Reactive oxygen species: Importance for ischemia/reperfusion (injury)
|
|
- Howard Wilcox
- 5 years ago
- Views:
Transcription
1 Physiologisches Institut Reactive oxygen species: Importance for ischemia/reperfusion (injury) Prof. Dr. Rainer Schulz
2 Reactive oxygen species (ROS) in ischemia/reperfusion injury (IRI) ROS GOOD: Endogenous protection BAD: Infarction ROS
3 Potential sources of ROS Cardiomyocytes Other cell types p66 SOD2 Mitochondria CAT SOD1 Giorgio et al., Nat Rev Mol Cell Biol, 8: , 2007; Akki et al., J Mol Cell Cardiol 47: 15 22, 2009
4 Formation of ROS during ischemia Rat cardiomyocytes ROS generation: amytal (2.5 mm, a site I electron transport inhibitor), rotenone (10 μm, a site I electron transport inhibitor), bovine ROS formation during liver SOD (200 U/ml, dismutates superoxide to H2O2), (low-flow) diethyldithiocarbamic ischemia acid (DDC, 1 mm, which appears chelates to Cu be in Cu,Zn-SOD, primarily thereby inhibiting its function), nitro-larginine methyl caused ester [L-NAME, by mitochondria! 200 μm, inhibitor of nitric oxide synthase (NOS)], apocynin (300 μm, an inhibitor of NADPH oxidases). Cytosolic SOD inhibitor Complex I inhibitors NOX inhibitor NOS inhibitor Becker et al., Am J Physiol 277 Heart Circ Physiol 46: H2240 H2246, 1999
5 Dog Formation of ROS during ischemia/reperfusion Reperfusion Ischemia Bolli et al., Proc Natl Acad Sci USA 86: , 1989
6 ROS during IRI contribute to cellular damage contribute to cellular protection Function Morphology Function Morphology (Postischemic Reperfusion, Heart Failure) (Ischemia/Reperfusion Injury)
7 Mice NOX2 and irreversible IRI NOX2-KO Hoffmeyer et al., Circ Res 87: , 2000
8 Mice Catalase (CAT), superoxid dismutase (SOD) and irreversible IRI Cardiomyocytes Cardiomyocytes SOD2 Mitochondria CAT SOD1 Giorgio et al., Nat Rev Mol Cell Biol, 8: , 2007 Loor et al., Biochem Biophys Acta 2011
9 Mice GSH during ischemia/reperfusion GSH Mitochondria
10 GSH and irreversible IRI Pig Kupatt et al., Cardiovasc Res 61: , 2004
11 Aldolase reductase and irreversible IRI
12 ROS and mitochondrial morphology Cell (Cardio)- protection mrna BBA 2011
13 Mice ROS and mitochondrial morphology Loor et al., Biochem Biophys Acta 2011
14 ROS and mitochondrial morphology Kuznetsova et al, Int J Biochem & Cell Biol 41: , 2009
15 OPA1, mitochondrial morphology and IRI Chen et al., Cardiovasc Res 84: 91-99, 2009
16 ROS during IRI and protection from it contribute to cellular damage contribute to cellular protection Function Morphology Function Morphology (Postischemic Reperfusion, Heart Failure) (Ischemia/Reperfusion Injury)
17 Ischemic pre- and post-conditioning Dog Coronary occlusion 30 Infarct size (% area at risk) Control Precon (Ischemia/ Drugs) 60 min 5 10 min 3h 3h P<0.05 Postcon 3h 5 0 control Precon Postcon Zhao et al., Am J Physiol 285: H579-H588, 2004
18 ROS and ischemic preconditioning Garciarena et al., J Appl Physiol 105: , 2008
19 NOX2, ROS and ischemic preconditioning Mice NOX2-KO Bell et al., FASEB J 2005
20 Cylophilin D, ROS and ischemic preconditioning
21 Pre- and Post-conditioning: Signal transduction adenosine bradykinin opioids, UCN ANP BNP adenosine bradykinin opioids, UCN IGF-1 FGF-2 IL-6 type cytokines NO TNFα GPCR PI3K Akt NPR pgc GPCR NPR gp130 JAK TNF-R CB-R adiponectin only adenosine enos NO H11K PI3K Akt ERK STAT3 AMPK NO p38 sgc PKG enos NO P70S6K SIRT1 inos MnSOD aldose reductase ROS MPTP PKC MPTP GSK3β mitochondrium nucleus K ATP mitochondrium Cx43 mitochondrium : age-dependent : species-dependent Heusch, Boengler, Schulz, Circulation 118: , 2008; Boengler, Schulz, Heusch, Cardiovasc Res 2009
22 Heinzel et al., Circ Res 97: , 2005 Connexin 43 (Cx43), ROS and ischemic preconditioning Knockout mice MTR fluorescence [% above control] Infarct size (% area at risk) WT Cx43 +/ 60% 60 50% 40% 30% 20% 10% p< * * 0% WT Cx43 +/ Cx43 +/ Diazoxide Menadione 10 0 PLA Diaz PLA Diaz Mena
23 Rat heart in vitro Mitochondrial uncoupling, ROS and IRI Yue et al., Am J Physiol 281: H590-H595, 2001 Minners et al., Cardiovasc Res 47: 68-73, 2000
24 ROS scavenging and ischemic preconditioning 35 Infarct size [% area at risk] P< Placebo IP10 Ascorbic acid IP10 + Ascorbic acid
25 Ovize et al, Cardiovasc Res 87: , 2010 Ischemic Postconditioning: Signal transduction MKP-1
26 Tsutsumi et al., Life Sci 81: , 2007 Mice ROS scavenging and ischemic postconditioning
27 ROS during IRI and protection from it contribute to cellular damage contribute to cellular protection Function Morphology Function Morphology (Postischemic Reperfusion, Heart Failure) (Ischemia/Reperfusion Injury)
Ischemia and Reperfusion: Pharmacological treatment options
Physiologisches Institut Ischemia and Reperfusion: Pharmacological treatment options Prof. Dr. Rainer Schulz Plaque rupture and myocardial ischemia Acute plaque rupture (Stary VI) Ischemic myocardium (ACS,
More informationCardioprotezione ed invecchiamento
55 Congresso SIGG Invecchiamento e longevità: più geni o più ambiente? Firenze, 30/11/2010-04/12/2010 Palazzo dei Congressi SESSIONE DI BIOGERONTOLOGIA Cardioprotezione ed invecchiamento P. Abete, MD,
More informationReperfusion Injury: How Can We Reduce It?
MI/CAD: Practical Question in Management of AMI Patients Reperfusion Injury: How Can We Reduce It? Hyun-Jai Cho, M.D., Ph.D Cardiovascular Center & Department of Internal Medicine Seoul National University
More informationNox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload
Nox-Dependent Mechanisms of Cardiomyocyte Dysfunction in a Model of Pressure Overload Giovanna Frazziano, PhD Vascular Medicine Institute Department of Pharmacology and Chemical Biology University of Pittsburgh
More informationAmeliorating Reperfusion Injury During Resuscitation from Cardiac Arrest
Ameliorating Reperfusion Injury During Resuscitation from Cardiac Arrest Scott T. Youngquist, MD, MSc Associate Professor, Emergency Medicine University of Utah School of Medicine Medical Director, Salt
More informationIntolerance in Heart Failure
Novel Targets to Attack Exercise Intolerance in Heart Failure - Skeletal Muscle - Volker Adams, PhD ESC, Paris 3. Aug. 211 UNIVERSITÄT LEIPZIG H E R Z Z E N T R U M Nothing to disclose Myers et al. NEJM
More informationReperfusion injury in STEMI. Therapeutic opportunities David Garcia-Dorado. Barcelona. Spain
Reperfusion injury in STEMI. Therapeutic opportunities David Garcia-Dorado. Barcelona. Spain 1. The problem 2. Reperfusion injury after acute coronary occlusion 3. Ischemic conditioning 4. Pharmacological
More informationGinkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury
Ginkgo biloba extract postconditioning reduces myocardial ischemia reperfusion injury K. Ran 1, D.-L. Yang 1, Y.-T. Chang 1, K.-M. Duan 2, Y.-W. Ou 2, H.-P. Wang 3 and Z.-J. Li 1 1 Department of Anesthesiology,
More informationSean Davidson. The Hatter Cardiovascular Institute University College London, UK
Key pathways to ischemia-reperfusion injury Sean Davidson The Hatter Cardiovascular Institute University College London, UK Outline What is ischaemia-reperfusion injury? What causes ischaemia-reperfusion
More informationPrevention of reperfusion injury in STEMI - Contra
Prevention of reperfusion injury in STEMI - Contra Prof David Erlinge, MD, PhD Lund University, Skane University Hospital, Lund Sweden Disclosure statement: Received speakers fees from the Medicines company,
More informationThere are numerous reviews on the signal transduction of
Review Molecular Basis of Cardioprotection Signal Transduction in Ischemic Pre-, Post-, and Remote Conditioning Gerd Heusch Abstract: Reperfusion is mandatory to salvage ischemic myocardium from infarction,
More informationThe role of cardiac mitochondria in myocardial ischemia/reperfusion injury. Chad R. Frasier. April, 2012
The role of cardiac mitochondria in myocardial ischemia/reperfusion injury by Chad R. Frasier April, 2012 Director of Dissertation: David A. Brown Department of Physiology Cardiovascular disease (CVD)
More informationREMOTE ISCHEMIC PRECONDITIONING PROTECTS AGAINST ISCHEMIC REPERFUSION INJURY DURING HEART TRANSPLANTATION
REMOTE ISCHEMIC PRECONDITIONING PROTECTS AGAINST ISCHEMIC REPERFUSION INJURY DURING HEART TRANSPLANTATION Mohamed S. A. Mohamed, MBBCh, MSc, MD. Thoracic Transplantation Department, University Clinic Essen,
More informationExercise Intolerance in Heart Failure: Significance of Skeletal Muscle Abnormalities
Exercise Intolerance in Heart Failure: Significance of Skeletal Muscle Abnormalities Hokkaido University Graduate School of Medicine Shintaro Kinugawa Survival rate (%) Peak oxygen uptake and prognosis
More informationCardioprotection by Ischemic Postconditioning Is Lost in Aged and STAT3-Deficient Mice
Cardioprotection by Ischemic Postconditioning Is Lost in Aged and -Deficient Mice Kerstin Boengler, Astrid Buechert, Yvonne Heinen, Christin Roeskes, Denise Hilfiker-Kleiner, Gerd Heusch, Rainer Schulz
More informationSupplementary Table 1. Table showing different gene specific primers used in real-time PCR.
Supplementary Table 1. Table showing different gene specific primers used in real-time PCR. gene Forward (5 3 ) Reverse(5 3 ) act CGTGAAAAGATGACCCAGATCA TGGTACGACCAGAGGCATACAG Nox1 TCGACACACAGGAATCAGGA
More informationChronic protection against ischemia and reperfusion injury during therapy with different organic nitrates
UNIVERSITA DEGLI STUDI DI SIENA Doctorate in Biomedicine and Immunological Science Clinical Pharmacology section Chronic protection against ischemia and reperfusion injury during therapy with different
More informationRole of oxidative Stress in Cerebral Ischemia-reperfusion Injury
Role of oxidative Stress in Cerebral Ischemia-reperfusion Injury Evidences obtained from the past two decades showed that there is an involvement of reactive oxygen species in cerebral ischemia (Christophe
More informationc Ischemia (30 min) Reperfusion (8 w) Supplementary Figure bp 300 bp Ischemia (30 min) Reperfusion (4 h) Dox 20 mg/kg i.p.
a Marker Ripk3 +/ 5 bp 3 bp b Ischemia (3 min) Reperfusion (4 h) d 2 mg/kg i.p. 1 w 5 w Sacrifice for IF size A subset for echocardiography and morphological analysis c Ischemia (3 min) Reperfusion (8
More informationAngiotensin-converting enzyme inhibitors potentiate subthreshold preconditioning through NO and mitok ATP. channel
Acta Physiologica Sinica, August 25, 2005, 57 (4): 453-460 http://www.actaps.com.cn 453 ATP 1 1 1 2 2 2,* 1 313000 2 310006 Langendorff ( ) ( ) (angiotensin-converting enzyme inhibitors, ACEI) (nitric
More informationPCTH 400. Endothelial dysfunction and cardiovascular diseases. Blood vessel LAST LECTURE. Endothelium. High blood pressure
PCTH 400 LAST LECTURE Endothelial dysfunction and cardiovascular diseases. Classic Vascular pharmacology -chronic -systemic Local Vascular pharmacology -acute -targeted High blood pressure Blood pressure
More informationInteraction of Cardiovascular Risk Factors with Myocardial Ischemia/Reperfusion Injury, Preconditioning, and Postconditioning
0031-6997/07/5904-418 458$20.00 PHARMACOLOGICAL REVIEWS Vol. 59, No. 4 Copyright 2007 by The American Society for Pharmacology and Experimental Therapeutics 6002/3284440 Pharmacol Rev 59:418 458, 2007
More informationRemote Ischemic Preconditioning: Current aspects of mechanisms. Hans Erik Bøtker, Aarhus University Hospital, Skejby, Denmark,
Remote Ischemic Preconditioning: Current aspects of mechanisms Hans Erik Bøtker, Aarhus University Hospital, Skejby, Denmark, Mechanisms Dialysate as a bioassay for riperc Shimizu et al. Clin Sci 2009;117:191-200
More informationEffects of hyperlipidemia and statins on cardioprotective signaling
Effects of hyperlipidemia and statins on cardioprotective signaling HFA-ISHR 212 Belgrade Péter Ferdinandy Cardiovascular Research Group, University of Szeged and Semmelweis University, Budapest; Pharmahungary
More informationCell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction. Rita Alonaizan
Cell therapy: enhancing the therapeutic potential of cardiac progenitors for delivery post myocardial infarction Rita Alonaizan Department of Physiology, Anatomy & Genetics St Catherine s College Supervisor:
More informationNuovi target e opportunità terapeutiche del danno da riperfusione nello STEMI
GUIDATI DA PARADIGMI SEMPRE NUOVI, GLI SCIENZIATI ADOTTANO NUOVI STRUMENTI E PROGETTANO NUOVI STUDI GUARDANDO VERSO NUOVE DIREZIONI Nuovi target e opportunità terapeutiche del danno da riperfusione nello
More informationAdjunctive Therapy to Reduce Infarct Size: Current and Future Challenges
Adjunctive Therapy to Reduce Infarct Size: Current and Future Challenges Chang-Hwan Yoon, M.D. Cardiovascular Center, Department of Internal Medicine Bundang Hospital 1 1. 빨리뚫어야한다 2013 ACC/AHA STEMI Guideline
More informationReperfusion Injury, Cardioprotection, and 2 Decades of Failed Studies
Reperfusion Injury, Cardioprotection, and 2 Decades of Failed Studies The Dark Side of Reperfusion 2014 MFMER 3327355-7 Reduction of Infarct Size in the Experimental Animal What can be achieved? No reperfusion
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 3,900 116,000 120M Open access books available International authors and editors Downloads Our
More informationΜηχανισµός της απώλειας της καρδιοπροστατευτικής δράσης της µετισχαιµικής προστασίας (postconditioning) στην αθηρωµάτωση Iωάννα Ανδρεάδου
Μηχανισµός της απώλειας της καρδιοπροστατευτικής δράσης της µετισχαιµικής προστασίας (postconditioning) στην αθηρωµάτωση Iωάννα Ανδρεάδου School of Pharmacy, University of Athens, Greece Definitions Preconditioning:
More informationBiomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in treatment Professor Grace George
Division of Medical Biochemistry, Department of Human Biology, Faculty of Health Sciences, Mthatha, South Africa Biomarkers of Oxidative Stress and Antioxidant Status in Type 2 Diabetes: Importance in
More informationMyocardial ischaemia reperfusion injury: the challenge of translating ischaemic and anaesthetic protection from animal models to humans
British Journal of Anaesthesia, 117 (S2): ii44 ii62 (2016) doi: 10.1093/bja/aew267 Review Article Myocardial ischaemia reperfusion injury: the challenge of translating ischaemic and anaesthetic protection
More informationNovel Necrosis Inhibitor to prevent. Myocardial Ischemia-Reperfusion Injury
Novel Necrosis Inhibitor to prevent Myocardial Ischemia-Reperfusion Injury Hyo-Soo Kim, MD/PhD/FAHA Cardiovascular Center & Department of Internal Medicine, Seoul National University Hospital INTRODUCTION
More informationLujain Hamdan. Faisal Nimri
20 Lujain Hamdan Faisal Nimri...... Sources of NADPH [ The pentose phosphate pathway is the primary source of the NADPH and is the only source in RBC.] Cytosolic conversion of oxaloacetate to pyruvate
More informationBIOCHEMICHISTRY OF EYE TISSUE. Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI
BIOCHEMICHISTRY OF EYE TISSUE Sri Widia A Jusman Department of Biochemistry & Molecular Biology FMUI 1 METABOLIC PATHWAYS IN EYE TISSUE Glycolysis ( aerobic & anaerobic) HMP shunt Poliol pathway TCA cycle
More informationNovel function of NADPH oxidase in atherosclerosis. Yun Soo Bae Department of Life Science Ewha Womans University
Novel function of NADPH oxidase in atherosclerosis Yun Soo Bae Department of Life Science Ewha Womans University Recent understanding of ROS: act as second messengers e e Catalase/peroxidase O 2 H 2 O
More informationCancer therapy, cardiovascular toxicity and hypertension
Cancer therapy, cardiovascular toxicity and hypertension Rhian M Touyz MBBCh, PhD Disclosures: None Capri Cardiovascular Conference 2.0, Capri 15-16 April 2016 Vascular phenotype in hypertension Normotensive
More informationCardiovascular Topics
CARDIOVASCULAR JOURNAL OF SOUTH AFRICA Vol 17, No. 5, September/October 2006 239 Cardiovascular Topics Melatonin prevents cardioprotection induced by a multi-cycle ischaemic preconditioning protocol in
More informationDoes Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa
Does Pharmacological Exercise Mimetics Exist? Hokkaido University Graduate School of Medicine Shintaro Kinugawa Survival rate (%) Peak oxygen uptake and prognosis in patients with heart failure (HF) 1
More informationMitochondrial ROS in the pro-hypertensive immune response. Rafal R. Nazarewicz and Sergey I. Dikalov
Articles in PresS. Am J Physiol Regul Integr Comp Physiol (May 8, 2013). doi:10.1152/ajpregu.00208.2013 Mitochondrial ROS in the pro-hypertensive immune response Rafal R. Nazarewicz and Sergey I. Dikalov
More informationE and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, ) Jolly, S. R., Kane, W. J., Bailie, M. B. et al.
1) Ferrari, R., Visoli, O., Guarnieri, C. et al.: Vitamin E and the heart: Possible role as antioxidant. Acta Vitaminol. Enzymol. 5: 11-22, 1983. 2) Jolly, S. R., Kane, W. J., Bailie, M. B. et al.: Canine
More informationPhiladelphia College of Osteopathic Medicine Annual Progress Report: 2011 Formula Grant
Philadelphia College of Osteopathic Medicine Annual Progress Report: 2011 Formula Grant Reporting Period January 1, 2012 June 30, 2012 Formula Grant Overview The Philadelphia College of Osteopathic Medicine
More informationBiological Chemistry of Hydrogen Peroxide
Biological Chemistry of Hydrogen Peroxide Christine Winterbourn Department of Pathology University of Otago, Christchurch New Zealand Hydrogen Peroxide Intermediate in reduction of oxygen to water A major
More informationCardioprotection by endogenous fibroblast growth factor 2 in cardiac ischemia-reperfusion injury in vivo
Washington University School of Medicine Digital Commons@Becker Conference Abstracts and Posters Division of Emergency Medicine/Emergency Care Research Section 2011 Cardioprotection by endogenous fibroblast
More informationEvaluation of Resveratrol and Tocotrienols as potential REDOX active compounds for Cardioprotection
Evaluation of Resveratrol and Tocotrienols as potential REDOX active compounds for Cardioprotection Dissertation for the Doctor of Philosophy Degree Written by: Samarjit Das 2006 Department of Pharmacology
More informationChapter 14. Energy conversion: Energy & Behavior
Chapter 14 Energy conversion: Energy & Behavior Why do you Eat and Breath? To generate ATP Foods, Oxygen, and Mitochodria Cells Obtain Energy by the Oxidation of Organic Molecules Food making ATP making
More informationS. Lemoine 1, *, L. Tritapepe 2, J. L. Hanouz 1 and P. E. Puddu 2. Abstract REVIEW ARTICLES
British Journal of Anaesthesia, 116 (4): 456 75 (2016) doi: 10.1093/bja/aev451 Advance Access Publication Date: 20 January 2016 Review Articles REVIEW ARTICLES The mechanisms of cardio-protective effects
More informationAdenosine stimulates the recruitment of endothelial progenitor cells to the ischemic heart
Adenosine stimulates the recruitment of endothelial progenitor cells to the ischemic heart Involvement of the microrna-150-cxcr4-sdf-1α pathway Emeline Goretti, MSc No conflict of interest Endothelial
More informationMol Biotechnol Sep;37(1):31-7. Bioenergetic and antioxidant properties of coenzyme Q10: recent developments. Littarru GP, Tiano L.
Mol Biotechnol. 2007 Sep;37(1):31-7. Bioenergetic and antioxidant properties of coenzyme Q10: recent developments. Littarru GP, Tiano L. Source : Institute of Biochemistry, Polytechnic University of the
More informationTSP1 Secr Sec eted eted b m byy m n a y n y ce c ll cee s Upregulated by injury/stress W dely expressed CD47 S TSP1 only known ligand
Parenchymal CD47 Promotes Renal IRI via Multiple Mechanisms Jeffrey S. Isenberg, MD, MPH Division of Pulmonary, Allergy and Critical Care Medicine Vascular Medicine Institute University of Pittsburgh School
More informationCigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences
Cigarette Smoke Exposure and HIV-Related Neurologic Disease Progression Basic Mechanisms and Clinical Consequences Walter Royal, III, MD Professor of Neurology University of Maryland School of Medicine
More informationSUBJECT INDEX. References to Figures and Tables are in italics
SUBJECT INDEX References to Figures and Tables are in italics aconitase EPR spectra of, Fig.14.1 inhibition by NO, 242 adenosine metabolism in influenza-infected mice, 283 adhesion molecules engagement
More informationForum Minireview. Tetsuji Miura 1, *, Masahiro Nishihara 1, and Takayuki Miki 1
J Pharmacol Sci 109, 162 167 (2009)2 Journal of Pharmacological Sciences 2009 The Japanese Pharmacological Society Forum Minireview Drug Development Targeting the Glycogen Synthase Kinase-3β (GSK-3β)-
More informationEXPERIMENTAL AND THERAPEUTIC MEDICINE 8: , 2014
EXPERIMENTAL AND THERAPEUTIC MEDICINE 8: 973-977, 2014 Pharmacological postconditioning with tanshinone IIA attenuates myocardial ischemia reperfusion injury in rats by activating the phosphatidylinositol
More informationOzone in Complementary Medicine Possible Mechanism of Ozone in Rheumatic and Inflammatory Diseases
Ozone in Complementary Medicine Possible Mechanism of Ozone in Rheumatic and Inflammatory Diseases 10.11.2004 OZONOSAN 1 Mechanism of Action in Rheumatic Pain Syndroms Acute stage: Activation of cell metabolism,
More informationEffect of classic preconditioning and diazoxide on endothelial function and O 2 and NO generation in the post-ischemic guinea-pig heart
Cardiovascular Research 63 (2004) 118 129 www.elsevier.com/locate/cardiores Effect of classic preconditioning and diazoxide on endothelial function and O 2 and NO generation in the post-ischemic guinea-pig
More informationEndogenous Opioids and Exercise Induced Cardioprotection. Lindsey Erin Miller
Endogenous Opioids and Exercise Induced Cardioprotection by Lindsey Erin Miller A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the
More informationEffets Vasculaires des Flavonoïdes Alimentaires et leurs Mécanismes
Académie Nationale de Pharmacie Mercredi 27 janvier 21 Faculté de Pharmacie de Paris Effets Vasculaires des Flavonoïdes Alimentaires et leurs Mécanismes V.B. Schini-Kerth CNRS UMR 7213 Équipe Pharmacologie
More informationAssoc. Prof. Dr. Aslı Korkmaz* and Prof. Dr. Dürdane Kolankaya**
The possible protective effects of some flavonoids that found honey by experimental ischemia/reperfusion (I/R) induced nitrosative damage in kidney of male rats Assoc. Prof. Dr. Aslı Korkmaz* and Prof.
More informationAdipose Tissue Dysfunction and Diabetic Cardiovascular Disease
Adipose Tissue Dysfunction and Diabetic Cardiovascular Disease Xin-Liang Ma, MD, PhD Thomas Jefferson University Philadelphia, PA USA CVD As The #1 Causes of Death In USA Male Female Heart Disease and
More information, L2Arg NO. (ischemia reperfusion injury, IRI) (L2arginine/ nitric oxide, L2Arg/ NO) IRI g Wistar,, g/ kg) ip, Acta Physiologica Si nica
, 1999 2, 51 (1), 25 30 25 Acta Physiologica Si nica L2Arg/ NO 1997212227 1998203230 3 3 (, 524023 ; 3, 100083) ( IRI) (NO), 15 min, 45 min, 30 ml KH 15 min, (LDH) NO2 - NOS L2 (L2Arg), IRI LDH 411, 514
More informationTissue reperfusion after ischemia, although ultimately
Review Role of Glycogen Synthase Kinase-3 in Cardioprotection Magdalena Juhaszova, Dmitry B. Zorov, Yael Yaniv, H. Bradley Nuss, Su Wang, Steven J. Sollott Abstract Limitation of infarct size by ischemic/pharmacological
More informationThe Role of Neuronal Nitric Oxide Synthase (nnos) in Ischaemia/Reoxygenation-induced injury and in protection of the Mammalian Myocardium
The Role of Neuronal Nitric Oxide Synthase (nnos) in Ischaemia/Reoxygenation-induced injury and in protection of the Mammalian Myocardium Miss Anupama Barua MBBS, MRCSEd A thesis submitted to the University
More informationWe are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists. International authors and editors
We are IntechOpen, the world s leading publisher of Open Access books Built by scientists, for scientists 4,000 116,000 120M Open access books available International authors and editors Downloads Our
More informationUniversity of Milan spin-off founded in 2004 and now fully owned by Genextra S.p.A.
Mitochondrial Platform Targeting the Permebility Transition Pore Company Overview University of Milan spin-off founded in 2004 and now fully owned by Genextra SpA Focused on identifying and advancing novel
More informationCPR flow to prime the ischemic heart during cardiac arrest?
CPR flow to prime the ischemic heart during cardiac arrest? BY MARK G ANGELOS, MAHMOOD KHAN Abstract Cardiac arrest is unique among cardiac ischemic syndromes in that all circulation must be generated
More informationIschemic Heart Failure
15 th Cardiology Congress of Northern Greece Thessaloniki, May 26-28, 2016 Ischemic Heart Failure Filippos Triposkiadis, MD, FESC, FACC Professor of Cardiology Director, Department of Cardiology Larissa
More informationLack of the Effect of Superoxide Dismutase and Catalase on Na +,K + -ATPase Activity in Stunned Rabbit Hearts
Physiol. Res. 57 (Suppl. 2): S61-S66, 2008 Lack of the Effect of Superoxide Dismutase and Catalase on Na +,K + -ATPase Activity in Stunned Rabbit Hearts P. KAPLÁN 1,2, M. MATEJOVIČOVÁ 1,2, P. HERIJGERS
More informationEffect of mitochondrial ATP-sensitive potassium channel opening on the translocation of protein kinase C epsilon in adult rat ventricular myocytes
Effect of mitochondrial ATP-sensitive potassium channel opening on the translocation of protein kinase C epsilon in adult rat ventricular myocytes H. Li, T. Yang, Z. Long and J. Cheng Department of Anesthesiology,
More informationLung ischemia reperfusion injury: the therapeutic role of dipeptidyl peptidase 4 inhibition
Review Article on Acute Lung Injury Page 1 of 7 Lung ischemia reperfusion injury: the therapeutic role of dipeptidyl peptidase 4 inhibition Paul A. J. Beckers 1, Jan F. Gielis 1, Paul E. Van Schil 1, Dirk
More informationLecture 19 Summary Gestational Diabetes and Complications of Diabetes. Gestational diabetes;
Lecture 19 Summary Gestational Diabetes and Complications of Diabetes Gestational diabetes; - Type of diabetes that only develops during pregnancy Usually diagnosed in late pregnancy Causes high blood
More informationAdvances in ischemia and reperfusion injury: effects on liver microcirculation and therapeutic strategies for sinusoidal protection
Advances in ischemia and reperfusion injury: effects on liver microcirculation and therapeutic strategies for sinusoidal protection Diana Hide Alférez Aquesta tesi doctoral està subjecta a la llicència
More informationROS as targets for therapeutic intervention of diabetic nephropathy
36 th Autumn Congress of Korean Diabetes Association September 16-17, 2010, BEXCO, Busan, Korea ROS as targets for therapeutic intervention of diabetic nephropathy Hunjoo Ha Department of Bioinspired Science
More informationInterleukin-6 and Exercise-Induced Cardioprotection. Graham Ripley McGinnis
Interleukin-6 and Exercise-Induced Cardioprotection by Graham Ripley McGinnis A dissertation submitted to the Graduate Faculty of Auburn University In partial fulfillment of the Requirements for the Degree
More informationBasic Mechanisms of Remote Ischemic Conditioning
Basic Mechanisms of Remote Ischemic Conditioning Rajesh K Kharbanda Oxford, GB ESC 2012. From Bench to Practice: Bridging the gap Mechanisms and Clinical use of Ischaemic Conditioning Disclosure Shareholder
More informationThis Review is part of a thematic series on the Role of Mitochondria in Cardiovascular Diseases, which includes the following articles:
This Review is part of a thematic series on the Role of Mitochondria in Cardiovascular Diseases, which includes the following articles: Free Radicals, Mitochondria, and Oxidized Lipids: The Emerging Role
More informationAcetylcholine and bradykinin trigger preconditioning in the heart through a pathway that includes Akt and NOS
Am J Physiol Heart Circ Physiol 287: H2606 H2611, 2004. First published August 26, 2004; doi:10.1152/ajpheart.00600.2004. Acetylcholine and bradykinin trigger preconditioning in the heart through a pathway
More informationH 2 S: Synthesis and functions
H 2 S: Synthesis and functions 1 Signaling gas molecules: O 2, NO and CO Then, H 2 S - Fourth singling gas molecule after O 2, NO and CO 2 Nothing Rotten About Hydrogen Sulfide s Medical Promise Science
More informationTrans-plasma membrane electron transport in muscle cells. Shannon Kelly
Trans-plasma membrane electron transport in muscle cells Shannon Kelly Introduction Trans-plasma membrane electron transport (tpmet) Shuttle-based electron transfer Enzyme-mediated electron transfer Intracellular
More informationAntioxidant Enzymes. - Superoxide dismutases (SODs) - Catalases - Peroxiredoxins - Glutathione peroxidases
Antioxidant Enzymes - Superoxide dismutases (SODs) - Catalases - Peroxiredoxins - Glutathione peroxidases Eva Maria Steiner, Samantha Swenson, Mattias Günther and Xiaoxiao Peng 1 Eva Maria Steiner June
More informationThis student paper was written as an assignment in the graduate course
77:222 Spring 2003 Free Radicals in Biology and Medicine Page 0 This student paper was written as an assignment in the graduate course Free Radicals in Biology and Medicine (77:222, Spring 2003) offered
More information,, - [5, 11]., -, (NO)., NO,,. NO NO- (NOS). (nnos NOS1) (enos NOS3) NO-,, 2+- NO- (inos NOS2),,,,, [5]., NOS (nnos enos), inos. inos - ( ),, ( ),. NO
, 70,9 ± 1,3% 58,0±0,86%. 3... 1.. /..,.. // today. 2004. 1-2.. 30-31. 2.. /.,..,.. //-.: -, -2006. - 240. 3... /.., C. B.,.. [.] //. -2008. - 5.-C.33-36. 4..., - /..,.. // - 2007. - 1. -. 38-41. 5...
More informationNNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update
NNZ-2566 in Rett Syndrome and Autism Spectrum Disorders Role and Update 1 Overview The natural growth factor IGF-1 is broken down in the body to IGF-1[1-3] NNZ-2566 is an analogue of IGF-1[1-3] developed
More informationAperTO - Archivio Istituzionale Open Access dell'università di Torino
AperTO - Archivio Istituzionale Open Access dell'università di Torino From the nucleus to the mitochondria and backthe odyssey of a multitask STAT3 This is the author's manuscript Original Citation: From
More informationStroke, the most common medical emergency, is a
Report on Progress 2016 Advances in Our Knowledge of Stroke Mechanisms and Therapy Xuefang Ren, M.D., and James W. Simpkins Ph. D Department of Physiology and Pharmacology, Experimental Stroke Core, Center
More informationReview Article Molecular Characterization of Reactive Oxygen Species in Myocardial Ischemia-Reperfusion Injury
BioMed Research International Volume 2015, Article ID 864946, 9 pages http://dx.doi.org/10.1155/2015/864946 Review Article Molecular Characterization of Reactive Oxygen Species in Myocardial Ischemia-Reperfusion
More informationARF ARF. NOx. NOS nmol NOx formed/30 min/kidney Wet Weight; ± ± 1.81 ARF. acute renal failure: ARF
Vol. 29, pp.673 ~ 679, 2001 13 12 20 ARF 50% ARF ARF ARF ARF NO ARF NO NOS NO NO2 /NO3 NOx Griess NO NOx 1 72 7 NOx NOS 1 7 NOx µmol/kidney Wet Weight; Sham 0.116 ± 0.005 0.168 ± 0.006 24 0.185 ± 0.004
More informationReactive Oxygen species ROS + Anti-oxidants. Dr. Naif Karadsheh
Reactive Oxygen species ROS + Anti-oxidants Dr. Naif Karadsheh Oxygen Toxicity & Free Radicals Biradical O 2 Radical O 2 Non-Radical Radical H 2 O 2 OH ROS O 2 Metabolism and Toxicity O 2 Consumption >90%
More informationIschemic preconditioning is cardioprotective 1 and depends
The ph Hypothesis of Postconditioning Staccato Reperfusion Reintroduces Oxygen and Perpetuates Myocardial Acidosis Michael V. Cohen, MD; Xi-Ming Yang, MD, PhD; James M. Downey, PhD Background It is unclear
More informationOriginal Article Change of mitochondrial function in the early stage after cardiac ischemia-reperfusion injury in mice
Int J Clin Exp Med 2016;9(2):2549-2554 www.ijcem.com /ISSN:1940-5901/IJCEM0015306 Original Article Change of mitochondrial function in the early stage after cardiac ischemia-reperfusion injury in mice
More informationMelatonin improves vascular reactivity of endotoxemia rats
Acta Physiologica Sinica, June 25, 2005, 57 (3): 367-372 http://www.actaps.com.cn 367, *,,,, 050017 (melatonin, MT) (lipopolysaccharide LPS) LPS LPS+MT MT (phenylephrine PE) (acetylcholine ACh) (malondialhyde
More informationAnti-diabetic effects of seaweeds: potential mechanisms. By: Z. Janahmadi
Anti-diabetic effects of seaweeds: potential mechanisms By: Z. Janahmadi Presentation outline Diabetes mellitus Marine algae *Unsaturated fatty acids *Dietary Fibers *α-glucosidase inhibitors *Glucose
More informationTNF- Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury
TNF- Contributes to Endothelial Dysfunction in Ischemia/Reperfusion Injury Cuihua Zhang, Xiangbin Xu, Barry J. Potter, Wei Wang, Lih Kuo, Lloyd Michael, Gregory J. Bagby, William M. Chilian Background
More informationNew Drug Development for Hepatic Insulin Resistance
New Drug Development for Hepatic Insulin Resistance Innovative Drug Research Center for Metabolic and Inflammatory Disease College of Pharmacy Sang Geon Kim AMPK as an energy sensor, (A novel drug target
More informationCardioprotective Effect of High Intensity Interval Training and Nitric Oxide Metabolites (NO 2 -, NO 3 - )
Original Article Cardioprotective Effect of High Intensity Interval Training and Nitric Oxide Metabolites (NO 2 -, NO 3 - ) *Aliasghar FALLAHI 1, 2, Abbasali GAEINI 3, Shahnaz SHEKARFROUSH 4, Ali KHOSHBATEN
More informationMyocardial infarction continues to be a major cause of
Integrative Physiology Mitochondrial STAT3 Activation and Cardioprotection by Ischemic Postconditioning in Pigs With Regional Myocardial Ischemia/Reperfusion Gerd Heusch, Judith Musiolik, Nilguen Gedik,
More informationEFFECTS OF HEME-L-ARGINATE ON L-NAME INDUCED HYPERTENSION. A Thesis Submitted to. The College of Graduate Studies & Research
EFFECTS OF HEME-L-ARGINATE ON L-NAME INDUCED HYPERTENSION A Thesis Submitted to The College of Graduate Studies & Research In Partial Fulfillment of the Requirements For the Degree of Master of Science
More informationPETER L. LUTZ. Red-eared slider Trachemys scripta elegans
www.carleton.ca/~kbstorey PETER L. LUTZ Red-eared slider Trachemys scripta elegans Lutz PL, Storey KB. 1997. Handbook of Physiology (Dantzler WH, ed) Oxford Univ. Press, Vol. 2, pp. 1479-1522. 1 Relative
More informationReview Article The Coronary Microcirculation in Health and Disease
ISRN Physiology Volume 2013, Article ID 238979, 24 pages http://dx.doi.org/10.1155/2013/238979 Review Article The Coronary Microcirculation in Health and Disease Judy M. Muller-Delp Department of Physiology
More informationIschemic Postconditioning During Primary Percutaneous Coronary Intervention Mechanisms and Clinical Application Jian Liu, MD FACC FESC FSCAI Chief Phy
Ischemic Postconditioning During Primary Percutaneous Coronary Intervention Mechanisms and Clinical Application Jian Liu, MD FACC FESC FSCAI Chief Physician, Professor of Medicine Department of Cardiology,
More information