochondria in myocardial ischemia/reperfusion injury by Chad R. Frasier April, 2012 Director of Dissertation: David A. Brown Department of Physiology Cardiovascular disease (CVD)

More information

REMOTE ISCHEMIC PRECONDITIONING PROTECTS AGAINST ISCHEMIC REPERFUSION INJURY DURING HEART TRANSPLANTATION

REMOTE ISCHEMIC PRECONDITIONING PROTECTS AGAINST ISCHEMIC REPERFUSION INJURY DURING HEART TRANSPLANTATION REMOTE ISCHEMIC PRECONDITIONING PROTECTS AGAINST ISCHEMIC REPERFUSION INJURY DURING HEART TRANSPLANTATION Mohamed S. A. Mohamed, MBBCh, MSc, MD. Thoracic Transplantation Department, University Clinic Essen,

More information

Exercise Intolerance in Heart Failure: Significance of Skeletal Muscle Abnormalities

Exercise Intolerance in Heart Failure: Significance of Skeletal Muscle Abnormalities Exercise Intolerance in Heart Failure: Significance of Skeletal Muscle Abnormalities Hokkaido University Graduate School of Medicine Shintaro Kinugawa Survival rate (%) Peak oxygen uptake and prognosis

More information

Cardioprotection by Ischemic Postconditioning Is Lost in Aged and STAT3-Deficient Mice

Cardioprotection by Ischemic Postconditioning Is Lost in Aged and STAT3-Deficient Mice Cardioprotection by Ischemic Postconditioning Is Lost in Aged and -Deficient Mice Kerstin Boengler, Astrid Buechert, Yvonne Heinen, Christin Roeskes, Denise Hilfiker-Kleiner, Gerd Heusch, Rainer Schulz

More information

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR.

Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA

More information

Chronic protection against ischemia and reperfusion injury during therapy with different organic nitrates

Chronic protection against ischemia and reperfusion injury during therapy with different organic nitrates UNIVERSITA DEGLI STUDI DI SIENA Doctorate in Biomedicine and Immunological Science Clinical Pharmacology section Chronic protection against ischemia and reperfusion injury during therapy with different

More information

Role of oxidative Stress in Cerebral Ischemia-reperfusion Injury

Role of oxidative Stress in Cerebral Ischemia-reperfusion Injury Role of oxidative Stress in Cerebral Ischemia-reperfusion Injury Evidences obtained from the past two decades showed that there is an involvement of reactive oxygen species in cerebral ischemia (Christophe

More information

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.

c Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p. a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8

More information

Angiotensin-converting enzyme inhibitors potentiate subthreshold preconditioning through NO and mitok ATP. channel

Angiotensin-converting enzyme inhibitors potentiate subthreshold preconditioning through NO and mitok ATP. channel Acta Physiologica Sinica, August 25, 2005, 57 (4): 453-460 http://www.actaps.com.cn 453 ATP 1 1 1 2 2 2,* 1 313000 2 310006 Langendorff ( ) ( ) (angiotensin-converting enzyme inhibitors, ACEI) (nitric

More information

PCTH 400. Endothelial dysfunction and cardiovascular diseases. Blood vessel LAST LECTURE. Endothelium. High blood pressure

PCTH 400. Endothelial dysfunction and cardiovascular diseases. Blood vessel LAST LECTURE. Endothelium. High blood pressure PCTH 400 LAST LECTURE Endothelial dysfunction and cardiovascular diseases. Classic Vascular pharmacology -chronic -systemic Local Vascular pharmacology -acute -targeted High blood pressure Blood pressure

More information

Interaction of Cardiovascular Risk Factors with Myocardial Ischemia/Reperfusion Injury, Preconditioning, and Postconditioning

Interaction of Cardiovascular Risk Factors with Myocardial Ischemia/Reperfusion Injury, Preconditioning, and Postconditioning 0031-6997/07/5904-418 458$20.00 PHARMACOLOGICAL REVIEWS Vol. 59, No. 4 Copyright 2007 by The American Society for Pharmacology and Experimental Therapeutics 6002/3284440 Pharmacol Rev 59:418 458, 2007

More information

Remote Ischemic Preconditioning: Current aspects of mechanisms. Hans Erik Bøtker, Aarhus University Hospital, Skejby, Denmark,

Remote Ischemic Preconditioning: Current aspects of mechanisms. Hans Erik Bøtker, Aarhus University Hospital, Skejby, Denmark, Remote Ischemic Preconditioning: Current aspects of mechanisms Hans Erik Bøtker, Aarhus University Hospital, Skejby, Denmark, Mechanisms Dialysate as a bioassay for riperc Shimizu et al. Clin Sci 2009;117:191-200

More information

Effects of hyperlipidemia and statins on cardioprotective signaling

Effects of hyperlipidemia and statins on cardioprotective signaling Effects of hyperlipidemia and statins on cardioprotective signaling HFA-ISHR 212 Belgrade Péter Ferdinandy Cardiovascular Research Group, University of Szeged and Semmelweis University, Budapest; Pharmahungary

More information

Cell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction. Rita Alonaizan

Cell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction. Rita Alonaizan Cell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction Rita Alonaizan Department of Physiology, Anatomy & Genetics St Catherine s College Supervisor:

More information

Nuovi target e opportunità terapeutiche del danno da riperfusione nello STEMI

Nuovi target e opportunità terapeutiche del danno da riperfusione nello STEMI GUIDATI DA PARADIGMI SEMPRE NUOVI, GLI SCIENZIATI ADOTTANO NUOVI STRUMENTI E PROGETTANO NUOVI STUDI GUARDANDO VERSO NUOVE DIREZIONI Nuovi target e opportunità terapeutiche del danno da riperfusione nello

More information

Adjunctive Therapy to Reduce Infarct Size: Current and Future Challenges

Adjunctive Therapy to Reduce Infarct Size: Current and Future Challenges Adjunctive Therapy to Reduce Infarct Size: Current and Future Challenges Chang-Hwan Yoon, M.D. Cardiovascular Center, Department of Internal Medicine Bundang Hospital 1 1. 빨리뚫어야한다 2013 ACC/AHA STEMI Guideline

More information

Reperfusion Injury, Cardioprotection, and 2 Decades of Failed Studies

Reperfusion Injury, Cardioprotection, and 2 Decades of Failed Studies Reperfusion Injury, Cardioprotection, and 2 Decades of Failed Studies The Dark Side of Reperfusion 2014 MFMER 3327355-7 Reduction of Infarct Size in the Experimental Animal What can be achieved? No reperfusion

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our

More information

Μηχανισµός της απώλειας της καρδιοπροστατευτικής δράσης της µετισχαιµικής προστασίας (postconditioning) στην αθηρωµάτωση Iωάννα Ανδρεάδου

Μηχανισµός της απώλειας της καρδιοπροστατευτικής δράσης της µετισχαιµικής προστασίας (postconditioning) στην αθηρωµάτωση Iωάννα Ανδρεάδου Μηχανισµός της απώλειας της καρδιοπροστατευτικής δράσης της µετισχαιµικής προστασίας (postconditioning) στην αθηρωµάτωση Iωάννα Ανδρεάδου School of Pharmacy, University of Athens, Greece Definitions Preconditioning:

More information

Biomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in treatment Professor Grace George

Biomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in treatment Professor Grace George Division of Medical Biochemistry, Department of Human Biology, Faculty of Health Sciences, Mthatha, South Africa Biomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in

More information

Myocardial ischaemia reperfusion injury: the challenge of translating ischaemic and anaesthetic protection from animal models to humans

Myocardial ischaemia reperfusion injury: the challenge of translating ischaemic and anaesthetic protection from animal models to humans British Journal of Anaesthesia, 117 (S2): ii44 ii62 (2016) doi: 10.1093/bja/aew267 Review Article Myocardial ischaemia reperfusion injury: the challenge of translating ischaemic and anaesthetic protection

More information

Novel Necrosis Inhibitor to prevent. Myocardial Ischemia-Reperfusion Injury

Novel Necrosis Inhibitor to prevent. Myocardial Ischemia-Reperfusion Injury Novel Necrosis Inhibitor to prevent Myocardial Ischemia-Reperfusion Injury Hyo-Soo Kim, MD/PhD/FAHA Cardiovascular Center & Department of Internal Medicine, Seoul National University Hospital INTRODUCTION

More information

Lujain Hamdan. Faisal Nimri

Lujain Hamdan. Faisal Nimri 20 Lujain Hamdan Faisal Nimri...... Sources of NADPH [ The pentose phosphate pathway is the primary source of the NADPH and is the only source in RBC.] Cytosolic conversion of oxaloacetate to pyruvate

More information

BIOCHEMICHISTRY OF EYE TISSUE. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI

BIOCHEMICHISTRY OF EYE TISSUE. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI BIOCHEMICHISTRY OF EYE TISSUE Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI 1 METABOLIC PATHWAYS IN EYE TISSUE Glycolysis ( aerobic & anaerobic) HMP shunt Poliol pathway TCA cycle

More information

Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University

Novel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University Novel function of NADPH oxidase in atherosclerosis Yun Soo Bae Department of Life Science Ewha Womans University Recent understanding of ROS: act as second messengers e e Catalase/peroxidase O 2 H 2 O

More information

Cancer therapy, cardiovascular toxicity and hypertension

Cancer therapy, cardiovascular toxicity and hypertension Cancer therapy, cardiovascular toxicity and hypertension Rhian M Touyz MBBCh, PhD Disclosures: None Capri Cardiovascular Conference 2.0, Capri 15-16 April 2016 Vascular phenotype in hypertension Normotensive

More information

Cardiovascular Topics

Cardiovascular Topics CARDIOVASCULAR JOURNAL OF SOUTH AFRICA Vol 17, No. 5, September/October 2006 239 Cardiovascular Topics Melatonin prevents cardioprotection induced by a multi-cycle ischaemic preconditioning protocol in

More information

Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa

Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa Survival rate (%) Peak oxygen uptake and prognosis in patients with heart failure (HF) 1

More information

Mitochondrial ROS in the pro-hypertensive immune response. Rafal R. Nazarewicz and Sergey I. Dikalov

Mitochondrial ROS in the pro-hypertensive immune response. Rafal R. Nazarewicz and Sergey I. Dikalov Articles in PresS. Am J Physiol Regul Integr Comp Physiol (May 8, 2013). doi:10.1152/ajpregu.00208.2013 Mitochondrial ROS in the pro-hypertensive immune response Rafal R. Nazarewicz and Sergey I. Dikalov

More information

E and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, ) Jolly, S. R., Kane, W. J., Bailie, M. B. et al.

E and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, ) Jolly, S. R., Kane, W. J., Bailie, M. B. et al. 1) Ferrari, R., Visoli, O., Guarnieri, C. et al.: Vitamin E and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, 1983. 2) Jolly, S. R., Kane, W. J., Bailie, M. B. et al.: Canine

More information

Philadelphia College of Osteopathic Medicine Annual Progress Report: 2011 Formula Grant

Philadelphia College of Osteopathic Medicine Annual Progress Report: 2011 Formula Grant Philadelphia College of Osteopathic Medicine Annual Progress Report: 2011 Formula Grant Reporting Period January 1, 2012 June 30, 2012 Formula Grant Overview The Philadelphia College of Osteopathic Medicine

More information

Biological Chemistry of Hydrogen Peroxide

Biological Chemistry of Hydrogen Peroxide Biological Chemistry of Hydrogen Peroxide Christine Winterbourn Department of Pathology University of Otago, Christchurch New Zealand Hydrogen Peroxide Intermediate in reduction of oxygen to water A major

More information

Cardioprotection by endogenous fibroblast growth factor 2 in cardiac ischemia-reperfusion injury in vivo

Cardioprotection by endogenous fibroblast growth factor 2 in cardiac ischemia-reperfusion injury in vivo Washington University School of Medicine Digital Commons@Becker Conference Abstracts and Posters Division of Emergency Medicine/Emergency Care Research Section 2011 Cardioprotection by endogenous fibroblast

More information

Evaluation of Resveratrol and Tocotrienols as potential REDOX active compounds for Cardioprotection

Evaluation of Resveratrol and Tocotrienols as potential REDOX active compounds for Cardioprotection Evaluation of Resveratrol and Tocotrienols as potential REDOX active compounds for Cardioprotection Dissertation for the Doctor of Philosophy Degree Written by: Samarjit Das 2006 Department of Pharmacology

More information

Chapter 14. Energy conversion: Energy & Behavior

Chapter 14. Energy conversion: Energy & Behavior Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making

More information

S. Lemoine 1, *, L. Tritapepe 2, J. L. Hanouz 1 and P. E. Puddu 2. Abstract REVIEW ARTICLES

S. Lemoine 1, *, L. Tritapepe 2, J. L. Hanouz 1 and P. E. Puddu 2. Abstract REVIEW ARTICLES British Journal of Anaesthesia, 116 (4): 456 75 (2016) doi: 10.1093/bja/aev451 Advance Access Publication Date: 20 January 2016 Review Articles REVIEW ARTICLES The mechanisms of cardio-protective effects

More information

Adenosine stimulates the recruitment of endothelial progenitor cells to the ischemic heart

Adenosine stimulates the recruitment of endothelial progenitor cells to the ischemic heart Adenosine stimulates the recruitment of endothelial progenitor cells to the ischemic heart Involvement of the microrna-150-cxcr4-sdf-1α pathway Emeline Goretti, MSc No conflict of interest Endothelial

More information

Mol Biotechnol Sep;37(1):31-7. Bioenergetic and antioxidant properties of coenzyme Q10: recent developments. Littarru GP, Tiano L.

Mol Biotechnol Sep;37(1):31-7. Bioenergetic and antioxidant properties of coenzyme Q10: recent developments. Littarru GP, Tiano L. Mol Biotechnol. 2007 Sep;37(1):31-7. Bioenergetic and antioxidant properties of coenzyme Q10: recent developments. Littarru GP, Tiano L. Source : Institute of Biochemistry, Polytechnic University of the

More information

TSP1 Secr Sec eted eted b m byy m n a y n y ce c ll cee s Upregulated by injury/stress W dely expressed CD47 S TSP1 only known ligand

TSP1 Secr Sec eted eted b m byy m n a y n y ce c ll cee s Upregulated by injury/stress W dely expressed CD47 S TSP1 only known ligand Parenchymal CD47 Promotes Renal IRI via Multiple Mechanisms Jeffrey S. Isenberg, MD, MPH Division of Pulmonary, Allergy and Critical Care Medicine Vascular Medicine Institute University of Pittsburgh School

More information

Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences

Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine

More information

SUBJECT INDEX. References to Figures and Tables are in italics

SUBJECT INDEX. References to Figures and Tables are in italics SUBJECT INDEX References to Figures and Tables are in italics aconitase EPR spectra of, Fig.14.1 inhibition by NO, 242 adenosine metabolism in influenza-infected mice, 283 adhesion molecules engagement

More information

Forum Minireview. Tetsuji Miura 1, *, Masahiro Nishihara 1, and Takayuki Miki 1

Forum Minireview. Tetsuji Miura 1, *, Masahiro Nishihara 1, and Takayuki Miki 1 J Pharmacol Sci 109, 162 167 (2009)2 Journal of Pharmacological Sciences 2009 The Japanese Pharmacological Society Forum Minireview Drug Development Targeting the Glycogen Synthase Kinase-3β (GSK-3β)-

More information

EXPERIMENTAL AND THERAPEUTIC MEDICINE 8: , 2014

EXPERIMENTAL AND THERAPEUTIC MEDICINE 8: , 2014 EXPERIMENTAL AND THERAPEUTIC MEDICINE 8: 973-977, 2014 Pharmacological postconditioning with tanshinone IIA attenuates myocardial ischemia reperfusion injury in rats by activating the phosphatidylinositol

More information

Ozone in Complementary Medicine Possible Mechanism of Ozone in Rheumatic and Inflammatory Diseases

Ozone in Complementary Medicine Possible Mechanism of Ozone in Rheumatic and Inflammatory Diseases Ozone in Complementary Medicine Possible Mechanism of Ozone in Rheumatic and Inflammatory Diseases 10.11.2004 OZONOSAN 1 Mechanism of Action in Rheumatic Pain Syndroms Acute stage: Activation of cell metabolism,

More information

Effect of classic preconditioning and diazoxide on endothelial function and O 2 and NO generation in the post-ischemic guinea-pig heart

Effect of classic preconditioning and diazoxide on endothelial function and O 2 and NO generation in the post-ischemic guinea-pig heart Cardiovascular Research 63 (2004) 118 129 www.elsevier.com/locate/cardiores Effect of classic preconditioning and diazoxide on endothelial function and O 2 and NO generation in the post-ischemic guinea-pig

More information

Endogenous Opioids and Exercise Induced Cardioprotection. Lindsey Erin Miller

Endogenous Opioids and Exercise Induced Cardioprotection. Lindsey Erin Miller Endogenous Opioids and Exercise Induced Cardioprotection by Lindsey Erin Miller A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the

More information

Effets Vasculaires des Flavonoïdes Alimentaires et leurs Mécanismes

Effets Vasculaires des Flavonoïdes Alimentaires et leurs Mécanismes Académie Nationale de Pharmacie Mercredi 27 janvier 21 Faculté de Pharmacie de Paris Effets Vasculaires des Flavonoïdes Alimentaires et leurs Mécanismes V.B. Schini-Kerth CNRS UMR 7213 Équipe Pharmacologie

More information

Assoc. Prof. Dr. Aslı Korkmaz* and Prof. Dr. Dürdane Kolankaya**

Assoc. Prof. Dr. Aslı Korkmaz* and Prof. Dr. Dürdane Kolankaya** The possible protective effects of some flavonoids that found honey by experimental ischemia/reperfusion (I/R) induced nitrosative damage in kidney of male rats Assoc. Prof. Dr. Aslı Korkmaz* and Prof.

More information

Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease

Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and

More information

, L2Arg NO. (ischemia reperfusion injury, IRI) (L2arginine/ nitric oxide, L2Arg/ NO) IRI g Wistar,, g/ kg) ip, Acta Physiologica Si nica

, L2Arg NO. (ischemia reperfusion injury, IRI) (L2arginine/ nitric oxide, L2Arg/ NO) IRI g Wistar,, g/ kg) ip, Acta Physiologica Si nica , 1999 2, 51 (1), 25 30 25 Acta Physiologica Si nica L2Arg/ NO 1997212227 1998203230 3 3 (, 524023 ; 3, 100083) ( IRI) (NO), 15 min, 45 min, 30 ml KH 15 min, (LDH) NO2 - NOS L2 (L2Arg), IRI LDH 411, 514

More information

Tissue reperfusion after ischemia, although ultimately

Tissue reperfusion after ischemia, although ultimately Review Role of Glycogen Synthase Kinase-3 in Cardioprotection Magdalena Juhaszova, Dmitry B. Zorov, Yael Yaniv, H. Bradley Nuss, Su Wang, Steven J. Sollott Abstract Limitation of infarct size by ischemic/pharmacological

More information

The Role of Neuronal Nitric Oxide Synthase (nnos) in Ischaemia/Reoxygenation-induced injury and in protection of the Mammalian Myocardium

The Role of Neuronal Nitric Oxide Synthase (nnos) in Ischaemia/Reoxygenation-induced injury and in protection of the Mammalian Myocardium The Role of Neuronal Nitric Oxide Synthase (nnos) in Ischaemia/Reoxygenation-induced injury and in protection of the Mammalian Myocardium Miss Anupama Barua MBBS, MRCSEd A thesis submitted to the University

More information

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors

We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our

More information

University of Milan spin-off founded in 2004 and now fully owned by Genextra S.p.A.

University of Milan spin-off founded in 2004 and now fully owned by Genextra S.p.A. Mitochondrial Platform Targeting the Permebility Transition Pore Company Overview University of Milan spin-off founded in 2004 and now fully owned by Genextra SpA Focused on identifying and advancing novel

More information

CPR flow to prime the ischemic heart during cardiac arrest?

CPR flow to prime the ischemic heart during cardiac arrest? CPR flow to prime the ischemic heart during cardiac arrest? BY MARK G ANGELOS, MAHMOOD KHAN Abstract Cardiac arrest is unique among cardiac ischemic syndromes in that all circulation must be generated

More information

Ischemic Heart Failure

Ischemic Heart Failure 15 th Cardiology Congress of Northern Greece Thessaloniki, May 26-28, 2016 Ischemic Heart Failure Filippos Triposkiadis, MD, FESC, FACC Professor of Cardiology Director, Department of Cardiology Larissa

More information

Lack of the Effect of Superoxide Dismutase and Catalase on Na +,K + -ATPase Activity in Stunned Rabbit Hearts

Lack of the Effect of Superoxide Dismutase and Catalase on Na +,K + -ATPase Activity in Stunned Rabbit Hearts Physiol. Res. 57 (Suppl. 2): S61-S66, 2008 Lack of the Effect of Superoxide Dismutase and Catalase on Na +,K + -ATPase Activity in Stunned Rabbit Hearts P. KAPLÁN 1,2, M. MATEJOVIČOVÁ 1,2, P. HERIJGERS

More information

Effect of mitochondrial ATP-sensitive potassium channel opening on the translocation of protein kinase C epsilon in adult rat ventricular myocytes

Effect of mitochondrial ATP-sensitive potassium channel opening on the translocation of protein kinase C epsilon in adult rat ventricular myocytes Effect of mitochondrial ATP-sensitive potassium channel opening on the translocation of protein kinase C epsilon in adult rat ventricular myocytes H. Li, T. Yang, Z. Long and J. Cheng Department of Anesthesiology,

More information

Lung ischemia reperfusion injury: the therapeutic role of dipeptidyl peptidase 4 inhibition

Lung ischemia reperfusion injury: the therapeutic role of dipeptidyl peptidase 4 inhibition Review Article on Acute Lung Injury Page 1 of 7 Lung ischemia reperfusion injury: the therapeutic role of dipeptidyl peptidase 4 inhibition Paul A. J. Beckers 1, Jan F. Gielis 1, Paul E. Van Schil 1, Dirk

More information

Lecture 19 Summary Gestational Diabetes and Complications of Diabetes. Gestational diabetes;

Lecture 19 Summary Gestational Diabetes and Complications of Diabetes. Gestational diabetes; Lecture 19 Summary Gestational Diabetes and Complications of Diabetes Gestational diabetes; - Type of diabetes that only develops during pregnancy Usually diagnosed in late pregnancy Causes high blood

More information

Advances in ischemia and reperfusion injury: effects on liver microcirculation and therapeutic strategies for sinusoidal protection

Advances in ischemia and reperfusion injury: effects on liver microcirculation and therapeutic strategies for sinusoidal protection Advances in ischemia and reperfusion injury: effects on liver microcirculation and therapeutic strategies for sinusoidal protection Diana Hide Alférez Aquesta tesi doctoral està subjecta a la llicència

More information

ROS as targets for therapeutic intervention of diabetic nephropathy

ROS as targets for therapeutic intervention of diabetic nephropathy 36 th Autumn Congress of Korean Diabetes Association September 16-17, 2010, BEXCO, Busan, Korea ROS as targets for therapeutic intervention of diabetic nephropathy Hunjoo Ha Department of Bioinspired Science

More information

Interleukin-6 and Exercise-Induced Cardioprotection. Graham Ripley McGinnis

Interleukin-6 and Exercise-Induced Cardioprotection. Graham Ripley McGinnis Interleukin-6 and Exercise-Induced Cardioprotection by Graham Ripley McGinnis A dissertation submitted to the Graduate Faculty of Auburn University In partial fulfillment of the Requirements for the Degree

More information

Basic Mechanisms of Remote Ischemic Conditioning

Basic Mechanisms of Remote Ischemic Conditioning Basic Mechanisms of Remote Ischemic Conditioning Rajesh K Kharbanda Oxford, GB ESC 2012. From Bench to Practice: Bridging the gap Mechanisms and Clinical use of Ischaemic Conditioning Disclosure Shareholder

More information

This Review is part of a thematic series on the Role of Mitochondria in Cardiovascular Diseases, which includes the following articles:

This Review is part of a thematic series on the Role of Mitochondria in Cardiovascular Diseases, which includes the following articles: This Review is part of a thematic series on the Role of Mitochondria in Cardiovascular Diseases, which includes the following articles: Free Radicals, Mitochondria, and Oxidized Lipids: The Emerging Role

More information

Acetylcholine and bradykinin trigger preconditioning in the heart through a pathway that includes Akt and NOS

Acetylcholine and bradykinin trigger preconditioning in the heart through a pathway that includes Akt and NOS Am J Physiol Heart Circ Physiol 287: H2606 H2611, 2004. First published August 26, 2004; doi:10.1152/ajpheart.00600.2004. Acetylcholine and bradykinin trigger preconditioning in the heart through a pathway

More information

H 2 S: Synthesis and functions

H 2 S: Synthesis and functions H 2 S: Synthesis and functions 1 Signaling gas molecules: O 2, NO and CO Then, H 2 S - Fourth singling gas molecule after O 2, NO and CO 2 Nothing Rotten About Hydrogen Sulfide s Medical Promise Science

More information

Trans-plasma membrane electron transport in muscle cells. Shannon Kelly

Trans-plasma membrane electron transport in muscle cells. Shannon Kelly Trans-plasma membrane electron transport in muscle cells Shannon Kelly Introduction Trans-plasma membrane electron transport (tpmet) Shuttle-based electron transfer Enzyme-mediated electron transfer Intracellular

More information

Antioxidant Enzymes. - Superoxide dismutases (SODs) - Catalases - Peroxiredoxins - Glutathione peroxidases

Antioxidant Enzymes. - Superoxide dismutases (SODs) - Catalases - Peroxiredoxins - Glutathione peroxidases Antioxidant Enzymes - Superoxide dismutases (SODs) - Catalases - Peroxiredoxins - Glutathione peroxidases Eva Maria Steiner, Samantha Swenson, Mattias Günther and Xiaoxiao Peng 1 Eva Maria Steiner June

More information

This student paper was written as an assignment in the graduate course

This student paper was written as an assignment in the graduate course 77:222 Spring 2003 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2003) offered

More information

,, - [5, 11]., -, (NO)., NO,,. NO NO- (NOS). (nnos NOS1) (enos NOS3) NO-,, 2+- NO- (inos NOS2),,,,, [5]., NOS (nnos enos), inos. inos - ( ),, ( ),. NO

,, - [5, 11]., -, (NO)., NO,,. NO NO- (NOS). (nnos NOS1) (enos NOS3) NO-,, 2+- NO- (inos NOS2),,,,, [5]., NOS (nnos enos), inos. inos - ( ),, ( ),. NO , 70,9 ± 1,3% 58,0±0,86%. 3... 1.. /..,.. // today. 2004. 1-2.. 30-31. 2.. /.,..,.. //-.: -, -2006. - 240. 3... /.., C. B.,.. [.] //. -2008. - 5.-C.33-36. 4..., - /..,.. // - 2007. - 1. -. 38-41. 5...

More information

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update

NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed

More information

AperTO - Archivio Istituzionale Open Access dell'università di Torino

AperTO - Archivio Istituzionale Open Access dell'università di Torino AperTO - Archivio Istituzionale Open Access dell'università di Torino From the nucleus to the mitochondria and backthe odyssey of a multitask STAT3 This is the author's manuscript Original Citation: From

More information

Stroke, the most common medical emergency, is a

Stroke, the most common medical emergency, is a Report on Progress 2016 Advances in Our Knowledge of Stroke Mechanisms and Therapy Xuefang Ren, M.D., and James W. Simpkins Ph. D Department of Physiology and Pharmacology, Experimental Stroke Core, Center

More information

Review Article Molecular Characterization of Reactive Oxygen Species in Myocardial Ischemia-Reperfusion Injury

Review Article Molecular Characterization of Reactive Oxygen Species in Myocardial Ischemia-Reperfusion Injury BioMed Research International Volume 2015, Article ID 864946, 9 pages http://dx.doi.org/10.1155/2015/864946 Review Article Molecular Characterization of Reactive Oxygen Species in Myocardial Ischemia-Reperfusion

More information

ARF ARF. NOx. NOS nmol NOx formed/30 min/kidney Wet Weight; ± ± 1.81 ARF. acute renal failure: ARF

ARF ARF. NOx. NOS nmol NOx formed/30 min/kidney Wet Weight; ± ± 1.81 ARF. acute renal failure: ARF Vol. 29, pp.673 ~ 679, 2001 13 12 20 ARF 50% ARF ARF ARF ARF NO ARF NO NOS NO NO2 /NO3 NOx Griess NO NOx 1 72 7 NOx NOS 1 7 NOx µmol/kidney Wet Weight; Sham 0.116 ± 0.005 0.168 ± 0.006 24 0.185 ± 0.004

More information

Reactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh

Reactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh Reactive Oxygen species ROS + Anti-oxidants Dr. Naif Karadsheh Oxygen Toxicity & Free Radicals Biradical O 2 Radical O 2 Non-Radical Radical H 2 O 2 OH ROS O 2 Metabolism and Toxicity O 2 Consumption >90%

More information

Ischemic preconditioning is cardioprotective 1 and depends

Ischemic preconditioning is cardioprotective 1 and depends The ph Hypothesis of Postconditioning Staccato Reperfusion Reintroduces Oxygen and Perpetuates Myocardial Acidosis Michael V. Cohen, MD; Xi-Ming Yang, MD, PhD; James M. Downey, PhD Background It is unclear

More information

Original Article Change of mitochondrial function in the early stage after cardiac ischemia-reperfusion injury in mice

Original Article Change of mitochondrial function in the early stage after cardiac ischemia-reperfusion injury in mice Int J Clin Exp Med 2016;9(2):2549-2554 www.ijcem.com /ISSN:1940-5901/IJCEM0015306 Original Article Change of mitochondrial function in the early stage after cardiac ischemia-reperfusion injury in mice

More information

Melatonin improves vascular reactivity of endotoxemia rats

Melatonin improves vascular reactivity of endotoxemia rats Acta Physiologica Sinica, June 25, 2005, 57 (3): 367-372 http://www.actaps.com.cn 367, *,,,, 050017 (melatonin, MT) (lipopolysaccharide LPS) LPS LPS+MT MT (phenylephrine PE) (acetylcholine ACh) (malondialhyde

More information

Anti-diabetic effects of seaweeds: potential mechanisms. By: Z. Janahmadi

Anti-diabetic effects of seaweeds: potential mechanisms. By: Z. Janahmadi Anti-diabetic effects of seaweeds: potential mechanisms By: Z. Janahmadi Presentation outline Diabetes mellitus Marine algae *Unsaturated fatty acids *Dietary Fibers *α-glucosidase inhibitors *Glucose

More information

TNF- Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury

TNF- Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury TNF- Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury Cuihua Zhang, Xiangbin Xu, Barry J. Potter, Wei Wang, Lih Kuo, Lloyd Michael, Gregory J. Bagby, William M. Chilian Background

More information

New Drug Development for Hepatic Insulin Resistance

New Drug Development for Hepatic Insulin Resistance New Drug Development for Hepatic Insulin Resistance Innovative Drug Research Center for Metabolic and Inflammatory Disease College of Pharmacy Sang Geon Kim AMPK as an energy sensor, (A novel drug target

More information

Cardioprotective Effect of High Intensity Interval Training and Nitric Oxide Metabolites (NO 2 -, NO 3 - )

Cardioprotective Effect of High Intensity Interval Training and Nitric Oxide Metabolites (NO 2 -, NO 3 - ) Original Article Cardioprotective Effect of High Intensity Interval Training and Nitric Oxide Metabolites (NO 2 -, NO 3 - ) *Aliasghar FALLAHI 1, 2, Abbasali GAEINI 3, Shahnaz SHEKARFROUSH 4, Ali KHOSHBATEN

More information

Myocardial infarction continues to be a major cause of

Myocardial infarction continues to be a major cause of Integrative Physiology Mitochondrial STAT3 Activation and Cardioprotection by Ischemic Postconditioning in Pigs With Regional Myocardial Ischemia/Reperfusion Gerd Heusch, Judith Musiolik, Nilguen Gedik,

More information

EFFECTS OF HEME-L-ARGINATE ON L-NAME INDUCED HYPERTENSION. A Thesis Submitted to. The College of Graduate Studies & Research

EFFECTS OF HEME-L-ARGINATE ON L-NAME INDUCED HYPERTENSION. A Thesis Submitted to. The College of Graduate Studies & Research EFFECTS OF HEME-L-ARGINATE ON L-NAME INDUCED HYPERTENSION A Thesis Submitted to The College of Graduate Studies & Research In Partial Fulfillment of the Requirements For the Degree of Master of Science

More information

PETER L. LUTZ. Red-eared slider Trachemys scripta elegans

PETER L. LUTZ.   Red-eared slider Trachemys scripta elegans www.carleton.ca/~kbstorey PETER L. LUTZ Red-eared slider Trachemys scripta elegans Lutz PL, Storey KB. 1997. Handbook of Physiology (Dantzler WH, ed) Oxford Univ. Press, Vol. 2, pp. 1479-1522. 1 Relative

More information

Review Article The Coronary Microcirculation in Health and Disease

Review Article The Coronary Microcirculation in Health and Disease ISRN Physiology Volume 2013, Article ID 238979, 24 pages http://dx.doi.org/10.1155/2013/238979 Review Article The Coronary Microcirculation in Health and Disease Judy M. Muller-Delp Department of Physiology

More information

Ischemic Postconditioning During Primary Percutaneous Coronary Intervention Mechanisms and Clinical Application Jian Liu, MD FACC FESC FSCAI Chief Phy

Ischemic Postconditioning During Primary Percutaneous Coronary Intervention Mechanisms and Clinical Application Jian Liu, MD FACC FESC FSCAI Chief Phy Ischemic Postconditioning During Primary Percutaneous Coronary Intervention Mechanisms and Clinical Application Jian Liu, MD FACC FESC FSCAI Chief Physician, Professor of Medicine Department of Cardiology,

More information