Vitrification has been used widely

Transcription

1 Effect of 5-aza-2 0 -deoxycytidine on methylation of the putative imprinted control region of H19 during the in vitro development of vitrified bovine two-cell embryos Xue-Ming Zhao, Ph.D., Jing-Jing Ren, M.Sc., Wei-Hua Du, Ph.D., Hai-Sheng Hao, Ph.D., Dong Wang, Ph.D., Yan Liu, Ph.D., Tong Qin, Ph.D., and Hua-Bin Zhu, Ph.D. Embryo Biotechnology and Reproduction Laboratory, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, People's Republic of China Objective: To determine the effect of vitrification and 5-aza-2 0 -deoxycytidine (5-aza-dC) on the methylation levels of the putative imprinted control region (ICR) of H19 and H19 expression in bovine two-cell embryos and their derived blastocysts. Design: Experimental animal study. Setting: Academic institution. Animal(s): Abattoir-derived bovine ovaries. Intervention(s): Vitrified two-cell embryos were cultured in vitro to blastocysts with 0.01 mm 5-aza-dC (5-aza-dC group) or without 5-aza-dC (vitrification group). Fresh embryos and their derived blastocysts were used as control. Main Outcome Measure(s): Putative ICR methylation of H19 was measured by bisulfate mutagenesis and sequencing, blastocyst development rate; total cell number were determined; and H19 expression was measured by real-time reverse transcriptasepolymerase chain reaction (PCR). Result(s): Vitrification significantly increased putative ICR methylation of H19 in two-cell embryos and their derived blastocysts; 5-aza-dC significantly reduced putative ICR methylation of H19 in vitrified two-cell embryos and their derived blastocysts. The H19 expression level was significantly higher in blastocysts from the 5-aza-dC group than the vitrification group. The blastocyst development rate and total cell number in the 5-aza-dC and vitrification groups were similar. Conclusion(s): Putative ICR methylation levels of H19 significantly increased in vitrified two-cell embryos and their derived blastocysts; 5-aza-dC significantly reduced putative ICR methylation of H19 and increased H19 expression in blastocysts derived from vitrified two-cell embryos. (Fertil Steril Ò 2012;98: Ó2012 by American Society for Reproductive Medicine.) Key Words: Vitrification, methylation, 5-aza-2 0 -deoxycytidine, putative imprinted control region of H19, embryo Vitrification has been used widely as an efficient approach to preserve mammalian oocytes and embryos (1, 2). In the past, researchers used common parameters, such as the survival rate and development Received December 20, 2011; revised March 21, 2012; accepted April 6, 2012; published online May 22, X.-M.Z. has nothing to disclose. J.-J.R. has nothing to disclose. W.-H.D. has nothing to disclose. H.-S.H. has nothing to disclose. D.W. has nothing to disclose. Y.L. has nothing to disclose. T.Q. has nothing to disclose. H.-B.Z. has nothing to disclose. Supported by grants from the National Natural Science Foundation of China ( ), the Basic Research Fund of Institute of Animal Science, Chinese Academy of Agricultural Sciences (2010jc-3-1), and the Genetically Modified Organisms Breeding Major Projects of China (2011ZX ). Reprint requests: Hua-Bin Zhu, Ph.D., Embryo Biotechnology and Reproduction Laboratory, Institute of Animal Science, Chinese Academy of Agricultural Sciences, No. 2 Yuanmingyuan Western Road, Haidian District, Beijing , People's Republic of China ( huabinzhu@yahoo. com.cn). Fertility and Sterility Vol. 98, No. 1, July /$36.00 Copyright 2012 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert potential, to assess the efficiency and safety of vitrification (3, 4); however, attention is now being paid to the epigenetic modifications induced by vitrification (5 7). Epigenetic modifications include differential DNA methylation, methylation/acetylation of histones, and production of antisense RNA (8, 9). Before fertilization, mammalian gametes are highly methylated (10). After fertilization, the paternal genome is demethylated by an active mechanism, whereas the maternal genome is demethylated by a passive mechanism (11). Until blastocyst developmental 222 VOL. 98 NO. 1 / JULY 2012

2 Fertility and Sterility stage, both maternal and paternal genomes are remethylated (12). And further development will be affected if the erasure and re-establishment of epigenetic markers fail (13, 14). During the in vitro embryos production, their epigenetic modifications can be influenced by many environmental conditions (6). The DNA methyltransferase inhibitor 5-aza deoxycytidine (5-aza-dC) is widely used to regulate the DNA methylation (15, 16). The 5-aza-dC treatment of donor cells in bovine somatic cell nuclear transfer has generated conflicting results on cloning efficiency (15 17). Researchers have investigated the effect of cryopreservation on DNA methylation in mammalian oocytes (7, 18 20), embryos (6), and oocytes from cryopreserved ovaries (21), and obtained conflicting results. In addition, no effective methods to positively regulate DNA methylation changes that occur during vitrification have been reported. Therefore, this study was designed to [1] observe the effect of vitrification on the putative imprinted control region (ICR) methylation levels of H19 in vitrified bovine two-cell embryos and their derived blastocysts, and [2] determine the effect of 5-aza-dC on the development rate, total cell number, putative ICR methylation of H19, and H19 expression level in blastocysts derived from vitrified two-cell embryos. MATERIALS AND METHODS All experimental protocols were in accordance with the requirements of the Institutional Animal Care and Use Committee of the Chinese Academy of Agricultural Sciences. All chemicals and media were purchased from Sigma Chemical Co. and plastics were obtained from Nunc-ware (Nunc; Nalge Nunc International), unless indicated otherwise. Open-pulled Straw Preparation Open-pulled straws were prepared according to the method described by Vajta et al. (1). Briefly, 0.25-mL plastic straws (I.M.V.) were heat-softened and manually pulled to a length of 2 3 cm, with an approximate outer diameter of 0.23 mm and wall thickness of 0.02 mm. Vitrification Solutions Vitrification solutions were prepared as previously described (22). The pretreatment solution composed of 10% ethylene glycol and 10% dimethyl sulfoxide (DMSO) in Dulbecco's phosphate-buffered saline (PBS) containing 3 mg/ml bovine serum albumin (BSA). The EDFS30 vitrification solution contained 15% ethylene glycol and 15% DMSO in FS solution (Dulbecco's PBS containing 300 mg/ml Ficoll, g/l sucrose, and 3 mg/ml BSA). In Vitro Maturation of Oocytes Bovine ovaries were collected from a local abattoir and transported to the laboratory within 2 hours in physiological saline solution (0.9% NaCl) at 30 C. Cumulus-oocyte complexes were aspirated from follicles 2 8 mm in diameter, and cumulus-oocyte complexes with at least three layers of compact cumulus cells were used. Groups of approximately 50 cumulus-oocyte complexes were cultured in 500 ml of maturation medium at 38.5 Cin5%CO 2 in air with maximum humidity. The maturation medium was Medium 199 (GIBCO BRL) supplemented with 10 mg/ml FSH, 10 mg/ml LH, 10 mg/ml E 2, 10% fetal bovine serum (FBS; GIBCO BRL), and 10 mg/ml heparin. Production of Bovine Two-cell Embryos by IVF In vitro fertilization was performed according to the method described previously (23) with some modifications. Cumulus-oocyte complexes were denuded of cumulus cells after in vitro maturation for hours by vortexing in 0.1% hyaluronidase for 2 3 minutes, and only oocytes with a first polar body and even distribution of cytoplasm were selected for IVF. One straw of frozen semen (Beijing Dairy Cattle Center) was thawed in a water bath (37 C), washed twice in Brackett and Oliphant medium containing 2.5 mmol/l caffeine by centrifugation at 1,800 rpm for 5 minutes and resuspended at /ml in Brackett and Oliphant medium supplemented with 20 mg/ml heparin, 100 mg/ml streptomycin, 100 IU/mL penicillin, and 20 mg/ml BSA. For insemination, a 20-mL aliquot of sperm suspension was added to each 80-mL droplet of Brackett and Oliphant medium containing oocytes. After hours of insemination, presumptive zygotes were cultured in Charles Rosenkrans medium with amino acids (CR1aa) (24) supplemented with 0.1% BSA for 48 hours, and then two-cell embryos were selected and divided into the following groups: [1] control group, two-cell embryos were cultured in vitro in CR1aa with 10% FBS for 5 days to the blastocyst stage; [2] vitrification group, two-cell embryos were vitrified and warmed, and embryos, which survived, were cultured in vitro in CR1aa with 10% FBS for 5 days to the blastocyst stage; [3] 5-aza-dC group, vitrified/thawed two-cell embryos were cultured in CR1aa with 10% FBS containing 0.01 mm 5-aza-dC for 48 hours, and then they were cultured in CR1aa with 10% FBS for 3 days to the blastocyst stage. Vitrification and Thawing of Bovine Two-cell Embryos Embryos were equilibrated in pretreatment solution for 30 seconds, loaded into an open-pulled straw with EDFS30 for 25 seconds, and plunged into liquid nitrogen. For warming, the two-cell embryos were rinsed in 0.5 M sucrose under mineral oil for 5 minutes, washed three times in CR1aa supplemented with 10% FBS, and the embryos that survived were morphologically evaluated. Only embryos that survived vitrification/thawing were used for blastocyst development and methylation analysis. DNA Methylation Analysis The putative ICR methylation levels of H19 were determined by bisulfate mutagenesis and sequencing as described by Borghol et al. (25). We analyzed 81 CpG sites within 1,898 bp of the putative ICR of H19 (GenBank accession no. GU371442) by polymerase chain reaction (PCR) using primers for VOL. 98 NO. 1 / JULY

3 ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY bisulfate-converted DNA (Table 1). The PCR conditions were 95 C for 3 minutes; 40 cycles of 95 C for 30 seconds, 53 C for 30 seconds, and 72 C for 40 seconds; followed by a final extension of 72 C for 5 minutes. Each PCR was performed on a pool of 100 two-cell embryos or 30 blastocysts. The PCR products were ligated into the pmd18-t vector (TaKaRa), transformed into Top10 cells (Transgene), and 10 clones of each PCR product were sequenced using the ABI PRISM-77 (Applied Biosystems). Identical bisulfite-modified sequences from separated PCR amplifications were considered to represent distinct chromosomes. Identical sequences from single product PCR amplifications were counted only once (25). Quantification of the H19 Expression by Real-time Reverse Transcription PCR Total RNA was isolated from pools of 60 fresh or vitrified blastocysts with TRIZOL reagent (Invitrogen) according to the manufacturer's instruction, dissolved in sterile water, and stored at 80 C. First-strand complementary DNA (cdna) was synthesized from 0.05 mg RNA using random hexamers. H19 messenger RNA expression was quantified using the primers listed in Table 2 on the ABI 7500 SDS (Applied Biosystems) according to the manufacturer's protocols. b-actin was used as a reference gene and the expression levels were calculated using the comparative Ct (2 DCt ) method (26). Total Cell Counts Blastocysts were treated with Dulbecco's PBS containing 0.25% pronase for 2 3 minutes to remove the zona pellucid (ZP), stained with 10 mg/ml Hoechst at 38.5 C for 10 minutes, washed three times in Dulbecco's PBS, and mounted on slides. The total cell number of each blastocyst was counted using fluorescence microscopy (Eclipse TE2000-u, Nikon). Statistical Analysis Each experiment was repeated at least three times and the results were presented as mean SE. Data were analyzed by one-way analysis of variance (ANOVA) with Duncan's test using SAS software (SAS Institute). Percentage data were subjected to arcsine transformation before analysis. P values <.05 were considered to be statistically significant. RESULTS Effect of 5-aza-dC on the Putative ICR Methylation Levels of H19 in Vitrified Two-cell Embryos and Their Blastocysts Figure 1 illustrates a representative sample of the bisulfite analysis of the putative ICR repetitive elements of H19 from the 5-aza-dC group. The putative ICR methylation level of H19 in vitrified two-cell embryos (71.4% 5.7%) was significantly higher than that of the control group (60.7% 3.5%; P<.05). The putative ICR methylation level of H19 in blastocysts from the vitrification group (72.2% 6.9%) was also significantly higher than blastocysts from the control group (52.8% 6.1%; P<.05; Fig. 1B). However, the putative ICR methylation level of H19 in blastocysts from the 5-aza-dC group (57.1% 4.3%) was significantly lower than that of the vitrification group (P<.05) and similar to that of the control group (P>.05). Effect of 5-aza-dC on the Development Potential of Vitrified Bovine Two-cell Embryos As shown in Table 3, the blastocyst development rates of the vitrification group (20.5% 2.7%) and 5-aza-dC group (24.8% 3.6%) were significantly lower than the control TABLE 1 Primers used for amplification of bisulfite-treated DNA. Primer no. Amplification interval (bp) Sequences Product size (bp) F: AGTTGTTGGGTGTGGATT 268 R: CACAACCCTATTTTAAAATATAACC F: ATAGGGTAGTGTGTAGAGGATATTGG 184 R: CCTATAATATACAAACCCCCCC F: GGGGGGGTTTGTATATTATAGG 298 R: AAAAACTATAAAATCCTCCTACCCTC ,025 F: GAGGGTAGGAGGATTTTATAGTT 351 R: CAAACTACCATCCTCCAACCT 5 1,000 1,201 F: TTTTTAGGTTGGAGGATGGTA 202 R: AAACCTTCAACATTTCAAACAA 6 1,180 1,449 F: TTGTTTGAAATGTTGAAGGTTT 270 R: ATACAATAAAATCCACACCCAA 7 1,413 1,633 F: GGAGTTTATGAGTTGTTGGGT 221 R: AAAACCCCAATATCCTCTACAC 8 1,593 1,814 F: TAYGGTGATATAGGGTAGTGTG 222 R: ATACRAACCCRAAATACC 9 1,721 1,958 F: AGGYGGTAGTGTAGGTTTA 238 R: ATAAAAATCCCTCATTATCCC Note: F ¼ forward primer; R ¼ reverse primer; H19 putative imprinted control region GenBank accession no. GU VOL. 98 NO. 1 / JULY 2012

4 Fertility and Sterility TABLE 2 Primer sequences, expected fragment sizes of H19 and b-actin genes. Gene Primers Size (bp) GenBank accession no. Annealing temperature ( C) H19 GATATGGTCCGGTGTGATGGAGAG 134 NR_ GTCTGAAGAGCAGCAGTGGTGTG b-actin TCCTGGGCATGGAATCCTG 199 NM_ GGCGCGATGATCTTGATCTTC group (35.2% 4.5%; P<.05). The blastocyst development rate of the 5-aza-dC group was higher than the vitrification group, but this difference was not statistically significant (P>.05). Similar total cell numbers were observed in blastocysts from the 5-aza-dC group ( ) and vitrification group ( ). Effect of 5-aza-dC on the Expression Level of H19 in Blastocysts Derived from Vitrified Two-cell Embryos As shown in Figure 1C, the relative expression of H19 in blastocysts from the vitrification group was significantly lower than blastocysts from the control group (P<.05). However, when vitrified two-cell embryos were cultured to the blastocyst stage in the presence of 0.01 mm 5-aza-dC, the relative expression level of H19 significantly increased but remained lower than the control group (P<.05). DISCUSSION H19 is located on bovine chromosome 29 (27). Many studies have indicated that the H19 ICR is sensitive to manipulation (28, 29) such as in vitro culture and ovarian stimulation (30, 31). Development of the fetus and placenta are regulated by H19 by expression of Igf2 (32, 33) and disorders in the H19 ICR lead to diseases of dominant inheritance in children born by assisted reproduction technology (ART) (34). As the most studied model of epigenetic modification, we analyzed the effect of vitrification and 5-aza-dC on the methylation level of H19 ICR. De novo methylation usually occurs at the 8- to 16-cell stage in normal bovine embryos. Therefore vitrified two-cell FIGURE 1 (A) Bisulfate sequencing results for a representative sample of blastocysts derived from vitrified two-cell embryos of the 5-aza-2 0 -deoxycytidine (5- aza-dc) group. Each line represents a unique DNA clone; filled and open circles represent methylated and unmethylated CpGs, respectively. (B) The percentage of methylated H19 putative imprinted control region clones in two-cell embryos and blastocysts. Values with different superscripts of the each type of embryos differ significantly between different groups. (C) The relative expression of H19 messenger RNA in blastocysts. Values with different superscripts differ significantly between different groups. VOL. 98 NO. 1 / JULY

5 ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY TABLE 3 Effect of 5-aza-dC on development potential of vitrified bovine two-cell embryos. Groups No. of two-cell embryos Blastocyst development rate (%) Total cell no. of blastocysts 5-aza-dC 1, ( ) b (n ¼ 35) b Vitrification 1, ( ) b (n ¼ 32) b Control ( ) a (n ¼ 37) a Note: 5-aza-dC ¼ 5-aza-2 0 -deoxycytidine. a,b Values with different superscripts differ significantly within the same column. embryos were cultured with 5-aza-dC for 48 hours, as treatment of embryos with 5-aza-dC up to the 8-cell stage may inhibit precocious de novo methylation, but not interrupt the formation of new methylation patterns (17). Effect of Vitrification on the Putative ICR Methylation Level of H19 in Bovine Two-cell Embryos Vitrification significantly increased the putative ICR methylation level of H19 in bovine two-cell embryos (71.4% 5.7% vs. 60.7% 3.5%), which was similar to the H3K9 methylation level found in vitrified mouse oocytes (18). These experiments demonstrated that vitrification significantly increased the methylation level in vitrified embryos or oocytes after immediate warming. Many factors could be regarded as stresses to embryos during vitrification, such as cryoprotectants, vitrification and thawing procedures, and low temperature, which may explain the increased methylation level of the H19 putative ICR in vitrified embryos. However, Milroy et al. (20) observed significantly lower overall Oct4 and Sox2 promoter methylation levels (25% and 4.5%) in vitrified in vitro maturation mouse oocytes compared with in vivo-matured mouse oocytes (62.5% and 8.5%, respectively). Vitrification was not associated with elevated levels of imprinting mutations (aberrant methylation of the entire differentially methylated region) in mouse oocytes from vitrified preantral follicles (19). Variation in the identification and size of the target genes analyzed, the species investigated, and the vitrification procedures or other factors during vitrification may explain the differences observed in the effect of vitrification on embryo methylation. Effect of 5-aza-dC on the Putative ICR Methylation Level of H19 in Blastocysts Derived from Vitrified Two-cell Embryos Notably, the putative ICR methylation level of H19 in blastocysts from the vitrification group (72.2% 6.9%) was significantly higher than the control group (52.8% 6.1%; P<.05; Fig. 1B). This indicates that vitrification exerted a longlasting impact on the methylation level of the H19 putative ICR, which would in turn affect the expression of Igf2 (32, 33). However, when vitrified two-cell embryos were cultured to blastocysts in the presence of 5-aza-dC, the putative ICR methylation level of H19 in the resulting blastocysts (57.1% 4.3%) was similar to blastocysts from the control group (52.8% 6.1%). The ability of 5-aza-dC to lower DNA methylation levels has previously been reported (16, 17). The methylation status of the H19 ICR and Lit1 ICR in the kidney, muscle, and tongue of the offspring from mice with grafted cryopreserved ovaries was not significantly different to the offspring of normal mice. However, these data should be interpreted with caution due to the relatively small number of samples tested in this study, and the reduced litter sizes of the operated females, which may reflect spontaneous abortions due to malformations associated with imprinted genes (21). Wang et al. (6) observed that embryo vitrification aggravated the loss of methylation of the H19/Igf2 differentially methylated domain in mouse fetuses derived from IVF. Al-Khtib et al. (7) reported that vitrification at the germinal vesicle stage did not affect the methylation profile of the H19 and KCNQ1OT1 imprinting centers in human oocytes, subsequently matured in vitro. Taken together, these data indicate that further research would be required to fully characterize the complex mechanisms regulating the effect of vitrification on methylation in oocytes or embryos, which may depend on the species, analysis targets and sizes, or the effects of specific genes. Effect of 5-aza-dC on the Development Potential of Vitrified Two-cell Embryos As shown in Table 3, the developmental rate and total cell number of blastocysts derived from vitrified two-cell embryos increased when they were cultured with 5-aza-dC (24.8% 3.6% and ). However, these results were not significantly different to the vitrification group (20.5% 2.7% and ). Similar results were obtained in blastocysts produced by somatic cell nuclear transfer from donor cells treated with 0.01 mm 5-aza-dC (16, 17). However, Ding et al. (17) reported that the addition of a combination of 5-aza-dC and trichostatin A during the culture of donor cell and somatic cell nuclear transfer embryos positively regulated epigenetic modifications and enhanced the development rate and total cell number of somatic cell nuclear transfer embryos, compared to 5-aza-dC or trichostatin A alone. This indicated that positive regulation of both methylation and acetylation may be essential for the improvement in the embryo development potential after vitrification. 226 VOL. 98 NO. 1 / JULY 2012

6 Fertility and Sterility Effect of 5-aza-dC on the Expression Level of H19 Messenger RNA in Blastocysts Derived from Vitrified Two-cell Embryos The relative expression level of H19 in blastocysts from the vitrification group was significantly lower than blastocysts from the control group, which indicated that the formation of fetus and placenta from blastocysts derived from vitrified two-cell embryos may be influenced (33). However, the relative expression level of H19 in blastocysts increased when the vitrified two-cell embryos were cultured with 5-aza-dC, indicating that the relative expression level of H19 correlated with the blastocysts' methylation status, in agreement with the results of Wang et al. (6). Although 5-aza-dC significantly reduced the putative ICR methylation level of the H19 in blastocysts derived from vitrified two-cell embryos, 5-aza-dC did not lead to a corresponding increase in H19 expression (Fig. 1C). This observation may be because the expression level of H19 was regulated by both methylation and modification of histones (6, 30). In addition, other factors that regulated H19 expression may be affected by vitrification (6). In conclusion, the putative ICR methylation levels of H19 significantly increased in vitrified two-cell embryos and their derived blastocysts, and culture of vitrified two-cell embryos with 5-aza-dC did not significantly increase the blastocyst rate and total cell number. It positively regulated the putative ICR methylation of H19 and H19 expression level in blastocysts derived from vitrified two-cell embryos. REFERENCES 1. Vajta G, Holm P, Kuwayama M, Booth PJ, Jacobsen H, Greve T, et al. Open pulled straw (OPS) vitrification: a new way to reduce cryoinjuries of bovine ova and embryos. Mol Reprod Dev 1998;51: Schoolcraft WB, Treff NR, Stevens JM, Ferry K, Katz-Jaffe M, Scott RT Jr. Live birth outcome with trophectoderm biopsy, blastocyst vitrification, and single-nucleotide polymorphism microarray-based comprehensive chromosome screening in infertile patients. Fertil Steril 2011;96: Liebermann J, Tucker MJ. Effect of carrier system on the yield of human oocytes and embryos as assessed by survival and developmental potential after vitrification. Reproduction 2002;124: Zhao XM, Du WH, Wang D, Hao HS, Liu Y, Qin T, et al. Effect of cyclosporine pretreatment on mitochondrial function in vitrified bovine mature oocytes. Fertil Steril 2011;95: Yan J, Yan L, Li L, Zhang QF, Qiao J, Chian RC. The global DNA methylation of mouse oocytes following vitrification. Fertil Steril 2009;92:S Wang Z, Xu L, He F. Embryo vitrification affects the methylation of the H19/Igf2 differentially methylated domain and the expression of H19 and Igf2. Fertil Steril 2010;93: Al-Khtib M, Perret A, Khoueiry R, Ibala-Romdhane S, Blachere T, Greze C, et al. Vitrification at the germinal vesicle stage does not affect the methylation profile of H19 and KCNQ1OT1 imprinting centers in human oocytes subsequently matured in vitro. Fertil Steril 2011;95: Holmes R, Soloway PD. Regulation of imprinted DNA methylation. Cytogenet Genome Res 2006;113: Lewis A, Reik W. How imprinting centers work. Cytogenet Genome Res 2006;113: Rougier N, Bourc'his D, Gomes DM, Niveleau A, Plachot M, Paldi A, et al. Chromosome methylation patterns during mammalian preimplantation development. Genes Dev 1998;12: Wolffe AP, Jones PI, Wade PA. DNA demethylation. Proc Natl Acad Sci USA 1999;96: Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science 2001;293: Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, et al. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001;28: Ohgane J, Wakayama T, Kogo Y, Senda S, Hattori N, Tanaka S, et al. DNA methylation variation in cloned mice. Genesis 2001;30: Enright BP, Kubota C, Yang X, Tian XC. Epigenetic characteristics and development of embryos cloned from donor cells treated by trichostatin A or 5-aza-2 0 -deoxycytidine. Biol Reprod 2003;69: Enright BP, Sung LY, Chang CC, Yang X, Tian XC Methylation and acetylation characteristics of cloned bovine embryos from donor cells treated with 5-aza-2 0 -deoxycytidine. Biol Reprod 2005;72: Ding X, Wang Y, Zhang D, Wang Y, Guo Z, Zhang Y. Increased preimplantation development of cloned bovine embryos treated with 5-aza deoxycytidine and trichostatin A. Theriogenology 2008;70: Yan LY, Yan J, Qiao J, Zhao PL, Liu P. Effects of oocyte vitrification on histone modifications. Reprod Fertil Dev 2010;22: Trapphoff T, El Hajj N, Zechner U, Haaf T, Eichenlaub-Ritter U. DNA integrity, growth pattern, spindle formation, chromosomal constitution and imprinting patterns of mouse oocytes from vitrified pre-antral follicles. Hum Reprod 2010;25: Milroy C, Liu L, Hammoud S, Hammoud A, Peterson CM, Carrell DT. Differential methylation of pluripotency gene promoters in in vitro matured and vitrified, in vivo-matured mouse oocytes. Fertil Steril 2011;95: Sauvat F, Capito C, Sarnacki S, Poirot C, Bachelot A, Meduri G, et al. Immature cryopreserved ovary restores puberty and fertility in mice without alteration of epigenetic marks. PLoS One 2008;3:e Zhou C, Zhou GB, Zhu SE, Hou YP, Jin F, Zhao XM, et al. Open-pulled straw (OPS) vitrification of mouse hatched blastocysts. Anim Biotechnol 2007;18: Brackett BG, Oliphant G. Capacitation of rabbit spermatozoa in vitro. Biol Reprod 1975;12: Rosenkrans CF Jr, First NL. Effect of free amino acids and vitamins on cleavage and developmental rate of bovine zygotes in vitro. J Anim Sci 1994;72: Borghol N, Lornage J, Blachere T, Sophie Garret A, Lefevre A. Epigenetic status of the H19 locus in human oocytes following in vitro maturation. Genomics 2006;87: Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C (T) method. Nat Protoc 2008;3: Sussenbach JS, Steenbergh PH, Holthuizen P. Structure and expression of the human insulin-like growth factor genes. Growth Regul 1992;2: Doherty AS, Mann MR, Tremblay KD, Bartolomei MS, Schultz RM. Differential effects of culture on imprinted H19 expression in the preimplantation mouse embryo. Biol Reprod 2000;62: Mann MR, Chung YG, Nolen LD, Verona RI, Latham KE, Bartolomei MS. Disruption of imprinted gene methylation and expression in cloned preimplantation stage mouse embryos. Biol Reprod 2003;69: Fauque P, Jouannet P, Lesaffre C, Ripoche MA, Dandolo L, Vaiman D, et al. Assisted reproductive technology affects developmental kinetics, H19 imprinting control region methylation and H19 gene expression in individual mouse embryos. BMC Dev Biol 2007;7: Rivera RM, Stein P, Weaver JR, Mager J, Schultz RM, Bartolomei MS. Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development. Hum Mol Genet 2008;17: Eggenschwiler J, Ludwig T, Fisher P, Leighton PA, Tilghman SM, Efstratiadis A. Mouse mutant embryos overexpressing IGF-II exhibit phenotypic features of the Beckwith-Wiedemann and Simpson-Golabi Behmel syndromes. Genes Dev 1997;11: Reik W, Constancia M, Fowden A, Anderson N, Dean W, Ferguson-Smith A, et al. Regulation of supply and demand for maternal nutrients in mammals by imprinted genes. J Physiol 2003;547: Gicquel C, Gaston V, Mandelbaum J, Siffroi JP, Flahault A, Le Bouc Y. In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCN1OT gene. Am J Hum Genet 2003;72: VOL. 98 NO. 1 / JULY