Phospholipase C zeta undergoes dynamic changes in its pattern of localization in sperm during capacitation and the acrosome reaction

Transcription

1 Phospholipase C zeta undergoes dynamic changes in its pattern of localization in sperm during capacitation and the acrosome reaction Claire Young, B.Sc., Patricia Grasa, Ph.D., Kevin Coward, Ph.D., Lianne C. Davis, B.Sc., and John Parrington, Ph.D. Department of Pharmacology, University of Oxford, Mansfield Road, Oxford, United Kingdom Objective: To evaluate the localization of phospholipase Cz (PLCz) in non-capacitated, capacitated, and ionophore-treated sperm. Design: Phospholipase Cz was cloned from the hamster, an important model organism for studying fertilization. Next, we used hamster and mouse models to investigate the localization of PLCz in non-capacitated and capacitated sperm and in sperm treated with ionophore to induce the acrosome reaction. Setting: University laboratory. Animal(s): Male mice and hamsters, 4 6 weeks old. Intervention(s): None. Main Outcome Measure(s): Phospholipase Cz localization in non-capacitated, capacitated, and ionophore-treated sperm. Result(s): Full-length hamster PLCz complementary DNA is 1953 base pairs in size, encoding an open reading frame of 651 amino acids, sharing 85% amino acid similarity with the mouse. Phospholipase Cz was localized in acrosomal and post-acrosomal regions of sperm. The post-acrosomal localization, which became more evident after capacitation and was maintained after ionophore treatment, is in line with PLCz being the endogenous agent of egg activation. However, the acrosomal PLCz population, which was lost after ionophore treatment, suggests that PLCz could have other functions besides egg activation. Conclusion(s): Phospholipase Cz is localized to acrosomal and post-acrosomal regions and undergoes dynamic changes during capacitation and the acrosome reaction, indicating a potential role regulating not only egg activation but other sperm functions. (Fertil Steril Ò 2009;91: Ó2009 by American Society for Reproductive Medicine.) Key Words: Fertilization, egg activation, phospholipase C zeta, sperm, capacitation, acrosome reaction, hamster PLC zeta, molecular cloning Egg activation is a crucial developmental event that releases the egg from meiotic arrest and prevents polyspermy. In almost all species studied, egg activation is associated with a rise in intracellular egg calcium ions (Ca 2þ ) (1 3). In mammals this occurs as a series of Ca 2þ oscillations that begin soon after fertilization and can persist for several hours (4, 5). Recent studies suggest that in mammals, egg activation is triggered by a sperm-specific phospholipase C, PLCz (6 8). Initially identified in the mouse (7), PLCz has since been identified in the monkey, human, and pig (9, 10), and in chickens (11), the latter finding suggesting a role for this protein during egg activation in other vertebrate groups. Received November 5, 2007; revised May 2, 2008; accepted May 5, 2008; published online August 16, C.Y. has nothing to disclose. P.G. has nothing to disclose. K.C. has nothing to disclose. L.C.D. has nothing to disclose. J.P. has nothing to disclose. Supported by a Medical Research Council (United Kingdom) project grant (J.P.) and a Fellowship from the Gobierno de Aragon-Caja Immaculada (Spain) (P.G.). C.Y., P.G., and K.C. contributed equally to this work. Reprint requests: John Parrington, Ph.D., Department of Pharmacology, University of Oxford, Mansfield Road, Oxford OX1 3QT, United Kingdom (FAX: ; john.parrington@pharm.ox.ac.uk). A number of pieces of evidence support the view that PLCz is the physiologic egg activation factor. Thus, injection of mouse recombinant RNA or protein into mouse oocytes induces Ca 2þ oscillations identical to those observed at fertilization (7, 12); immunodepletion of endogenous PLCz from sperm protein extracts eliminates their ability to release Ca 2þ in mouse oocytes and sea urchin egg homogenates (7); and the ability of fractionated sperm extracts to trigger Ca 2þ oscillations in mouse oocytes correlates with the presence of PLCz (13). In addition, the amount of PLCz within a single mouse sperm has been estimated to be approximately fg (7, 14), which is in the expected physiologic range required to trigger Ca 2þ oscillations at fertilization. Furthermore, PLCz has been shown to possess other distinctive properties previously identified as features of the physiologic egg activation agent, such as a high sensitivity to Ca 2þ (12) and association with the pronucleus of the fertilized egg (15, 16). Finally, evidence that PLCz is the physiologic agent of egg activation has come from a study in which sperm from transgenic mice expressing short hairpin RNAs against PLCz exhibited reduced amounts of the protein, and when injected into mouse oocytes, induced Ca 2þ oscillations that ended prematurely (17) Fertility and Sterility â Vol. 91, No. 5, Supplement, May /09/$36.00 Copyright ª2009 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert

2 Despite these advances, much remains unclear about PLCz s mechanism of action and functional role during fertilization. Key unresolved issues are how PLCz is packaged within sperm and whether its pattern of localization changes during sperm maturation and the events preceding gamete fusion. One previous study used immunofluorescence to study the localization of PLCz in mouse sperm and found evidence that the protein was present throughout the perinuclear theca of the sperm head (14), where the endogenous egg activation factor is thought to reside (18 20), as well as in the sperm tail, but the specificity of these localizations was not substantiated by the use of blocking peptides (14) or appropriate quantitation. A more recent study identified a pattern of localization for PLCz in the post-acrosomal region and the equatorial segment in non-capacitated mouse and bull sperm, respectively (21). However, this latter study s findings were complicated by quite a high degree of apparently nonspecific immunostaining. Moreover, neither of these studies investigated whether any dynamic changes took place in the localization of the PLCz protein during the important processes of capacitation and the acrosome reaction. We decided to investigate these important questions systematically in two model organisms, the mouse and hamster, by carrying out immunofluorescence and immunoblotting studies with specific affinity-purified antibodies to look at the pattern of localization of PLCz in sperm in non-capacitated sperm and those that have undergone capacitation and the acrosome reaction. We found that PLCz is localized to the post-acrosomal region of the sperm head, the expected location for the egg activation factor, and that this pattern of localization is maintained after the acrosome reaction, in line with PLCz being the endogenous agent of egg activation. Intriguingly, however, the pattern of PLCz immunofluorescence in this post-acrosomal region changes during capacitation, possibly suggesting that changes in the conformational state of PLCz, or its interaction with other subcellular components, may occur during this process. More surprisingly, we identify another population of PLCz in the acrosomal region, suggesting for the first time that this protein may have additional important roles in the sperm besides that of an egg activation factor, for instance in the acrosome reaction. MATERIALS AND METHODS Animals Male golden Syrian hamsters (4 6 weeks old) and MF1 mice (4 6 weeks old) were obtained from Harlan (Bicester, United Kingdom [UK]) and maintained on a 12-hour light/12-hour dark photoperiod. Food and water were provided ad libitum. To collect tissues and sperm, animals were culled by Schedule 1 methods in accordance with the Animals (Scientific Procedures) Act of Isolation and Cloning of Hamster PLCz Testis complementary DNA (cdna) was prepared from total RNA using methods described previously (11). Hamster PLCz was cloned from testis cdna by polymerase chain reaction (PCR) with primers designed using sequence alignments of mammalian PLCz sequences (forward: ATG GAAATGAGATGGTTTTTGTC; reverse: TCACTCTCT GATGTACCAAACGTAA) and the High Fidelity PCR Master System (Roche Diagnostics, Burgess Hill, UK). Full length PLCz cdna was sub-cloned into pcr II-TOPO and transformed into competent TOP 10 cells (Invitrogen, Paisley, UK). Plasmid DNA was prepared using the Wizard Plus Midiprep DNA Purification System (Promega, Southampton, UK) and sequenced by MWG Biotech (Ebersberg, Germany) to confirm identity. The full-length nucleotide sequence was translated into a predicted amino acid sequence with the ExPaSy Molecular Biology Server (Swiss Institute of Bioinformatics; Multiple sequence alignment using CLUSTAL W (22) was used to compare the putative hamster PLCz with mouse (NM_054066) and chicken (AY843531) isoforms. A dendrogram of PLCz and PLCd1 sequences was then constructed as described previously (11). Sequences used in the dendrogram were as follows (accession numbers in parentheses): chicken PLCz (AY843531), monkey PLCz (AB070108), human PLCz (NM_033123), mouse PLCz (NM_054066), mouse PLCd1 (AAH25798), human PLCd1 (AAH50382), and chicken PLCd1 (XP_418522). The accession number of hamster PLCz is EU The domain structure of hamster PLCz was investigated using SMART (23). Reverse Transcriptase Polymerase Chain Reaction and Northern Analysis Testis, heart, liver, lung, and kidney were dissected from freshly culled hamsters and total RNA isolated. Reverse transcriptase (RT)-PCR was carried out as above, using oligonucleotides designed to produce an approximately 500-base pair (bp) fragment from the C2 domain of hamster PLCz (forward: CCTTGAACTTCCAAACCCCT; reverse: CCAAACGTAAATGAACAGCGA). Northern blot analysis was used to investigate tissue expression of PLCz in hamster using testis, heart, liver, lung, and kidney, and also used to study expression of hamster PLCz messenger RNA (mrna) during spermatogenesis by harvesting testes from postnatal animals culled on days 5, 10, 17, 30, and 63 after birth. Northern blot analysis was carried out as previously described by Coward et al. (11) using the C2 domain fragment mentioned above as a radioactive probe. Antibody Design and Purification Antibodies specific for mouse and hamster PLCz were produced commercially (Covalab, Villeurbanne, France) by immunizing rabbits with two peptides derived from the protein sequence (MEMRWFLSKIQDEFRGGKI and CMNKGYRRVPLFSK). Specific antibodies were affinitypurified from immunized rabbit serum using both peptides conjugated to Sulfo-Link agarose (Pierce Biotechnology, Rockford, IL) in accordance with the manufacturer s instructions. Fertility and Sterility â 2231

3 Preparation of Whole Sperm and Sperm Protein Extracts Epididymi were harvested from culled animals, perforated with a 25-gauge hypodermic needle, and incubated in an equal volume of prewarmed phosphate-buffered saline (PBS) at 37 C for minutes to allow sperm to swim out. Sperm were washed in PBS containing ethylenediaminetetraacetic acid (EDTA)-free Complete protease inhibitors (Roche Diagnostics), centrifuged at 2000 g for 10 minutes at room temperature, the supernatant removed, and the pellet resuspended in PBS/protease inhibitor. Pellets were washed and finally resuspended in a volume of KCl/N-2-hydroxyethylpiperazine-N 0-2-ethanesulfonic acid (HEPES)/EDTA/ protease inhibitor (120 mmol/l KCl, 20 mmol/l HEPES, 1 mmol/l EDTA, ph 7.5) equal to that of the pellet. Sperm were lysed by freeze thaw in liquid nitrogen and stored at 80 C to await analysis. Sperm protein extracts were prepared by lysing whole sperm samples with two additional freeze thaw cycles to release soluble proteins into the cytoplasm, centrifuged at 55,565 g for 1 hour, and the resultant supernatant concentrated with a Microcon C-30 (Millipore, Watford, UK). To better localize the PLCz origin, sperm samples were also fractionated with Triton X-100 (by incubation with PBS/0.5% Triton X-100 for 30 minutes and further centrifuged at 2000 g for 10 minutes), retaining the supernatant and pellet for analysis. A cocktail of protease inhibitors (Roche Diagnostics) was used throughout these procedures. Whole sperm and sperm extracts for sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS- PAGE) analysis were prepared as described previously (23). Protein concentration was determined using the BCA Protein Assay (Pierce Biotechnology) and sperm protein extracts stored at 80 C to await further analysis. Generation of Recombinant Mouse PLCz Protein Full-length mouse PLCz cdna was isolated by PCR from a construct in which the full-length mouse PLCz had been linked to EYFP (24) and ligated into the pgex2tkp GST fusion protein expression vector (GE Healthcare Life Sciences, Amersham, UK). The construct was verified by DNA sequencing (MWG Biotech). Recombinant mouse PLCz was synthesized by transforming the mouse PLCz-pGEX2TKP construct into BL21-CodonPlus (DE3)-RIL competent cells (Stratagene, La Jolla, CA). Cultures were grown to an appropriate cell density and protein expression induced overnight at 16 C using isopropyl-b-d-thiogalactopyranoside. Induced cultures were centrifuged at 5000 g for 15 minutes, the supernatant removed, and pelleted cells resuspended in PBS/ protease inhibitor containing 0.5% Triton X-100 (Sigma, Poole, UK) and lysed on ice by sonication. The sonicated lysate was spun at 15,000 g for 30 minutes and added to equilibrated Glutathione Sepharose 4 Fast Flow (GE Healthcare Life Sciences) in a 4:1 ratio (sample/beads). The lysate/ bead mixture was incubated for 30 minutes on a rotator at room temperature and centrifuged for 3 minutes at 2000 g. The supernatant was removed and the pelleted beads washed twice with PBS/protease inhibitor containing 0.5% Triton X-100 followed by a final wash in PBS only. Recombinant mouse PLCz was stored on the beads in PBS at 25 Cto await further analysis. Immunoblotting Protein samples (100 mg) were separated by SDS-PAGE on a 10% gel and immunoblots prepared as described previously (25). Membranes were blocked in PBS containing 0.5% Tween (Sigma) and 5% dry skimmed milk for 1 hour at room temperature, incubated overnight at 4 C with 25 mg/ ml of anti-plcz antibody, then washed in PBS/0.5% Tween and incubated with horseradish peroxidase conjugated antirabbit IgG (1:10000; Sigma) for 1 hour at room temperature. Membranes were washed in PBS/0.5% Tween and specific bands visualized by chemiluminescence using enhanced chemiluminescence reagents (GE Healthcare Life Sciences). Induction of Capacitation and Use of Ionophore to Induce the Acrosome Reaction Mouse spermatozoa were collected from punctured cauda epididymi into 0.5 ml of modified Krebs-Ringer HEPES medium (KRH, ph 7.4) (26). After 10 minutes, epididymi were removed and the sperm suspension covered with 0.5 ml of fresh KRH, followed by a further 15 minutes at 37 C to allow sperm to swim up. Cell concentration was assessed using a Neubauer hemocytometer (Weber Scientific International, Teddington, UK). For in vitro capacitation, mouse sperm were diluted to cells/ml with Krebs- Ringer Bicarbonate medium (KRB, ph 7.4), similar to KRH except that 25 mmol/l NaHCO 3 was used instead of HEPES, and was supplemented with 5 mg/ml bovine serum albumin (BSA) (27). Some aliquots were processed immediately after swim-up (non-capacitated samples), whereas others were incubated for 90 minutes at 37 C under 5% CO 2 /95% air (capacitated samples). The medium used for hamster capacitation was a modified Tyrodes solution supplemented with 0.1 mmol/l sodium pyruvate, 1 mg/ml of polyvinyl alcohol, and 9 mg/ml of BSA (Fraction V; Sigma) (28, 29). Motility stimulators D-penicillamine (0.02 mmol/l), hypotaurine (0.1 mmol/l), and epinephrine (1 mm) were added just before use. Highly motile hamster epididymal sperm subpopulations were also obtained by using an established swim-up procedure (30). To perform in vitro capacitation, the collected suspensions were then diluted to cells/ml and incubated for 4 hours at 37 C, 5% CO 2 /95% air. To induce the acrosome reaction, aliquots of capacitated hamster and mouse spermatozoa were treated with calcium ionophore A23187 (Sigma) at final concentrations of 2 and 5 mm, respectively, for 30 minutes at 37 C under 5% CO 2 / 95% air (ionophore-treated samples). The acrosomal status of hamster samples was evaluated directly, by phase contrast microscopy according to previously described methodology (31, 32). For the mouse samples, acrosomal status was evaluated in permeabilized cells by incubation with 5 mg/ml of fluorescein isothiocyanate-conjugated Peanut agglutinin 2232 Young et al. Localization of PLCz in sperm Vol. 91, No. 5, Supplement, May 2009

4 (FITC-PNA; Invitrogen, Paisley, UK [33]) for 15 minutes at 37 C in the dark. At least 200 cells were evaluated, in duplicate, under a fluorescence microscope (DM5000B; Leica, Milton Keynes, UK) and results expressed as the mean percentage of intact acrosome cells SEM. Immunofluorescence Studies For immunofluorescence studies, aliquots of hamster and mouse non-capacitated, capacitated, and ionophore-treated sperm were concentrated by centrifugation at 800 g for 3 minutes (room temperature), washed in 1 ml of PBS, and fixed with in PBS/4% paraformaldehyde for 30 minutes at room temperature. After two washes in PBS by centrifugation, sperm suspensions were diluted as appropriate, added to PAP molds (Vector Laboratories, Peterborough, UK) drawn on slides precoated with 0.01% poly-l-lysine (Sigma), air dried, and permeabilized for 20 minutes with 0.5% Triton X 100. The slides were then washed twice with PBS, and nonspecific binding sites were blocked with PBS/5% BSA (Sigma) for 1 hour at room temperature. Samples were incubated overnight at 4 C with anti-plcz antibody (25 mg/ml) in PBS/0.05% BSA, whereas negative controls were incubated in the absence of primary antibody. Samples were washed in PBS and incubated at room temperature for 1 hour with 5 mg/ml of secondary fluorescent antibody (Alexa Fluor 546 F [ab ] 2 fragment goat anti-rabbit IgG; Invitrogen). Slides were then stained with 5 mg/ml FITC-PNA and 2 mg/ ml Hoechst (Sigma) for 15 minutes at 37 C in the dark, washed with PBS and mounted (Prolong Gold Antifade Mounting Reagent; Invitrogen) for analysis. Controls used preincubation of the first antibody with an excess of corresponding immunogenic peptide. Immunofluorescence, along with FITC-PNA and Hoechst staining, was visualized by laser scanning confocal microscopy (Zeiss, Welwyn Garden City, UK) using HeNe, argon, and ultraviolet lasers at wavelengths of 543 nm, 488 nm and 364 nm, respectively. Images were collected in the Multitrack mode, which alternates laser lines to reduce bleed-through. The localization of PLCz in non-capacitated, capacitated, and ionophore-treated samples was evaluated under a fluorescence microscope (DM5000B; Leica) and different patterns of distribution scored. In a second batch of experiments, addressing whether observed patterns of immunostaining might be associated with protein translocation mechanisms or the simple unmasking of protein within tissue samples, we treated non-capacitated, capacitated, and ionophore-treated mouse and hamster samples with 0.5% Triton-X 100 (Sigma) for 1 hour before fixation. Then, samples were processed by immunofluorescence as described above. Statistical Analysis Results are presented as mean SEM of the number of samples evaluated in each case. Analysis of variance was performed to compare the means of acrosome intact cells and PLCz localization pattern in non-capacitated, capacitated, and ionophore-treated samples. Post hoc comparisons were performed using Tukey s test (GraphPad InStat, San Diego, CA). Peptide block data were analyzed using Image J software ( RESULTS Cloning of Hamster PLCz The hamster has been an important model species for studying sperm processes such as capacitation and the acrosome reaction (34), as well as the mechanism of egg activation (35). The mammalian sperm factor activity now thought to be PLCz was first identified in hamster sperm (36). We therefore decided to isolate and clone hamster PLCz so that we could carry out studies in this species. Full-length hamster PLCz cdna was obtained by RT-PCR of hamster testis mrna using primers based on other mammalian PLCz sequences. The full-length cdna is 1953 bp in size, encoding an open reading frame of 651 amino acids, shares 77% amino acid identity and 85% amino acid similarity with mouse PLCz (Fig. 1), and has a predicted pi of 6.02 and molecular mass of kda. It exhibits the same domain structure as all other PLCz isoforms: an EF-hand domain, a catalytic X-Y domain, and a C2 domain, but no PH domain, as well as displaying catalytically important residues. Phylogenetic analysis demonstrated clear monophyly between monkey, human, mouse, hamster, and chicken PLCz isoforms with PLCd1 isoforms as outgroup sequences (Fig. 2). Tissue Specificity and Expression During Spermatogenesis of Hamster PLCz mrna To look at the tissue specificity of hamster PLCz mrna we used RT-PCR and Northern blot analysis. Reverse transcriptase polymerase chain reaction generated a band of the expected size only with testis cdna (Fig. 3A). Northern analysis confirmed that hamster PLCz mrna was present only in the testis and not other tissues and was the predicted size (Fig. 3B). Northern analysis was also used to study expression of PLCz mrna during spermatogenesis in the hamster, using testicular tissue obtained from animals at 0, 5, 10, 17, 30, and 63 days after birth, these time points being based on a previous study that determined the time frame for the appearance of specific types of germ cells in neonate hamsters (37). We found that hamster PLCz mrna could not be detected in testicular tissue until day 17 onward (Fig. 3C), corresponding to the time that early meiotic spermatocytes first appear (37). Pattern of Localization of PLCz in Non-capacitated Sperm and Those That Have Undergone Capacitation and the Acrosome Reaction We next carried out studies to identify the pattern of localization of PLCz in mature epididymal sperm and how this changes during capacitation and the acrosome reaction. First we generated an affinity-purified polyclonal antibody against mouse and hamster PLCz N- and C-terminal amino acid sequences. Immunoblotting confirmed that the antibody Fertility and Sterility â 2233

5 FIGURE 1 Multiple sequence alignment of hamster, mouse, and chicken PLCz proteins. Identical residues indicated by black shading, conserved residues by dark grey shading, and similar residues by light grey shading. y Catalytically important residues; z residues vital for Ca 2þ binding; # residues forming a putative phosphoinoside binding site. Small bold dots represent EF Hand, X and Y domains, and C2 domain. Large black dots indicate positions of peptides used to create the polyclonal antibody. detected a recombinant GST fusion hamster PLCz protein of the expected size (approximately 100 kda) (Fig. 4A) and a major protein band in mouse and hamster sperm of the expected molecular weight for endogenous PLCz in these species (approximately 74 kda) (Fig. 4B). These protein bands were not detected in similar immunoblots using preimmune sera (data not shown). Other, more minor bands were observed, which may be breakdown products of PLCz or alternatively, unrelated proteins. We then used these antibodies to carry out immunofluorescence studies. In these experiments, as well as carrying out immunofluorescence studies with anti-plcz, we also used FITC-PNA and Hoescht staining to identify the acrosome and the sperm nucleus, respectively. Analysis showed that 78.6% of non-capacitated sperm possessed an intact acrosome (Table 1), indicating a small proportion (21.4%) of acrosomal loss in some sperm, presumably due to the trauma of physical handling. In acrosome-intact non-capacitated sperm, PLCz appeared to be primarily localized within, or in close vicinity, to the acrosome (Fig. 5A). Quantitative analysis (Table 1) showed that 88.2% of non-capacitated, acrosome-intact, mouse sperm, exhibited immunofluorescence for PLCz in the acrosomal region. Of these, 36.2% exhibited immunofluorescence only in the acrosomal region. Co-staining with FITC-PNA revealed the protein to be apparently located within a subsection of the acrosomal region (Fig. 5A D). Of the sperm exhibiting PLCz in the acrosomal region, 52.0% also exhibited a further fluorescent signal in the post-acrosomal region, the predicted location of the endogenous egg activation factor (20), which was less prominent than that seen in the acrosomal area. We 2234 Young et al. Localization of PLCz in sperm Vol. 91, No. 5, Supplement, May 2009

6 FIGURE 2 Dendrogram of PLCz, and PLCd1 sequences. The topology of this dendrogram is supported by boostrap values of 100% at all internal nodes. FIGURE 3 (A) Tissue expression of hamster PLCz as detected by RT-PCR. Target PCR product is 500 bp. (B) Northern hybridization demonstrating tissue specificity of hamster PLCz. (C) Northern hybridization demonstrating developmental expression of hamster PLCz at 5, 10, 17, 30, 63 days after birth. T ¼ testis; L ¼ liver; H ¼ heart; K ¼ kidney; Lu ¼ lung; -ve ¼ negative control. also observed a small cohort of sperm (11.8% of non-capacitated sperm) in which immunofluorescence for PLCz was only evident in the post-acrosomal region. We next investigated whether capacitation and the acrosome reaction, induced in vitro, could influence the localization of PLCz within epididymal sperm. When mouse sperm underwent capacitation in vitro, it was apparent that the number of sperm cells possessing an intact acrosome was further reduced from 78.5% to 52.4% (Table 1), indicating spontaneous acrosome reaction during the incubation or possibly the effect of further physical trauma during the manipulations involved with in vitro capacitation. Analysis showed that PLCz immunofluorescence in the acrosomal region remained at levels similar to non-capacitated sperm (77.3%). Quantitative analysis showed that the frequency of PLCz detection in the acrosomal region alone had fallen from 36.2% in non-capacitated sperm to just 10.2% in capacitated sperm (Table 1). However, the detection of PLCz immunofluorescence in the post-acrosomal region alone had almost doubled from 11.8% in non-capacitated sperm to 22.7% in capacitated sperm. Immunofluorescence in the post-acrosomal region was much more intense, showing a clear signal around the base of the sperm nucleus, indicating either an increase in the amount of PLCz protein in that region or a change in its accessibility to antibody (Fig. 5E H). We next investigated the effect of inducing the acrosome reaction in vitro by treating sperm with an ionophore. During these experiments, it was evident that only 22.4% of resulting sperm still possessed an intact acrosome (Table 1), indicating that the in vitro induction had been very successful. In 53.9% of ionophoretreated sperm, there was still evidence of PLCz immunofluorescence in both the acrosomal and post-acrosomal region. However, in these cases, there was strong immunofluorescence in the post-acrosomal region but only very weak immunoreactivity in acrosomal regions. More evident was the fact that the acrosome reaction was clearly associated with a marked reduction in the proportion of sperm exhibiting immunofluorescence for PLCz in the acrosomal region alone (to just 6.4%; Table 1), concomitant with a dramatic increase in the proportion of sperm exhibiting PLCz in the post-acrosomal region alone (46.1%; Table 1). Immunofluorescence experiments carried out without the primary antibody (Fig. 5M P) did not show any immunofluorescent signal for PLCz. Moreover, both patterns of immunolocalization (acrosomal and post-acrosomal) were abolished in experiments in which the primary antibody was preincubated with excess immunogenic peptides (Fig. 5Q and R). Statistical analysis showed that there was a significant reduction (P<.001) of fluorescence signal in samples processed with primary antibody that had been preincubated with immunogenic peptides. Similar quantitative immunofluorescent studies involving hamster sperm revealed a very similar pattern of events (Fig. 6, Table 1), confirming that the observed changes in PLCz localization during capacitation and after ionophoretreatment are a feature common to both species. Once again, immunofluorescence experiments carried out without the Fertility and Sterility â 2235

7 FIGURE 4 (A) Immunoblot with anti-plcz antibody demonstrating detection of recombinant mouse GST-PLCz (approximately 100 kda). (B) Immunoblot blot with anti-plcz antibody demonstrating presence of immunoreactive bands indicative of PLCz at approximately 74 kda in (1) mouse sperm and (2) hamster sperm. (C) Immunoblot of untreated intact mice sperm (lane 1) and the soluble fraction obtained after incubating mouse sperm with Triton X-100 (which should correspond to the acrosomal PLCz population) (lane 2), and Triton extracted sperm (which should contain the post-acrosomal PLCz population) (lane 3). An expected protein band of approximately 74 kda was observed in intact sperm and was also present in the Triton-extracted sperm (lanes 1 and 3), in line with the postacrosomal PLCz population corresponding to full length PLCz. However, full-length PLCz was not detected in the Triton-soluble fraction (lane 2). Instead we observed a new prominent protein band at approximately kda (asterisk) in this fraction that is not obvious in either of the other two samples. might be improved by altering the conditions under which immunofluorescence was carried out. When we permeabilized mouse sperm with Triton X-100, a non-ionic detergent, before fixing, a clear immunofluorescent signal was obtained in the post-acrosomal region that was of the same high intensity in non-capacitated, capacitated, or ionophore-treated sperm (Fig. 7A L). No acrosomal PLCz staining was obtained in this case, probably because the acrosome itself was disrupted by this treatment (Fig. 7A L). Similar findings were obtained with hamster sperm (Fig. 7M X). The fact that treatment of sperm with Triton disrupted the acrosomal PLCz population but not the post-acrosomal one suggested a way to begin investigating the identity of the proteins recognized in the immunofluorescence studies. To do this we carried out immunoblotting of untreated mouse sperm, as well as the soluble fraction obtained after incubating sperm with Triton (which should correspond to the acrosomal PLCz population), and the Triton-extracted sperm (which should contain the post-acrosomal PLCz population). We found that although the expected approximately 74-kDa protein we observed in intact sperm was also present in the Triton-extracted sperm (Fig. 4C), indicating that the postacrosomal PLCz population corresponds to full-length PLCz, in the Triton-soluble fraction we did not observe this fulllength PLCz. Instead we observed a new prominent protein band at approximately kda in this fraction that is not obvious in the untreated or Triton-extracted sperm (Fig. 4C). DISCUSSION Cloning and Characterization of Hamster PLCz In the first part of the present study, PLCz was cloned from the hamster, a valuable animal model. In common with other PLCz isoforms (7, 9 11), hamster PLCz is sperm-specific and composed of an EF-hand domain, a catalytic X-Y domain, and a C2 domain, but lacks a PH domain. Moreover, at kda, the predicted molecular mass of hamster PLCz is in line with isoforms from other species. Phylogenetic analysis further demonstrated clear monophyly between monkey, mouse, hamster, and chicken PLCz (7, 9 11). Isolation of PLCz in the hamster is likely to prove invaluable for future work in this field because it represents a highly useful reproductive model, particularly in the areas of capacitation and acrosome reaction (32) and egg activation at fertilization (35, 36). primary antibody (Fig. 6M P), or after preincubation with excess immunogenic peptides (Fig. 6Q and R; P<.0001), did not show any immunofluorescence in the acrosomal or post-acrosomal region. We next investigated whether the apparent increase in the intensity of the post-acrosomal PLCz population during capacitation was due to an actual movement of the protein to this region, or alternatively to changes in the accessibility of the protein to the antibody. If the latter is true, we reasoned that our ability to detect PLCz in the non-capacitated state PLCz mrna Is First Expressed in Spermatocytes in Hamsters Determining the stage of spermatogenesis in which PLCz is first expressed is important in terms of understanding the mechanisms underlying its generation in the testis. It also has practical implications for the development of techniques, such as intracytoplasmic sperm injection and round spermatid injection, to produce both human and animal offspring (38), because identifying when sperm precursor cells begin to generate their own endogenous egg activation agent would 2236 Young et al. Localization of PLCz in sperm Vol. 91, No. 5, Supplement, May 2009

8 TABLE 1 Phospholipase Cz distribution and the evaluation of acrosomal status in non-capacitated, capacitated, and ionophore-treated sperm. Mouse Hamster NC C IT NC C IT Immunopattern Ac a b,d c,d a b b AcPa a b Pa a,d d,e c,f a c Acrosome-intact cells (%) f g h f g h Note: Percentage (mean SEM) of different localization patterns (n ¼ 5) and acrosome-intact cells (n ¼ 6). Data refer to Fig. 5A, E, I and Fig. 6A, E, I (mouse) and Fig. 7A, E, I (hamster). NC ¼ non-capacitated; C ¼ capacitated; IT ¼ ionophoretreated; Ac ¼ acrosomal; AcPa ¼ acrosomal and post-acrosomal (sample grouping includes intact sperm and sperm that appear to be either just starting or are close to completing the acrosome reaction); Pa ¼ post-acrosomal. For each species, columns annotated with different superscripts indicate significant differences: a-b, e-f P<.05. a-c P<.01. f-g, f-h, g-h P<.001. d not significantly different. be of great importance in optimizing these strategies (39). Previous studies have investigated the expression profile of PLCz mrna, showing that in mice PLCz mrnawas detectable in spermatids and not in testicular cells depleted of spermatids (7), whereas a more systematic study of PLCz mrna expression during spermatogenesis in mice and pigs concluded that PLCz mrna was first present in the round spermatid stage and most likely translated in elongated spermatids (10). In the present study we carried out Northern analysis of testes from a time-course of postnatal hamsters to study PLCz mrna expression during spermatogenesis and found that PLCz mrna was present at day 17, which is when meiotic spermatocytes first appear in this species (37). This apparent earlier pattern of expression of PLCz mrna compared with previous reports may reflect species differences, as well as the fact that we used Northern blotting rather than RT-PCR to analyze expression. Certainly, our data represent the first time that a fully quantitative method has been used to study PLCz mrna expression during spermatogenesis. The fact that we see an apparently slightly earlier temporal pattern of expression for hamster PLCz mrna compared with that previously reported for mouse PLCz mrna is interesting given that a previous study showed that egg activation occurred during round spermatid injection in hamsters, but not in mice (39). PLCz May Undergo Changes During Capacitation in Preparation for its Role in Egg Activation Our identification of a post-acrosomal pattern of localization for one of the PLCz populations is in line with this protein being involved in the process of egg activation, given that this is the region in which previous studies have predicted the endogenous egg activation factor to be located (20). Importantly, we show for the first time that this population of PLCz is still present in the sperm after the acrosome reaction, another important feature of any putative egg activation factor. Intriguingly, however, the post-acrosomal PLCz population is far less immunoreactive in non-capacitated sperm compared with that in capacitated and ionophore-treated sperm. This could be owing to either an actual movement of PLCz protein into the post-acrosomal region during capacitation or a change in the accessibility of the protein to antibody. The fact that the post-acrosomal pattern of immunofluorescence is greatly increased, and of a similar intensity to that in capacitated and ionophore-treated sperm, if we treat with Triton, a non-ionic detergent, before fixing, provides evidence for the latter possibility. Phospholipase Cz could possibly become more accessible to antibody after capacitation because of physiologic changes in the sperm membrane (40, 41), but it could also be because PLCz undergoes a conformational change during capacitation or a changing interaction with other proteins (42, 43). Previous studies of the endogenous egg activation factor in mouse sperm have suggested that it is bound to the perinuclear theca (14). It would be of interest in future studies to determine whether the apparent change in accessibility of PLCz to antibody during capacitation reflects changes in the interaction of the protein with this sperm component and whether this helps to prepare PLCz for release into the egg cytoplasm. PLCz May Be Involved in Other Processes Besides Egg Activation, Such as the Acrosome Reaction Our data demonstrate that in mouse and hamster sperm, PLCz seems to exist predominantly in the post-acrosomal Fertility and Sterility â 2237

9 FIGURE 5 Immunofluorescent studies in (A D) non-capacitated, (E H) capacitated, and (I L) ionophore-treated mouse sperm. (M P) Secondary antibody alone. (A, E, I, M) Anti-PLCz immuofluorescence. (B, F, J, N) FITC-PNA-lectin staining identifying acrosome. (C, G, K, O) Sperm nucleus stained with Hoescht (D, H, L, P) Merged fluorescent and brightfield data. (Q, R) Merged fluorescent and brightfield PLCz immunolocalization, in (Q) absence and (R) presence of immunogenic peptide. Arrows indicate position of positive PLCz immunoreactivity. Original photographs taken at 63 magnification with 3.5 digital zoom. region, the expected location of the egg activation factor, but with an additional, smaller population in the acrosomal region. These observations would seem to be in agreement with the preliminary findings of an earlier report concerning mouse sperm (14), in which the investigators described PLCz as being located predominantly in the post-acrosomal region, but with an apparent second population located in more a peripheral region loosely associated with the perinuclear matrix, a macromolecular assembly surrounding the nuclear membrane. The authors of this earlier report postulated that this peripheral population of PLCz would be easily removed from the perinuclear matrix and would therefore swiftly engage the ooplasm after gamete fusion to facilitate rapid activation (14). It was further suggested that each 2238 Young et al. Localization of PLCz in sperm Vol. 91, No. 5, Supplement, May 2009

10 FIGURE 6 Immunofluorescent studies in (A D) non-capacitated, (E-H) capacitated, and (I L) ionophore-treated hamster sperm. (M P) Secondary antibody alone. (A, E, I, M) Anti-PLCz immuofluorescence. (B, F, J, N) FITC-PNA-lectin staining identifying acrosome. (C, G, K, O) Sperm nucleus stained with Hoescht (D, H, L, P) Merged fluorescent and brightfield data. (Q, R) Merged fluorescent and brightfield PLCz immunolocalization, in (Q) absence and (R) presence of immunogenic peptide. Arrows indicate position of positive PLCz immunoreactivity. Original photographs taken at 63 magnification with 3.5 digital zoom. subpopulation might play a distinct role: the peripheral population in the induction of egg activation and the second post-acrosomal population to modulate pronuclear function (14 16). Although not addressed specifically or quantitatively, the published data (14) seem to indicate that the minor peripheral population of PLCz was located to a region close to the acrosome. In the present study we were also able to clearly demonstrate a predominant population of PLCz in the post-acrosomal region of sperm along with a second population associated with the acrosome. Peptide-blocking experiments, along with quantitative image analysis, clearly showed that binding of the PLCz antibody to these two regions was specific. We also provide additional evidence to support the existence of a second population of PLCz in Fertility and Sterility â 2239

11 FIGURE 7 Immunofluorescent studies in non-capacitated (A D) mouse and (M P) hamster, capacitated (E H) mouse and (Q T) hamster, and ionophore-treated (I L) mouse and (U X) hamster sperm treated with Triton X-100 before fixing. (A, E, I, M, Q, U) Immunofluorescent images of PLCz localization. (B, F, J, N, R, V) FITC-PNA-lectin staining indicating absence of acrosome in these samples. (C, G, K, O, S, W) Hoescht staining of sperm nucleus. (D, H, L, P, T, X) Merged fluorescent and brightfield data. Arrows indicate position of positive PLCz immunoreactivity. Original photographs taken at 63 magnification with 3.5 digital zoom Young et al. Localization of PLCz in sperm Vol. 91, No. 5, Supplement, May 2009

12 the acrosomal region by using an FITC-PNA antibody. A further study described the immunofluorescent localization of PLCz in mouse and bull sperm using two polyclonal antibodies (raised against the N- and C-termini of PLCz) (21). Immunofluoresence studies, including peptide-block specificity tests, indicated that PLCz was localized only to the post-acrosomal region and the equatorial segment in non-capacitated and non-acrosome-reacted mouse and bull sperm, respectively. The investigators also reported immunofluorescence in the acrosomal region of both mouse and bull sperm but reported this to be nonspecific in origin because they could not complete it using a peptide block (21). The present study extends these earlier immunolocalization studies by investigating how the immunoreactivity of the acrosomal and post-acrosomal populations of PLCz might be influenced by important physiologic mechanisms associated with the capacitation and the acrosome reaction, vital prerequisites to successful sperm maturation. Our data are notable in that they additionally demonstrate an acrosomal population of PLCz which seems to disappear during the acrosome reaction, perhaps suggesting that PLCz may play a role in this important process. The conclusions of a previous study (14) suggested that a peripheral population of PLCz was responsible for egg activation, whereas the predominant post-acrosomal population was thought to modulate pronuclear activity. The present data, although also detecting a second, peripheral population of PLCz, which was shown to be associated with the acrosomal region, rather suggests a function role associated with the acrosome reaction, whereas post-acrosomal PLCz remains responsible for egg activation. The main caveat to the potential involvement of PLCz in the acrosome reaction are our immunoblotting studies, which show that a prominent immunoreactive protein of approximately 74 kda, the expected molecular weight for full-length PLCz, is present in Triton-extracted sperm as it is in whole sperm, but is not apparently present in the Triton-soluble fraction, which contains the acrosomal contents. On the other hand, the detection of minor bands of lower molecular weight specifically recognized by our antibody could correspond to proteolytic fragments of PLCz that have been shown in a previous study to maintain (Ca 2þ ) oscillatory and PLC activity (13). The fact that a prominent immunoreactive band of approximately kda appears in this fraction, that is not obvious in whole sperm, is suggestive of the possibility that this is a breakdown product of PLCz, breakdown possibly having been triggered by the release of acrosomal contents. However, further investigation of the identity of this protein band is required before we can confirm this. There is certainly ample scope for involvement of sperm PLCs in the acrosome reaction. It has been known for some time that the acrosome reaction is activated by Ca 2þ signals, through both Ca 2þ influx and release of Ca 2þ from intracellular stores (44, 45), but the molecular components underlying these signalling events remain to be fully resolved. A number of studies have suggested that phosphoinositide-specific PLCs play an essential role in the acrosome reaction (46). The most direct evidence is that for PLCd4, induced acrosomal exocytosis in response to zona pellucida (ZP) or P treatment being impaired in mice in which this gene has been knocked out (47, 48). Phospholipase Cg has also been implicated by virtue of the fact that it translocates from the soluble to the particulate fraction during capacitation, and its enzymatic activity is increased in ZP-treated sperm, an effect blocked by tryphostin (49) an inhibitor that also suppresses ZP-induced acrosomal exocytosis (50). Phospholipase Cb has been suggested to play a role in the acrosome reaction because PLCb1, PLCb3, and their Ga q/11 activator proteins have been localized to the acrosomal region of mouse sperm (51), and the acrosome reaction seems to be impaired in PLCb1 knockout mice (52). Now our findings suggest that PLCz could also play a possible role in the acrosome reaction, or at least in other sperm processes besides egg activation. At present no one has generated a PLCz knockout mouse strain, but if such a strain becomes available it would be interesting to determine whether sperm from such animals are deficient in the acrosome reaction or other sperm processes, as well as in their ability to activate the egg. Sperm from mice in which PLCz was knocked down by RNA interference were not reported to have defective acrosomal exocytosis, but then knockdown was only partial, resulting in a reduction of only 40% in PLCz protein levels (17). It would also be interesting in future studies to determine whether the acrosome reaction is accompanied by changes in the activity of PLCz or whether it undergoes posttranslational modifications or altered interactions with regulatory proteins during this process. Acknowledgments: The authors thank Professor Antony Galione for the use of his confocal microscope; Dr. Anthony Morgan for technical advice concerning confocal microscopy; and Teresa Tsakok and Victoria Crossland for technical assistance. REFERENCES 1. Runft LL, Jaffe LA, Mehlmann LM. Egg activation at fertilization: where it all begins. Dev Biol 2002;245: Stricker SA. Comparative biology of calcium signaling during fertilization and egg activation in animals. Dev Biol 1999;211: Swann K, Ozil JP. Dynamics of the calcium signal that triggers mammalian egg activation. Int Rev Cytol 1994;152: Fissore RA, Dobrinsky JR, Balise JJ, Duby RT, Robl JM. Patterns of intracellular Ca 2þ concentrations in fertilized bovine eggs. Biol Reprod 1992;47: Kline D, Kline JT. Thapsigargin activates a calcium influx pathway in the unfertilized mouse egg and suppresses repetitive calcium transients in the fertilized egg. J Biol Chem 1992;267: Kurokawa M, Sato K, Fissore RA. Mammalian fertilization: from sperm factor to phospholipase Cz. Biol Cell 2004;96: Saunders CM, Larman MG, Parrington J, Cox LJ, Royse J, Blayney LM, et al. PLCz: a sperm-specific trigger of Ca 2þ oscillations in eggs and embryo development. Development 2002;129: Saunders CM, Swann K, Lai FA. PLCz, a sperm-specific PLC and its potential role in fertilization. Biochem Soc Symp 2007;74: Cox LJ, Larman MG, Saunders CM, Hashimoto K, Swann K, Lai FA. Sperm phospholipase Cz from humans and cynomolgus monkeys triggers Ca 2þ oscillations, activation and development of mouse oocytes. Reproduction 2002;124: Yoneda A, Kashima M, Yoshida S, Terada K, Nakagawa S, Sakamoto A, et al. Molecular cloning, testicular postnatal expression, and oocyte- Fertility and Sterility â 2241

13 activating potential of porcine phospholipase Cz. Reproduction 2006;132: Coward K, Ponting CP, Chang HY, Hibbitt O, Savolainen P, Jones KT, et al. Phospholipase Cz, the trigger of egg activation in mammals, is present in a non-mammalian species. Reproduction 2005;130: Kouchi Z, Fukami K, Shikano T, Oda S, Nakamura Y, Takenawa T, et al. Recombinant phospholipase Czeta has high Ca 2þ sensitivity and induces Ca 2þ oscillations in mouse eggs. J Biol Chem 2004;279: Kurokawa M, Sato K, Wu H, He C, Malcuit C, Black SJ, et al. Functional, biochemical, and chromatographic characterization of the complete [Ca 2þ ] i oscillation-inducing activity of porcine sperm. Dev Biol 2005;285: Fujimoto S, Yoshida N, Fukui T, Amanai M, Isobe T, Itagaki C, et al. Mammalian phospholipase Cz induces oocyte activation from the sperm perinuclear matrix. Dev Biol 2004;274: Larman MG, Saunders CM, Carroll J, Lai FA, Swann K. Cell cycle-dependent Ca 2þ oscillations in mouse embryos are regulated by nuclear targeting of PLCz. J Cell Sci 2004;117: Yoda A, Oda S, Shikano T, Kouchi Z, Awaji T, Shirakawa H, et al. Ca 2þ oscillation-inducing phospholipase C zeta expressed in mouse eggs is accumulated to the pronucleus during egg activation. Dev Biol 2004;268: Knott JG, Kurokawa M, Fissore RA, Schultz RM, Williams CJ. Transgenic RNA interference reveals role for mouse sperm PLCz in triggering Ca 2þ oscillations during fertilization. Biol Reprod 2005;72: Kimura Y, Yanagimachi R, Kuretake S, Bortkiewicz H, Perry AC, Yanagimachi H. Analysis of mouse oocyte activation suggests the involvement of sperm perinuclear material. Biol Reprod 1998;58: Perry AC, Wakayama T, Yanagimachi R. A novel trans-complementation assay suggests full mammalian oocyte activation is coordinately initiated by multiple, submembrane sperm components. Biol Reprod 1999;60: Sutovsky P, Manandhar G, Wu A, Oko R. Interactions of sperm perinuclear theca with the oocyte: implications for oocyte activation, anti-polyspermy defense, and assisted reproduction. Microsc Res Tech 2003;61: Yoon SY, Fissore RA. Release of phospholipase C z and [Ca 2þ ] i oscillation-inducing activity during mammalian fertilization. Reproduction 2007;134: Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22: Schultz J, Milpetz F, Bork P, Ponting CP. SMART, a simple modular architecture research tool: identification of signaling domains. Proc Natl Acad Sci U S A 1998;95: Coward K, Kubota H, Hibbitt O, McIlhinney J, Kohri K, Parrington J. Expression of a fluorescent recombinant form of sperm protein phospholipase C zeta in mouse epididymal sperm by in vivo gene transfer into the testis. Fertil Steril 2006;85(Suppl 1): Parrington J, Jones ML, Tunwell R, Devader C, Katan M, Swann K. Phospholipase C isoforms in mammalian spermatozoa: potential components of the sperm factor that causes Ca 2þ release in eggs. Reproduction 2002;123: Lee MA, Storey BT. Bicarbonate is essential for fertilization of mouse eggs: mouse sperm require it to undergo the acrosome reaction. Biol Reprod 1986;34: Furimsky A, Vuong N, Xu H, Kumarathasan P, Xu M, Weerachatyanukul W, et al. Percoll gradient-centrifuged capacitated mouse sperm have increased fertilizing ability and higher contents of sulfogalactosylglycerolipid and docosahexaenoic acid containing phosphatidylcholine compared to washed capacitated sperm. Biol Reprod 2005;72: Stewart-Savage J. Effect of bovine serum albumin concentration and source on sperm capacitation in the golden hamster. Biol Reprod 1993;49: Visconti PE, Stewart-Savage J, Blasco A, Battaglia L, Miranda P, Kopf GS, et al. Roles of bicarbonate, camp, and protein tyrosine phosphorylation on capacitation and the spontaneous acrosome reaction of hamster sperm. Biol Reprod 1999;61: Nagdas SK, Winfrey VP, Olson GE. Tyrosine phosphorylation generates multiple isoforms of the mitochondrial capsule protein, phospholipid hydroperoxide glutathione peroxidase (PHGPx), during hamster sperm capacitation. Biol Reprod 2005;72: Talbot P, Summers RG, Hylander BL, Keough EM, Franklin LE. The role of calcium in the acrosome reaction: an analysis using ionophore A J Exp Zool 1976;198: Yanagimachi R, Phillips DM. The status of acrosomal caps of hamster spermatozoa immediately before fertilization in vivo. Gamete Res 1984;9: Tao J, Critser E, Critser JK. Evaluation of mouse sperm acrosomal status and viability by flow cytometry. Mol Reprod Dev 1993;36: Yanagimachi R. Mammalian fertilization. In: Knobil E, Neil JD, eds. The physiology of reproduction. New York: Raven Press, 1994: Miyazaki S. Cell signalling at fertilization of hamster eggs. J Reprod Fertil 1990;42: Swann K. A cytosolic sperm factor stimulates repetitive calcium increases and mimics fertilization in hamster eggs. Development 1990;110: Golan R, Weissenberg R, Oschry Y, Shochat L, Lewin LM. Spermatogenesis in the golden hamster during the first spermatogenic wave: a flow cytometric analysis. Mol Reprod Dev 2000;55: Tesarik J, Mendoza C, Greco E. Treatment of severe male infertility by micromanipulation-assisted fertilization: news and views. Front Biosci 1998;3:E Yazawa H, Yanagida K, Katayose H, Hayashi S, Sato A. Comparison of oocyte activation and Ca 2þ oscillation-inducing abilities of round/elongated spermatids of mouse, hamster, rat, rabbit and human assessed by mouse oocyte activation assay. Hum Reprod 2000;15: Visconti PE, Galantino-Homer H, Moore GD, Bailey JL, Ning X, Fornes M, et al. The molecular basis of sperm capacitation. J Androl 1998;19: Harrison RA, Gadella BM. Bicarbonate-induced membrane processing in sperm capacitation. Theriogenology 2005;63: Yeung CH, Perez-Sanchez F, Schroter S, Kirchhoff C, Cooper TG. Changes of the major sperm maturation-associated epididymal protein HE5 (CD52) on human ejaculated spermatozoa during incubation. Mol Hum Reprod 2001;7: Adeoya-Osiguwa SA, Fraser LR. Capacitation state-dependent changes in adenosine receptors and their regulation of adenylyl cyclase/camp. Mol Reprod Dev 2002;63: Breitbart H. Intracellular calcium regulation in sperm capacitation and acrosomal reaction. Mol Cell Endocrinol 2002;187: Evans JP, Florman HM. The state of the union: the cell biology of fertilization. Nat Cell Biol 2002;4(Suppl): Roldan ER, Shi QX. Sperm phospholipases and acrosomal exocytosis. Front Biosci 2007;12: Fukami K, Nakao K, Inoue T, Kataoka Y, Kurokawa M, Fissore RA, et al. Requirement of phospholipase Cdelta4 for the zona pellucida-induced acrosome reaction. Science 2001;292: Fukami K, Yoshida M, Inoue T, Kurokawa M, Fissore RA, Yoshida N, et al. Phospholipase Cd4 is required for Ca2þ mobilization essential for acrosome reaction in sperm. J Cell Biol 2003;161: Tomes CN, McMaster CR, Saling PM. Activation of mouse sperm phosphatidylinositol-4,5 bisphosphate-phospholipase C by zona pellucida is modulated by tyrosine phosphorylation. Mol Reprod Dev 1996;43: Leyton L, LeGuen P, Bunch D, Saling PM. Regulation of mouse gamete interaction by a sperm tyrosine kinase. Proc Natl Acad Sci U S A 1992;89: Murase T, Roldan ER. Progesterone and the zona pellucida activate different transducing pathways in the sequence of events leading to diacylglycerol generation during mouse sperm acrosomal exocytosis. Biochem J 1996;320: Choi D, Lee E, Hwang S, Jun K, Kim D, Yoon BK, et al. The biological significance of phospholipase C beta 1 gene mutation in mouse sperm in the acrosome reaction, fertilization, and embryo development. J Assist Reprod Genet 2001;18: Young et al. Localization of PLCz in sperm Vol. 91, No. 5, Supplement, May 2009