Vitrification has been used widely
|
|
- Virgil Shaw
- 6 years ago
- Views:
Transcription
1 Effect of 5-aza-2 0 -deoxycytidine on methylation of the putative imprinted control region of H19 during the in vitro development of vitrified bovine two-cell embryos Xue-Ming Zhao, Ph.D., Jing-Jing Ren, M.Sc., Wei-Hua Du, Ph.D., Hai-Sheng Hao, Ph.D., Dong Wang, Ph.D., Yan Liu, Ph.D., Tong Qin, Ph.D., and Hua-Bin Zhu, Ph.D. Embryo Biotechnology and Reproduction Laboratory, Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, People's Republic of China Objective: To determine the effect of vitrification and 5-aza-2 0 -deoxycytidine (5-aza-dC) on the methylation levels of the putative imprinted control region (ICR) of H19 and H19 expression in bovine two-cell embryos and their derived blastocysts. Design: Experimental animal study. Setting: Academic institution. Animal(s): Abattoir-derived bovine ovaries. Intervention(s): Vitrified two-cell embryos were cultured in vitro to blastocysts with 0.01 mm 5-aza-dC (5-aza-dC group) or without 5-aza-dC (vitrification group). Fresh embryos and their derived blastocysts were used as control. Main Outcome Measure(s): Putative ICR methylation of H19 was measured by bisulfate mutagenesis and sequencing, blastocyst development rate; total cell number were determined; and H19 expression was measured by real-time reverse transcriptasepolymerase chain reaction (PCR). Result(s): Vitrification significantly increased putative ICR methylation of H19 in two-cell embryos and their derived blastocysts; 5-aza-dC significantly reduced putative ICR methylation of H19 in vitrified two-cell embryos and their derived blastocysts. The H19 expression level was significantly higher in blastocysts from the 5-aza-dC group than the vitrification group. The blastocyst development rate and total cell number in the 5-aza-dC and vitrification groups were similar. Conclusion(s): Putative ICR methylation levels of H19 significantly increased in vitrified two-cell embryos and their derived blastocysts; 5-aza-dC significantly reduced putative ICR methylation of H19 and increased H19 expression in blastocysts derived from vitrified two-cell embryos. (Fertil Steril Ò 2012;98: Ó2012 by American Society for Reproductive Medicine.) Key Words: Vitrification, methylation, 5-aza-2 0 -deoxycytidine, putative imprinted control region of H19, embryo Vitrification has been used widely as an efficient approach to preserve mammalian oocytes and embryos (1, 2). In the past, researchers used common parameters, such as the survival rate and development Received December 20, 2011; revised March 21, 2012; accepted April 6, 2012; published online May 22, X.-M.Z. has nothing to disclose. J.-J.R. has nothing to disclose. W.-H.D. has nothing to disclose. H.-S.H. has nothing to disclose. D.W. has nothing to disclose. Y.L. has nothing to disclose. T.Q. has nothing to disclose. H.-B.Z. has nothing to disclose. Supported by grants from the National Natural Science Foundation of China ( ), the Basic Research Fund of Institute of Animal Science, Chinese Academy of Agricultural Sciences (2010jc-3-1), and the Genetically Modified Organisms Breeding Major Projects of China (2011ZX ). Reprint requests: Hua-Bin Zhu, Ph.D., Embryo Biotechnology and Reproduction Laboratory, Institute of Animal Science, Chinese Academy of Agricultural Sciences, No. 2 Yuanmingyuan Western Road, Haidian District, Beijing , People's Republic of China ( huabinzhu@yahoo. com.cn). Fertility and Sterility Vol. 98, No. 1, July /$36.00 Copyright 2012 American Society for Reproductive Medicine, Published by Elsevier Inc. doi: /j.fertnstert potential, to assess the efficiency and safety of vitrification (3, 4); however, attention is now being paid to the epigenetic modifications induced by vitrification (5 7). Epigenetic modifications include differential DNA methylation, methylation/acetylation of histones, and production of antisense RNA (8, 9). Before fertilization, mammalian gametes are highly methylated (10). After fertilization, the paternal genome is demethylated by an active mechanism, whereas the maternal genome is demethylated by a passive mechanism (11). Until blastocyst developmental 222 VOL. 98 NO. 1 / JULY 2012
2 Fertility and Sterility stage, both maternal and paternal genomes are remethylated (12). And further development will be affected if the erasure and re-establishment of epigenetic markers fail (13, 14). During the in vitro embryos production, their epigenetic modifications can be influenced by many environmental conditions (6). The DNA methyltransferase inhibitor 5-aza deoxycytidine (5-aza-dC) is widely used to regulate the DNA methylation (15, 16). The 5-aza-dC treatment of donor cells in bovine somatic cell nuclear transfer has generated conflicting results on cloning efficiency (15 17). Researchers have investigated the effect of cryopreservation on DNA methylation in mammalian oocytes (7, 18 20), embryos (6), and oocytes from cryopreserved ovaries (21), and obtained conflicting results. In addition, no effective methods to positively regulate DNA methylation changes that occur during vitrification have been reported. Therefore, this study was designed to [1] observe the effect of vitrification on the putative imprinted control region (ICR) methylation levels of H19 in vitrified bovine two-cell embryos and their derived blastocysts, and [2] determine the effect of 5-aza-dC on the development rate, total cell number, putative ICR methylation of H19, and H19 expression level in blastocysts derived from vitrified two-cell embryos. MATERIALS AND METHODS All experimental protocols were in accordance with the requirements of the Institutional Animal Care and Use Committee of the Chinese Academy of Agricultural Sciences. All chemicals and media were purchased from Sigma Chemical Co. and plastics were obtained from Nunc-ware (Nunc; Nalge Nunc International), unless indicated otherwise. Open-pulled Straw Preparation Open-pulled straws were prepared according to the method described by Vajta et al. (1). Briefly, 0.25-mL plastic straws (I.M.V.) were heat-softened and manually pulled to a length of 2 3 cm, with an approximate outer diameter of 0.23 mm and wall thickness of 0.02 mm. Vitrification Solutions Vitrification solutions were prepared as previously described (22). The pretreatment solution composed of 10% ethylene glycol and 10% dimethyl sulfoxide (DMSO) in Dulbecco's phosphate-buffered saline (PBS) containing 3 mg/ml bovine serum albumin (BSA). The EDFS30 vitrification solution contained 15% ethylene glycol and 15% DMSO in FS solution (Dulbecco's PBS containing 300 mg/ml Ficoll, g/l sucrose, and 3 mg/ml BSA). In Vitro Maturation of Oocytes Bovine ovaries were collected from a local abattoir and transported to the laboratory within 2 hours in physiological saline solution (0.9% NaCl) at 30 C. Cumulus-oocyte complexes were aspirated from follicles 2 8 mm in diameter, and cumulus-oocyte complexes with at least three layers of compact cumulus cells were used. Groups of approximately 50 cumulus-oocyte complexes were cultured in 500 ml of maturation medium at 38.5 Cin5%CO 2 in air with maximum humidity. The maturation medium was Medium 199 (GIBCO BRL) supplemented with 10 mg/ml FSH, 10 mg/ml LH, 10 mg/ml E 2, 10% fetal bovine serum (FBS; GIBCO BRL), and 10 mg/ml heparin. Production of Bovine Two-cell Embryos by IVF In vitro fertilization was performed according to the method described previously (23) with some modifications. Cumulus-oocyte complexes were denuded of cumulus cells after in vitro maturation for hours by vortexing in 0.1% hyaluronidase for 2 3 minutes, and only oocytes with a first polar body and even distribution of cytoplasm were selected for IVF. One straw of frozen semen (Beijing Dairy Cattle Center) was thawed in a water bath (37 C), washed twice in Brackett and Oliphant medium containing 2.5 mmol/l caffeine by centrifugation at 1,800 rpm for 5 minutes and resuspended at /ml in Brackett and Oliphant medium supplemented with 20 mg/ml heparin, 100 mg/ml streptomycin, 100 IU/mL penicillin, and 20 mg/ml BSA. For insemination, a 20-mL aliquot of sperm suspension was added to each 80-mL droplet of Brackett and Oliphant medium containing oocytes. After hours of insemination, presumptive zygotes were cultured in Charles Rosenkrans medium with amino acids (CR1aa) (24) supplemented with 0.1% BSA for 48 hours, and then two-cell embryos were selected and divided into the following groups: [1] control group, two-cell embryos were cultured in vitro in CR1aa with 10% FBS for 5 days to the blastocyst stage; [2] vitrification group, two-cell embryos were vitrified and warmed, and embryos, which survived, were cultured in vitro in CR1aa with 10% FBS for 5 days to the blastocyst stage; [3] 5-aza-dC group, vitrified/thawed two-cell embryos were cultured in CR1aa with 10% FBS containing 0.01 mm 5-aza-dC for 48 hours, and then they were cultured in CR1aa with 10% FBS for 3 days to the blastocyst stage. Vitrification and Thawing of Bovine Two-cell Embryos Embryos were equilibrated in pretreatment solution for 30 seconds, loaded into an open-pulled straw with EDFS30 for 25 seconds, and plunged into liquid nitrogen. For warming, the two-cell embryos were rinsed in 0.5 M sucrose under mineral oil for 5 minutes, washed three times in CR1aa supplemented with 10% FBS, and the embryos that survived were morphologically evaluated. Only embryos that survived vitrification/thawing were used for blastocyst development and methylation analysis. DNA Methylation Analysis The putative ICR methylation levels of H19 were determined by bisulfate mutagenesis and sequencing as described by Borghol et al. (25). We analyzed 81 CpG sites within 1,898 bp of the putative ICR of H19 (GenBank accession no. GU371442) by polymerase chain reaction (PCR) using primers for VOL. 98 NO. 1 / JULY
3 ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY bisulfate-converted DNA (Table 1). The PCR conditions were 95 C for 3 minutes; 40 cycles of 95 C for 30 seconds, 53 C for 30 seconds, and 72 C for 40 seconds; followed by a final extension of 72 C for 5 minutes. Each PCR was performed on a pool of 100 two-cell embryos or 30 blastocysts. The PCR products were ligated into the pmd18-t vector (TaKaRa), transformed into Top10 cells (Transgene), and 10 clones of each PCR product were sequenced using the ABI PRISM-77 (Applied Biosystems). Identical bisulfite-modified sequences from separated PCR amplifications were considered to represent distinct chromosomes. Identical sequences from single product PCR amplifications were counted only once (25). Quantification of the H19 Expression by Real-time Reverse Transcription PCR Total RNA was isolated from pools of 60 fresh or vitrified blastocysts with TRIZOL reagent (Invitrogen) according to the manufacturer's instruction, dissolved in sterile water, and stored at 80 C. First-strand complementary DNA (cdna) was synthesized from 0.05 mg RNA using random hexamers. H19 messenger RNA expression was quantified using the primers listed in Table 2 on the ABI 7500 SDS (Applied Biosystems) according to the manufacturer's protocols. b-actin was used as a reference gene and the expression levels were calculated using the comparative Ct (2 DCt ) method (26). Total Cell Counts Blastocysts were treated with Dulbecco's PBS containing 0.25% pronase for 2 3 minutes to remove the zona pellucid (ZP), stained with 10 mg/ml Hoechst at 38.5 C for 10 minutes, washed three times in Dulbecco's PBS, and mounted on slides. The total cell number of each blastocyst was counted using fluorescence microscopy (Eclipse TE2000-u, Nikon). Statistical Analysis Each experiment was repeated at least three times and the results were presented as mean SE. Data were analyzed by one-way analysis of variance (ANOVA) with Duncan's test using SAS software (SAS Institute). Percentage data were subjected to arcsine transformation before analysis. P values <.05 were considered to be statistically significant. RESULTS Effect of 5-aza-dC on the Putative ICR Methylation Levels of H19 in Vitrified Two-cell Embryos and Their Blastocysts Figure 1 illustrates a representative sample of the bisulfite analysis of the putative ICR repetitive elements of H19 from the 5-aza-dC group. The putative ICR methylation level of H19 in vitrified two-cell embryos (71.4% 5.7%) was significantly higher than that of the control group (60.7% 3.5%; P<.05). The putative ICR methylation level of H19 in blastocysts from the vitrification group (72.2% 6.9%) was also significantly higher than blastocysts from the control group (52.8% 6.1%; P<.05; Fig. 1B). However, the putative ICR methylation level of H19 in blastocysts from the 5-aza-dC group (57.1% 4.3%) was significantly lower than that of the vitrification group (P<.05) and similar to that of the control group (P>.05). Effect of 5-aza-dC on the Development Potential of Vitrified Bovine Two-cell Embryos As shown in Table 3, the blastocyst development rates of the vitrification group (20.5% 2.7%) and 5-aza-dC group (24.8% 3.6%) were significantly lower than the control TABLE 1 Primers used for amplification of bisulfite-treated DNA. Primer no. Amplification interval (bp) Sequences Product size (bp) F: AGTTGTTGGGTGTGGATT 268 R: CACAACCCTATTTTAAAATATAACC F: ATAGGGTAGTGTGTAGAGGATATTGG 184 R: CCTATAATATACAAACCCCCCC F: GGGGGGGTTTGTATATTATAGG 298 R: AAAAACTATAAAATCCTCCTACCCTC ,025 F: GAGGGTAGGAGGATTTTATAGTT 351 R: CAAACTACCATCCTCCAACCT 5 1,000 1,201 F: TTTTTAGGTTGGAGGATGGTA 202 R: AAACCTTCAACATTTCAAACAA 6 1,180 1,449 F: TTGTTTGAAATGTTGAAGGTTT 270 R: ATACAATAAAATCCACACCCAA 7 1,413 1,633 F: GGAGTTTATGAGTTGTTGGGT 221 R: AAAACCCCAATATCCTCTACAC 8 1,593 1,814 F: TAYGGTGATATAGGGTAGTGTG 222 R: ATACRAACCCRAAATACC 9 1,721 1,958 F: AGGYGGTAGTGTAGGTTTA 238 R: ATAAAAATCCCTCATTATCCC Note: F ¼ forward primer; R ¼ reverse primer; H19 putative imprinted control region GenBank accession no. GU VOL. 98 NO. 1 / JULY 2012
4 Fertility and Sterility TABLE 2 Primer sequences, expected fragment sizes of H19 and b-actin genes. Gene Primers Size (bp) GenBank accession no. Annealing temperature ( C) H19 GATATGGTCCGGTGTGATGGAGAG 134 NR_ GTCTGAAGAGCAGCAGTGGTGTG b-actin TCCTGGGCATGGAATCCTG 199 NM_ GGCGCGATGATCTTGATCTTC group (35.2% 4.5%; P<.05). The blastocyst development rate of the 5-aza-dC group was higher than the vitrification group, but this difference was not statistically significant (P>.05). Similar total cell numbers were observed in blastocysts from the 5-aza-dC group ( ) and vitrification group ( ). Effect of 5-aza-dC on the Expression Level of H19 in Blastocysts Derived from Vitrified Two-cell Embryos As shown in Figure 1C, the relative expression of H19 in blastocysts from the vitrification group was significantly lower than blastocysts from the control group (P<.05). However, when vitrified two-cell embryos were cultured to the blastocyst stage in the presence of 0.01 mm 5-aza-dC, the relative expression level of H19 significantly increased but remained lower than the control group (P<.05). DISCUSSION H19 is located on bovine chromosome 29 (27). Many studies have indicated that the H19 ICR is sensitive to manipulation (28, 29) such as in vitro culture and ovarian stimulation (30, 31). Development of the fetus and placenta are regulated by H19 by expression of Igf2 (32, 33) and disorders in the H19 ICR lead to diseases of dominant inheritance in children born by assisted reproduction technology (ART) (34). As the most studied model of epigenetic modification, we analyzed the effect of vitrification and 5-aza-dC on the methylation level of H19 ICR. De novo methylation usually occurs at the 8- to 16-cell stage in normal bovine embryos. Therefore vitrified two-cell FIGURE 1 (A) Bisulfate sequencing results for a representative sample of blastocysts derived from vitrified two-cell embryos of the 5-aza-2 0 -deoxycytidine (5- aza-dc) group. Each line represents a unique DNA clone; filled and open circles represent methylated and unmethylated CpGs, respectively. (B) The percentage of methylated H19 putative imprinted control region clones in two-cell embryos and blastocysts. Values with different superscripts of the each type of embryos differ significantly between different groups. (C) The relative expression of H19 messenger RNA in blastocysts. Values with different superscripts differ significantly between different groups. VOL. 98 NO. 1 / JULY
5 ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY TABLE 3 Effect of 5-aza-dC on development potential of vitrified bovine two-cell embryos. Groups No. of two-cell embryos Blastocyst development rate (%) Total cell no. of blastocysts 5-aza-dC 1, ( ) b (n ¼ 35) b Vitrification 1, ( ) b (n ¼ 32) b Control ( ) a (n ¼ 37) a Note: 5-aza-dC ¼ 5-aza-2 0 -deoxycytidine. a,b Values with different superscripts differ significantly within the same column. embryos were cultured with 5-aza-dC for 48 hours, as treatment of embryos with 5-aza-dC up to the 8-cell stage may inhibit precocious de novo methylation, but not interrupt the formation of new methylation patterns (17). Effect of Vitrification on the Putative ICR Methylation Level of H19 in Bovine Two-cell Embryos Vitrification significantly increased the putative ICR methylation level of H19 in bovine two-cell embryos (71.4% 5.7% vs. 60.7% 3.5%), which was similar to the H3K9 methylation level found in vitrified mouse oocytes (18). These experiments demonstrated that vitrification significantly increased the methylation level in vitrified embryos or oocytes after immediate warming. Many factors could be regarded as stresses to embryos during vitrification, such as cryoprotectants, vitrification and thawing procedures, and low temperature, which may explain the increased methylation level of the H19 putative ICR in vitrified embryos. However, Milroy et al. (20) observed significantly lower overall Oct4 and Sox2 promoter methylation levels (25% and 4.5%) in vitrified in vitro maturation mouse oocytes compared with in vivo-matured mouse oocytes (62.5% and 8.5%, respectively). Vitrification was not associated with elevated levels of imprinting mutations (aberrant methylation of the entire differentially methylated region) in mouse oocytes from vitrified preantral follicles (19). Variation in the identification and size of the target genes analyzed, the species investigated, and the vitrification procedures or other factors during vitrification may explain the differences observed in the effect of vitrification on embryo methylation. Effect of 5-aza-dC on the Putative ICR Methylation Level of H19 in Blastocysts Derived from Vitrified Two-cell Embryos Notably, the putative ICR methylation level of H19 in blastocysts from the vitrification group (72.2% 6.9%) was significantly higher than the control group (52.8% 6.1%; P<.05; Fig. 1B). This indicates that vitrification exerted a longlasting impact on the methylation level of the H19 putative ICR, which would in turn affect the expression of Igf2 (32, 33). However, when vitrified two-cell embryos were cultured to blastocysts in the presence of 5-aza-dC, the putative ICR methylation level of H19 in the resulting blastocysts (57.1% 4.3%) was similar to blastocysts from the control group (52.8% 6.1%). The ability of 5-aza-dC to lower DNA methylation levels has previously been reported (16, 17). The methylation status of the H19 ICR and Lit1 ICR in the kidney, muscle, and tongue of the offspring from mice with grafted cryopreserved ovaries was not significantly different to the offspring of normal mice. However, these data should be interpreted with caution due to the relatively small number of samples tested in this study, and the reduced litter sizes of the operated females, which may reflect spontaneous abortions due to malformations associated with imprinted genes (21). Wang et al. (6) observed that embryo vitrification aggravated the loss of methylation of the H19/Igf2 differentially methylated domain in mouse fetuses derived from IVF. Al-Khtib et al. (7) reported that vitrification at the germinal vesicle stage did not affect the methylation profile of the H19 and KCNQ1OT1 imprinting centers in human oocytes, subsequently matured in vitro. Taken together, these data indicate that further research would be required to fully characterize the complex mechanisms regulating the effect of vitrification on methylation in oocytes or embryos, which may depend on the species, analysis targets and sizes, or the effects of specific genes. Effect of 5-aza-dC on the Development Potential of Vitrified Two-cell Embryos As shown in Table 3, the developmental rate and total cell number of blastocysts derived from vitrified two-cell embryos increased when they were cultured with 5-aza-dC (24.8% 3.6% and ). However, these results were not significantly different to the vitrification group (20.5% 2.7% and ). Similar results were obtained in blastocysts produced by somatic cell nuclear transfer from donor cells treated with 0.01 mm 5-aza-dC (16, 17). However, Ding et al. (17) reported that the addition of a combination of 5-aza-dC and trichostatin A during the culture of donor cell and somatic cell nuclear transfer embryos positively regulated epigenetic modifications and enhanced the development rate and total cell number of somatic cell nuclear transfer embryos, compared to 5-aza-dC or trichostatin A alone. This indicated that positive regulation of both methylation and acetylation may be essential for the improvement in the embryo development potential after vitrification. 226 VOL. 98 NO. 1 / JULY 2012
6 Fertility and Sterility Effect of 5-aza-dC on the Expression Level of H19 Messenger RNA in Blastocysts Derived from Vitrified Two-cell Embryos The relative expression level of H19 in blastocysts from the vitrification group was significantly lower than blastocysts from the control group, which indicated that the formation of fetus and placenta from blastocysts derived from vitrified two-cell embryos may be influenced (33). However, the relative expression level of H19 in blastocysts increased when the vitrified two-cell embryos were cultured with 5-aza-dC, indicating that the relative expression level of H19 correlated with the blastocysts' methylation status, in agreement with the results of Wang et al. (6). Although 5-aza-dC significantly reduced the putative ICR methylation level of the H19 in blastocysts derived from vitrified two-cell embryos, 5-aza-dC did not lead to a corresponding increase in H19 expression (Fig. 1C). This observation may be because the expression level of H19 was regulated by both methylation and modification of histones (6, 30). In addition, other factors that regulated H19 expression may be affected by vitrification (6). In conclusion, the putative ICR methylation levels of H19 significantly increased in vitrified two-cell embryos and their derived blastocysts, and culture of vitrified two-cell embryos with 5-aza-dC did not significantly increase the blastocyst rate and total cell number. It positively regulated the putative ICR methylation of H19 and H19 expression level in blastocysts derived from vitrified two-cell embryos. REFERENCES 1. Vajta G, Holm P, Kuwayama M, Booth PJ, Jacobsen H, Greve T, et al. Open pulled straw (OPS) vitrification: a new way to reduce cryoinjuries of bovine ova and embryos. Mol Reprod Dev 1998;51: Schoolcraft WB, Treff NR, Stevens JM, Ferry K, Katz-Jaffe M, Scott RT Jr. Live birth outcome with trophectoderm biopsy, blastocyst vitrification, and single-nucleotide polymorphism microarray-based comprehensive chromosome screening in infertile patients. Fertil Steril 2011;96: Liebermann J, Tucker MJ. Effect of carrier system on the yield of human oocytes and embryos as assessed by survival and developmental potential after vitrification. Reproduction 2002;124: Zhao XM, Du WH, Wang D, Hao HS, Liu Y, Qin T, et al. Effect of cyclosporine pretreatment on mitochondrial function in vitrified bovine mature oocytes. Fertil Steril 2011;95: Yan J, Yan L, Li L, Zhang QF, Qiao J, Chian RC. The global DNA methylation of mouse oocytes following vitrification. Fertil Steril 2009;92:S Wang Z, Xu L, He F. Embryo vitrification affects the methylation of the H19/Igf2 differentially methylated domain and the expression of H19 and Igf2. Fertil Steril 2010;93: Al-Khtib M, Perret A, Khoueiry R, Ibala-Romdhane S, Blachere T, Greze C, et al. Vitrification at the germinal vesicle stage does not affect the methylation profile of H19 and KCNQ1OT1 imprinting centers in human oocytes subsequently matured in vitro. Fertil Steril 2011;95: Holmes R, Soloway PD. Regulation of imprinted DNA methylation. Cytogenet Genome Res 2006;113: Lewis A, Reik W. How imprinting centers work. Cytogenet Genome Res 2006;113: Rougier N, Bourc'his D, Gomes DM, Niveleau A, Plachot M, Paldi A, et al. Chromosome methylation patterns during mammalian preimplantation development. Genes Dev 1998;12: Wolffe AP, Jones PI, Wade PA. DNA demethylation. Proc Natl Acad Sci USA 1999;96: Reik W, Dean W, Walter J. Epigenetic reprogramming in mammalian development. Science 2001;293: Kang YK, Koo DB, Park JS, Choi YH, Chung AS, Lee KK, et al. Aberrant methylation of donor genome in cloned bovine embryos. Nat Genet 2001;28: Ohgane J, Wakayama T, Kogo Y, Senda S, Hattori N, Tanaka S, et al. DNA methylation variation in cloned mice. Genesis 2001;30: Enright BP, Kubota C, Yang X, Tian XC. Epigenetic characteristics and development of embryos cloned from donor cells treated by trichostatin A or 5-aza-2 0 -deoxycytidine. Biol Reprod 2003;69: Enright BP, Sung LY, Chang CC, Yang X, Tian XC Methylation and acetylation characteristics of cloned bovine embryos from donor cells treated with 5-aza-2 0 -deoxycytidine. Biol Reprod 2005;72: Ding X, Wang Y, Zhang D, Wang Y, Guo Z, Zhang Y. Increased preimplantation development of cloned bovine embryos treated with 5-aza deoxycytidine and trichostatin A. Theriogenology 2008;70: Yan LY, Yan J, Qiao J, Zhao PL, Liu P. Effects of oocyte vitrification on histone modifications. Reprod Fertil Dev 2010;22: Trapphoff T, El Hajj N, Zechner U, Haaf T, Eichenlaub-Ritter U. DNA integrity, growth pattern, spindle formation, chromosomal constitution and imprinting patterns of mouse oocytes from vitrified pre-antral follicles. Hum Reprod 2010;25: Milroy C, Liu L, Hammoud S, Hammoud A, Peterson CM, Carrell DT. Differential methylation of pluripotency gene promoters in in vitro matured and vitrified, in vivo-matured mouse oocytes. Fertil Steril 2011;95: Sauvat F, Capito C, Sarnacki S, Poirot C, Bachelot A, Meduri G, et al. Immature cryopreserved ovary restores puberty and fertility in mice without alteration of epigenetic marks. PLoS One 2008;3:e Zhou C, Zhou GB, Zhu SE, Hou YP, Jin F, Zhao XM, et al. Open-pulled straw (OPS) vitrification of mouse hatched blastocysts. Anim Biotechnol 2007;18: Brackett BG, Oliphant G. Capacitation of rabbit spermatozoa in vitro. Biol Reprod 1975;12: Rosenkrans CF Jr, First NL. Effect of free amino acids and vitamins on cleavage and developmental rate of bovine zygotes in vitro. J Anim Sci 1994;72: Borghol N, Lornage J, Blachere T, Sophie Garret A, Lefevre A. Epigenetic status of the H19 locus in human oocytes following in vitro maturation. Genomics 2006;87: Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C (T) method. Nat Protoc 2008;3: Sussenbach JS, Steenbergh PH, Holthuizen P. Structure and expression of the human insulin-like growth factor genes. Growth Regul 1992;2: Doherty AS, Mann MR, Tremblay KD, Bartolomei MS, Schultz RM. Differential effects of culture on imprinted H19 expression in the preimplantation mouse embryo. Biol Reprod 2000;62: Mann MR, Chung YG, Nolen LD, Verona RI, Latham KE, Bartolomei MS. Disruption of imprinted gene methylation and expression in cloned preimplantation stage mouse embryos. Biol Reprod 2003;69: Fauque P, Jouannet P, Lesaffre C, Ripoche MA, Dandolo L, Vaiman D, et al. Assisted reproductive technology affects developmental kinetics, H19 imprinting control region methylation and H19 gene expression in individual mouse embryos. BMC Dev Biol 2007;7: Rivera RM, Stein P, Weaver JR, Mager J, Schultz RM, Bartolomei MS. Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development. Hum Mol Genet 2008;17: Eggenschwiler J, Ludwig T, Fisher P, Leighton PA, Tilghman SM, Efstratiadis A. Mouse mutant embryos overexpressing IGF-II exhibit phenotypic features of the Beckwith-Wiedemann and Simpson-Golabi Behmel syndromes. Genes Dev 1997;11: Reik W, Constancia M, Fowden A, Anderson N, Dean W, Ferguson-Smith A, et al. Regulation of supply and demand for maternal nutrients in mammals by imprinted genes. J Physiol 2003;547: Gicquel C, Gaston V, Mandelbaum J, Siffroi JP, Flahault A, Le Bouc Y. In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCN1OT gene. Am J Hum Genet 2003;72: VOL. 98 NO. 1 / JULY
Name: Xueming Zhao. Professional Title: Professor. Animal embryo biotechnology, mainly including in vitro maturation (IVM), in vitro fertilization
Name: Xueming Zhao Professional Title: Professor Telephone:86-010-62815892 Fax:86-010-62895971 E-mail: zhaoxueming@caas.cn Website: http://www.iascaas.net.cn/yjspy/dsjj/sssds/dwyzyzypz1/62040.htm Research
More informationMethylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine
Univ.-Prof. Dr. Thomas Haaf Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine Epigenetics and DNA methylation Heritable change of
More informationEffects of Centrifugation and Lipid Removal on the Cryopreservation of in Vitro Produced Bovine Embryos at the Eight-Cell Stage
CRYOBIOLOGY 36, 206 212 (1998) ARTICLE NO. CY982077 Effects of Centrifugation and Lipid Removal on the Cryopreservation of in Vitro Produced Bovine Embryos at the Eight-Cell Stage M. Murakami,* T. Otoi,
More informationChromosomal Aneuploidy
The Many Advantages of Trophectoderm Biopsy Compared to Day 3 Biopsy for Pre- Implantation Genetic Screening (PGS) Mandy Katz-Jaffe, PhD Chromosomal Aneuploidy Trisomy 21 Fetus Aneuploidy is the most common
More informationA comparison of the effects of estrus cow. nuclear maturation of bovine oocytes
A comparison of the effects of estrus cow serum and fetal calf serum on in vitro nuclear maturation of bovine oocytes J Spiropoulos, SE Long University of Bristol, School of Veterinary Science, Department
More informationUnderstanding eggs, sperm and embryos. Marta Jansa Perez Wolfson Fertility Centre
Understanding eggs, sperm and embryos Marta Jansa Perez Wolfson Fertility Centre What does embryology involve? Aims of the embryology laboratory Creation of a large number of embryos and supporting their
More informationEffect of addition of exogenous growth factor on in vitro development of preimplantation stage buffalo embryos
Effect of addition of exogenous growth factor on in vitro development of preimplantation stage buffalo embryos CONTENTS 5. EFFECT OF ADDITION OF EXOGENOUS GROWTH FACTOR ON IN VITRO DEVELOPMENT OF PREIMPLANTATION
More informationIn vitro competence of vitrified bovine oocytes with open pulled straw
Indian Journal of Biotechnology Vol. 17, July 2018, pp 402-406 In vitro competence of vitrified bovine oocytes with open pulled straw D J Dutta*, B C Sarmah, Hiramoni Dev and Himangshu Raj Department of
More informationThe Cytotoxic Effect of Cryoprotective Agents on in vitro Fertilization Rates of Mammalian Oocytes
Cean A. et al./scientific Papers: Animal Science and Biotechnologies, 2013, 46 (2) The Cytotoxic Effect of Cryoprotective Agents on in vitro Fertilization Rates of Mammalian Oocytes Ada Cean 1,2,*, Ivan
More informationEffect of Warming on the Survivability and Fertilizability of Vitrified Matured Bovine Oocytes
International Journal of Agricultural Technology 2014 Vol. 10(1):49-58 Available online http://www.ijat-aatsea.com ISSN 2630-0192 (Online) Fungal Diversity Effect of Warming on the Survivability and Fertilizability
More information1,2,3 1,2 1 1,2 1,2 1 1,2 1,2 (1.,, ) (2.,, ) (3.,, )
34 0 Vol.34 No.0 204 0 Oct. 204 Reproduction & ontraception doi: 0.7669/j.issn.0253-357X.204.0.0789 E-mail: randc_journal@63.com 5-23 2 2 2 2 2. 236037) 2. 236037) 3. 23060) : 5-5-azacytidine ) : 0. μmol/l
More informationEffect of Bovine Follicular Fluid Added to the Maturation Medium on Sperm Penetration in Pig Oocytes Matured In Vitro
Article Effect of Bovine Follicular Fluid Added to the Maturation Medium on Sperm Penetration in Pig Oocytes Matured In Vitro Abstract Naoki ISOBE Research Associate Graduate School for International Development
More informationSimple, efficient and successful vitrification of bovine blastocysts using electron microscope grids
Human Reproduction vol.14 no.11 pp.838-843, 1999 Simple, efficient and successful vitrification of bovine blastocysts using electron microscope grids Se-Pill Park, Eun Young Kim, Deok Im Kim, Noh Hyung
More informationOOPLASM CRYOPRESERVATION: OVARIAN FRAGMENTS VERSUS OOCYTES ALONE
2018 NPPC ISSN 1337-9984 OOPLASM CRYOPRESERVATION: OVARIAN FRAGMENTS VERSUS OOCYTES ALONE A. V. MAKAREVICH*, L. OLEXIKOVA, M. FÖLDEŠIOVÁ, J. PIVKO, E. KUBOVIČOVÁ NPPC Research Institute for Animal Production
More informationEffect of Equilibration Temperature on In vitro Viability and Subsequent Embryo Development of Vitrified-Warmed Immature Bovine Oocytes
American Journal of Animal and Veterinary Sciences 5 (2): 71-75, 2010 ISSN 1557-4555 2010 Science Publications Effect of Equilibration Temperature on In vitro Viability and Subsequent Embryo Development
More informationProtocol for embryo vitrification using open pulled straws. Introduction. Reagents. Materials
Protocol for embryo vitrification using open pulled straws Froylan Sosa and Peter J Hansen Department of Animal Sciences, University of Florida Introduction This vitrification protocol is a slight modification
More informationCryotop Vitrification Affects Oocyte Quality and Embryo Developmental Potential
Cronicon OPEN ACCESS Ling Jia*, Bo Xu*, Yu-sheng Liu and Xian-hong Tong Center for Reproductive Medicine, Anhui Provincial Hospital Affiliated to Anhui Medical University, China *These authors contributed
More informationRejuvenation of Gamete Cells; Past, Present and Future
Rejuvenation of Gamete Cells; Past, Present and Future Denny Sakkas PhD Scientific Director, Boston IVF Waltham, MA, USA Conflict of Interest I have no conflict of interest related to this presentation.
More informationEpigenetic marks in offspring of. cryopreserved immature ovary of mouse
6th Workshop on Mammalian folliculogenesis and oogenesis: from basic science to the clinic Epigenetic marks in offspring of cryopreserved immature ovary of mouse Nadine Binart Inserm U845, Paris, France
More informationUltrarapid freezing of early cleavage stage human embryos and eight-cell mouse embryos*
FERTILITY AND STERILITY Copyright 1988 The American Fertility Society Printed in U.S.A. Ultrarapid freezing of early cleavage stage human embryos and eight-cell mouse embryos* Alan Trounson, Ph.D.t:!:
More informationEffect of sucrose and propylene glycol on the vitrification of sheep oocytes
Journal of Cell and Animal Biology Vol. 7 (3), pp. 25-30, March 2013 Available online at http://www.academicjournals.org/jcab DOI: 10.5897/JCAB12.033 ISSN 1996-0867 2013 Academic Journals Full Length Research
More informationFluorescence Expression by Bovine Embryos after Pronuclear Microinjection with the EGFP Gene
Fluorescence Expression by Bovine Embryos after Pronuclear Microinjection with the EGFP Gene Masao MURAKAMI, Mokhamad FAHRUDIN, Modest Diamond VARISANGA and Tatsuyuki SUZUKI United Graduate School of Veterinary
More informationMicroinsemination (Intracytoplasmic Sperm Injection) Microinsemination schedule. 1. Preparation of mediums
Microinsemination (Intracytoplasmic Sperm Injection) Masumi Hirabayashi Section of Mammalian Transgenesis, Center for Genetic Analysis of Behavior, National Institute for Physiological Sciences, National
More informationLecture 27. Epigenetic regulation of gene expression during development
Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation
More informationRapiDVIT & rapidwarm oocyte. Specialised media for oocyte vitrification.
RapiDVIT & rapidwarm oocyte Specialised media for oocyte vitrification. Special media for A unique cell Cryopreservation of oocytes requires care. Some preservation techniques cause premature oocyte activation
More informationRNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using
Supplementary Information Materials and Methods RNA extraction, RT-PCR and real-time PCR. Total RNA were extracted using Trizol reagent (Invitrogen,Carlsbad, CA) according to the manufacturer's instructions.
More informationEpigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation
Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:
More informationREPRODUCTIVE BIOTECHNOLOGY IN SWINE
REPRODUCTIVE BIOTECHNOLOGY IN SWINE References * Animal breeding and infertility by M. J. Meredith * Controlled reproduction in pigs by I. Gordon * Reproduction in farm animals by E.S.E. Hafez * Progress
More informationAre all-freeze cycles & frozen-thawed embryo transfers improving IVF outcomes?
Are all-freeze cycles & frozen-thawed embryo transfers improving IVF outcomes? Andrea Weghofer Foundation for Reproductive Medicine 2017 New York, November 16-19 Conflict of interest No relevant financial
More informationThe 5th World congress of the INTERNATIONAL SOCIETY FOR FERTILITY PRESERVATION Vienna, Austria November 16-18, 2017
Vitrification: "Robots" versus Human Comparing automated vitrification outcomes The 5th World congress of the INTERNATIONAL SOCIETY FOR FERTILITY PRESERVATION Vienna, Austria November 16-18, 2017 Zsolt
More informationEffects of Preservation of Porcine Oocytes by Dibutyryl Cyclic AMP on in vitro Maturation, Fertilization and Development
JARQ 45 (3), 295 300 (2011) http://www.jircas.affrc.go.jp of Porcine Oocytes Using dbcamp Effects of of Porcine Oocytes by Dibutyryl Cyclic AMP on in vitro Maturation, Fertilization and Development Dai-ichiro
More informationDissecting gene regulation network in human early embryos. at single-cell and single-base resolution
Dissecting gene regulation network in human early embryos at single-cell and single-base resolution Fuchou Tang BIOPIC, College of Life Sciences Peking University 07/10/2015 Cockburn and Rossant, 2010
More informationRLI Mouse Vitrification Media Kit
RLI Mouse Vitrification Media Kit Product Description RLI Vitrification Media Kit (Catalog#: RLI Vitri-Cooling 01, RLI Vitri-Warming 01, RLI Vitri Complete Kit 01) enables ultra-rapid cooling and recovery
More informationM.Sc. (Reproductive Biology & Clinical Embryology)
M.Sc. (Reproductive Biology & Clinical Embryology) ACADEMIC SCHEDULE Theory (Didactic) Lectures + Seminars + Journal Clubs Semester I & II (2 hours / day) Practicals (Hands-on + Demo) Semester I & II (first
More informationSUPPORTING ONLINE MATERIAL
SUPPORTING ONLINE MATERIAL SUPPORTING ONLINE TEXT Efficiency of SCNT Alive fetuses at mid-gestation The rate of viable (beating heart) embryos at day 12.5-14.5 dpc was assessed after sacrifice of foster
More informationPreimplantation genetic diagnosis: polar body and embryo biopsy
Human Reproduction, Vol. 15, (Suppl. 4), pp. 69-75, 2000 Preimplantation genetic diagnosis: polar body and embryo biopsy Luca Gianaroli SISMER, Via Mazzini 12, 40138 Bologna, Italy Scientific Director
More informationImproved human oocyte development after vitrification: a comparison of thawing methods
FERTILITY AND STERILITY VOL. 72, NO. 1, JULY 1999 Copyright 1999 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. Improved human oocyte
More informationAdenosine Triphosphate Content in Human Unfertilized Oocytes, Undivided Zygotes and Embryos Unsuitable for Transfer or Cryopreservation
The Journal of International Medical Research 2012; 40: 734 739 Adenosine Triphosphate Content in Human Unfertilized Oocytes, Undivided Zygotes and Embryos Unsuitable for Transfer or Cryopreservation J
More informationEllen Anckaert, Sergio Romero, Tom Adriaenssens, Johan Smitz Follicle Biology Laboratory UZ Brussel, Brussels
Effects of low methyl donor levels during mouse follicle culture on follicle development, oocyte maturation and oocyte imprinting establishment. Ellen Anckaert, Sergio Romero, Tom Adriaenssens, Johan Smitz
More informationIn vitro production of equine embryos and genetic testing
In Vitro Fertilization (FIV) In Vitro Production of Equine Embryos and Preimplantation Genetic Testing Oocytes from or slaughterhouse ovaries Sperm sample Carolina Herrera, M Sc. Clinic for Reproductive
More informationToxic Effect of Cryoprotectants on Embryo Development in a Murine Model
: 31 1 2004 Kor J Fertil Steril, Vol 31, No 1, 2004, 3 1 2,, 1 2 3 3 3 3 3 3 3* Toxic Effect of Cryoprotectants on Embryo Development in a Murine Model Kwan Cheal Yang 1, Hee-Gyoo Kang 2,Hoi-ChangLee 3,
More informationJournal of Ningxia Medical University DMEM F12 GIBCO. 2mm mm 4mm 2mm vitrification group 10mm. 4mm 2mm VG 3
34 9 2012 9 Journal of Ningxia Medical University 869 1674-6309 2012 09-0869 - 03 FSH 1 2 1 1 1 1 1 1 3 1. 750004 2. 054000 3. 750001 FSH FSH 20 5mm 4mm 2mm 10mm 4mm 2mm 10μg FSH ml - 1 4. 5h FSH 1 2 -
More informationMethylation Dynamics in the Early Mammalian Embryo: Implications of Genome Reprogramming Defects for Development
CTMI (2006) 310:13 22 c Springer-Verlag Berlin Heidelberg 2006 Methylation Dynamics in the Early Mammalian Embryo: Implications of Genome Reprogramming Defects for Development T. Haaf ( ) Johannes Gutenberg-Universität
More informationEffect of the Well of the Well (WOW) System on In Vitro Culture for Porcine Embryos after Intracytoplasmic Sperm Injection
Journal of Reproduction and Development, Vol. 51, No. 4, 2005 Technical Note Effect of the Well of the Well (WOW) System on In Vitro Culture for Porcine Embryos after Intracytoplasmic Sperm Injection Mikiko
More informationVitrification of Oocytes: Biological Lessons Learned From Mice, Applied to Women
ESHRE Cryobiology Mtg Athens, Greece 9/26/09 Vitrification of Oocytes: Biological Lessons Learned From Mice, Applied to Women Gary D. Smith Ph.D., HCLD Associate Professor Director of Reproductive Sciences
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationASSISTED REPRODUCTIVE TECHNOLOGIES (ART)
ASSISTED REPRODUCTIVE TECHNOLOGIES (ART) Dr. Herve Lucas, MD, PhD, Biologist, Andrologist Dr. Taher Elbarbary, MD Gynecologist-Obstetrician Geneva Foundation for Medical Education and research Definitions
More informationBisphenol A Exposure Disrupts Genomic Imprinting in the Mouse
Bisphenol A Exposure Disrupts Genomic Imprinting in the Mouse Martha Susiarjo 1,2, Isaac Sasson 3, Clementina Mesaros 4, Marisa S. Bartolomei 1,2 * 1 Department of Cell and Developmental Biology, University
More informationVitrification: "Robots" versus Human Comparing automated vitrification outcomes
Vitrification: "Robots" versus Human Comparing automated vitrification outcomes The 5th World congress of the INTERNATIONAL SOCIETY FOR FERTILITY PRESERVATION Vienna, Austria November 16-18, 2017 Zsolt
More informationCARD HyperOva (Superovulation Reagent for mouse)
Product manual (Superovulation Reagent for mouse) Cat. No. KYD-010-EX -X5 Size: 5 1 ML Origin Serum of goat, Horse-derived villus gonatropin. Composition 1. Inhibin antiserum (Goat). 2. Equine chorionic
More informationFERTILITY PRESERVATION. Juergen Eisermann, M.D., F.A.C.O.G South Florida Institute for Reproductive Medicine South Miami Florida
FERTILITY PRESERVATION Juergen Eisermann, M.D., F.A.C.O.G South Florida Institute for Reproductive Medicine South Miami Florida 1 2 3 4 Oocyte Cryopreservation Experimental option Offer to single cancer
More informationSEQUENTIAL CULTURE MEDIA SYSTEM
SEQUENTIAL CULTURE MEDIA SYSTEM Gamete solutions... 7 Fertilization solutions...15 Cleavage solutions...21 Blastocyst solutions...27 STIC Media Stopper Removal Tool...35 Complete list of order numbers...36
More informationInfluence of Epidermal Growth Factor in the In vitro Development of Bovine Preimplantation Embryos
Available online at www.ijpab.com DOI: http://dx.doi.org/10.18782/2320-7051.6638 ISSN: 2320 7051 Int. J. Pure App. Biosci. 6 (5): 584-589 (2018) Research Article Influence of Epidermal Growth Factor in
More informationAnomalous mrna levels of chromatin remodeling genes in swamp buffalo (Bubalus bubalis) cloned embryos
Theriogenology 65 (2006) 1704 1715 www.journals.elsevierhealth.com/periodicals/the Anomalous mrna levels of chromatin remodeling genes in swamp buffalo (Bubalus bubalis) cloned embryos T. Suteevun a,b,
More informationPreimplantation Genetic Testing
Protocol Preimplantation Genetic Testing (40205) Medical Benefit Effective Date: 01/01/14 Next Review Date: 09/14 Preauthorization No Review Dates: 09/11, 09/12, 09/13 The following Protocol contains medical
More informationOpen Pulled Straw (OPS) Vitrification of Mus Musculus Morula and Blastocyst Survival in Two Common Cryopreservation Medias.
Open Pulled Straw (OPS) Vitrification of Mus Musculus Morula and Blastocyst Survival in Two Common Cryopreservation Medias A Senior Project presented to the Faculty of the Animal Science Department California
More informationEffect of different types of cryoprotectants on developmental capacity of vitrified-thawed immature buffalo oocytes
Anim. Reprod., v.11, n.4, p.543-548, Oct./Dec. 2014 Effect of different types of cryoprotectants on developmental capacity of vitrified-thawed immature buffalo oocytes K.H. El-Shahat 1,3, A.M. Hammam 2
More informationBlastocentesis: innovation in embryo biopsy
Blastocentesis: innovation in embryo biopsy L. Gianaroli, MC Magli, A. Pomante, AP Ferraretti S.I.S.Me.R. Reproductive Medicine Unit, Bologna, Italy Bologna, 8-11 May 2016 www.iiarg.com www.sismer.it 2013
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationLimited recovery of meiotic spindles in living human oocytes after cooling rewarming observed using polarized light microscopy
Human Reproduction Vol.16, No.11 pp. 2374 2378, 2001 Limited recovery of meiotic spindles in living human oocytes after cooling rewarming observed using polarized light microscopy Wei-Hua Wang 1,2,4, Li
More informationScientific Horizon Scanning at the HFEA. Annual Report 2009/10
Scientific Horizon Scanning at the HFEA Annual Report 2009/10 June 2010 Contents 3 1 Introduction 4 2 Work carried out during 2009 on issues identified previously 5 2.1 Health outcomes and birth defects
More informationSlow freezing of mouse embryos Slow freezing of domestic animal embryos Slow freezing of human embryos 1972 1973/74 1983 Slow freezing of human embryos Slow freezing of human oocytes 1985 1989 1993 1996
More informationFresh and Frozen Ovary Tissue Transplants: Mechanism of Adult Primordial Follicle Recruitment And Fetal Oocyte Arrest
Fresh and Frozen Ovary Tissue Transplants: Mechanism of Adult Primordial Follicle Recruitment And Fetal Oocyte Arrest Locking and Unlocking: Oocyte Meiosis and PGC differentiation Yasui et al 2012 Factors
More informationRescue IVF protocol for legacy stock
Rescue IVF protocol for legacy stock Sperm thawing/ivf protocol for MTG sperm samples (80ul per straw) from straw and conventional CPA from Vial (100ml per vial) This protocol is based on methods developed
More informationDevelopment of new comprehensive
Development and validation of an accurate quantitative real-time polymerase chain reaction based assay for human blastocyst comprehensive chromosomal aneuploidy screening Nathan R. Treff, Ph.D., a,b Xin
More informationColorado Center for Reproductive Medicine, Englewood, Colorado
FERTILITY AND STERILITY VOL. 72, NO. 6, DECEMBER 1999 Copyright 1999 American Society for Reproductive Medicine Published by Elsevier Science Inc. Printed on acid-free paper in U.S.A. REPRODUCTIVE BIOLOGY
More informationEFFECT OF VITRIFICATION AND CRYOSTORAGE LENGTH ON VIABILITY OF RABBIT EMBRYOS AFTER THAWING
World Rabbit Science Association Proceedings 10 th World Rabbit Congress September 3-6, 2012 Sharm El- Sheikh Egypt, 303-307 EFFECT OF VITRIFICATION AND CRYOSTORAGE LENGTH ON VIABILITY OF RABBIT EMBRYOS
More informationComprehensive chromosome screening is highly predictive of the reproductive potential of human embryos: a prospective, blinded, nonselection study
ORIGINAL ARTICLES: ASSISTED REPRODUCTION Comprehensive chromosome screening is highly predictive of the reproductive potential of human embryos: a prospective, blinded, nonselection study Richard T. Scott
More informationStudy of gene expression with molecular biological methods during mammalian embryo preimplantation development. Árpád Baji Gál
Study of gene expression with molecular biological methods during mammalian embryo preimplantation development PhD theses Árpád Baji Gál Doctoral School in Biology, Head of the School: Prof. Anna Erdei
More informationStrategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.
Strategic delivery: Setting standards Increasing and informing choice Demonstrating efficiency economy and value Details: Meeting Scientific and Clinical Advances Advisory Committee Agenda item 6 Paper
More informationto the Solution at Various Temperatures1
BIOLOGY OF REPRODUCTION 47, 1134-1139 (1992) Survival of Mouse Morulae Vitrified in an Ethylene Glycol-Based Solution after Exposure to the Solution at Various Temperatures1 M. KASAI,2 M. NISHIMORI, S.E.
More informationSupporting Information
Supporting Information Tanaka et al. 10.1073/pnas.1517466112 SI Materials and Methods Collection of Spermatogenic Cells from Azoospermic Men. We performed semen analysis at least twice for each man. When
More informationINFERTILITY SERVICES
INFERTILITY SERVICES Protocol: OBG036 Effective Date: August 1, 2018 Table of Contents Page COMMERCIAL COVERAGE RATIONALE... 1 DEFINITIONS... 4 MEDICARE AND MEDICAID COVERAGE RATIONALE... 5 REFERENCES...
More informationThe Effect of Biopsy During Precompacted Morula Stage on Post Vitrification Development of Blastocyst Derived Bovine Embryos
Short Communication The Effect of Biopsy During Precompacted Morula Stage on Post Vitrification Development of Derived Bovine Embryos Abolfazl Shirazi 1,2*, Sara Borjian 2, Ebrahim Ahmadi 1, Hassan Nazari
More informationInduction of the human sperm acrosome reaction by human oocytes*
FERTILITY AND STERILITY Copyright C> 1988 The American Fertility Society Vol. 50, No.6, December 1988 Printed in U.S.A. Induction of the human sperm acrosome reaction by human oocytes* Christopher J. De
More informationPurification of heparin binding oviduct specific proteins and its effect on in vitro embryo development in cattle
Indian Journal of Experimental Biology Vol. 51, May 2013, pp. 347-351 Purification of heparin binding oviduct specific proteins and its effect on in vitro embryo development in cattle Aditya K Sharma 1,
More informationHarmful or Not: Trichostatin A treatment of embryos generated by ICSI or ROSI
DOI: 10.2478/s11535-006-0023-5 Research article CEJB 1(3) 2006 376 385 Harmful or Not: Trichostatin A treatment of embryos generated by ICSI or ROSI Satoshi Kishigami, Hiroshi Ohta, Eiji Mizutani, Sayaka
More informationIn Vitro Bovine Embryo Development with Glucose and EDTA in Different Modifications of SOF Medium
2011 International Conference on Biology, Environment and Chemistry IPCBEE vol.24 (2011) (2011)IACSIT Press, Singapoore In Vitro Bovine Embryo Development with Glucose and EDTA in Different Modifications
More informationINDICATIONS OF IVF/ICSI
PROCESS OF IVF/ICSI INDICATIONS OF IVF/ICSI IVF is most clearly indicated when infertility results from one or more causes having no other effective treatment; Tubal disease. In women with blocked fallopian
More informationMouse sperm extraction:
Mouse sperm extraction: This method of extraction is used for acrosome reaction assays, immunocytochemistry and biochemical assays. Collect two cauda epidydimus from one male, cut them 5 times and place
More informationEMMA Cryopreservation Workshop Novel concepts in mouse production and preservation
EMMA Cryopreservation Workshop Novel concepts in mouse production and preservation Consejo Superior de Investigaciones Cientificas Madrid, Espagna May 7-8, 2012 K. C. Kent Lloyd, DVM, PhD University of
More informationIVF AND PREIMPLANTATION GENETIC TESTING FOR ANEUPLOIDY (PGT-A) WHAT THE COMMUNITY PHYSICIAN NEEDS TO KNOW
IVF AND PREIMPLANTATION GENETIC TESTING FOR ANEUPLOIDY (PGT-A) WHAT THE COMMUNITY PHYSICIAN NEEDS TO KNOW Jon Havelock, MD, FRCSC, FACOG Co-Director - PCRM Disclosure No conflict of interest in relation
More informationIn-vitro maturation of camel oocytes using different media and sera
In-vitro maturation of camel oocytes using different media and sera A. E. B. Zeidan 1, M. E. Hammad 2, Sh. A. Gabr 2, M. H. Farouk 3*, Sh. M. Shamiah 1, E. A. A. Ahmadi 1 and W. M. A. Nagy 1. 1 Dept. Camel
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationThe IVF Bioscience Media Brochure
The IVF Bioscience Media Brochure IVF Bioscience Visit us at ivfbioscience.com to find out more IVF Bioscience manufactures high quality, species specific media for in vitro fertilisation (IVF). Our innovative
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph
More informationThe work of a fertility specialist Steven Fleming PhD Honorary Associate, University of Sydney Director of Embryology, ORIGIO a/s
The work of a fertility specialist Steven Fleming PhD Honorary Associate, University of Sydney Director of Embryology, ORIGIO a/s sfleming@origio.com Scope of work Evaluation and diagnosis of the infertile
More informationEffect of Leukemia Inhibiton Factor (LIF) on in vitro maturation and fertilization of matured cattle oocytes
Theriogenology Insight: 4(3): 17-111, December, 214 DOI Number: 1.98/2277-3371.214.74.2 Effect of Leukemia Inhibiton Factor (LIF) on in vitro maturation and fertilization of matured cattle oocytes K M
More informationFertility What do GP s need to know? Richard Fisher Fertility Associates
Fertility 2010 What do GP s need to know? Richard Fisher Fertility Associates New Zealand Source: Max Planck Institute Average age of mother at first birth in New Zealand 35 30 25 20 15 10 5 0 Median Mean
More informationINFRAFRONTIER-I3 - Cryopreservation training course. Hosted by the Frozen Embryo and Sperm Archive, MRC - Harwell
Hosted by the Frozen Embryo and Sperm Archive, MRC - Harwell IVF recovery procedure incorporting methyl-β-cyclodextrin and reduced glutathione This protocol is based on the work published by Takeo et al.,
More informationICSI with sperm derived from cultured testes (Nature 2011) Establishment of rabbit ips cells (J Biol Chem 2010)
Efficient production of offspring in wild-derived strains of mice (Biol Reprod in press) (Presented by Keiji Mochida) Birth of offspring from ectopically transplanted PGCs (Biol Reprod 211) ICSI with sperm
More informationIn Vitro Maturation and Embryo Production in Cattle
2 In Vitro Maturation and Embryo Production in Cattle Marc-André Sirard and Karine Coenen Summary When immature bovine oocytes are released from their follicles and are cultured in standard maturation
More informationTitle. CitationJapanese Journal of Veterinary Research, 62(3): 135- Issue Date DOI. Doc URL. Type. File Information. surrounding oocytes
Title Effects of in vitro-growth culture duration on ferti surrounding oocytes Author(s)Huang, Weiping; Kang, Sung-Sik; Yanagawa, Yojiro; Ya CitationJapanese Journal of Veterinary Research, 62(3): 135-
More informationThe use of mitochondrial nutrients to improve IVF. Robert F Casper MD
The use of mitochondrial nutrients to improve IVF Robert F Casper MD Reproductive Aging Women in the developed world are delaying childbirth for many reasons In the last 10 years, first births for: Women
More informationIVF: PAST, PRESENT AND FUTURE
IVF: PAST, PRESENT AND FUTURE Mark Larman Chief Scientific Officer 1 HISTORY OF IVF IVF first achieved with rabbits in 1959 IVF with human gametes - pioneered by Robert Edwards and Patrick Steptoe during
More informationSNP array-based analyses of unbalanced embryos as a reference to distinguish between balanced translocation carrier and normal blastocysts
J Assist Reprod Genet (2016) 33:1115 1119 DOI 10.1007/s10815-016-0734-0 TECHNOLOGICAL INNOVATIONS SNP array-based analyses of unbalanced embryos as a reference to distinguish between balanced translocation
More information(a) Departamento de Ginecologia, Universidade Federal de São Paulo. (b) Centro de Reprodução Humana Fertivitro, São Paulo, Brazil.
Human Reproduction Center São Paulo Brasil Aline de Cássia Azevedo (a,b) ; Fernanda Coimbra Miyasato (b) ; Litsuko S. Fujihara (b), Maria Cecília R.M. Albuquerque (b), Ticiana V. Oliveira (b), Luiz Eduardo
More informationDNA methylation Dots(+) CxxC EGFP DAP
a 1.2 b 5mC PI Merge n level Relativ ve expressio 1.0 0.8 0.6 0.4 0.2 0 a b c Wildtype Gadd45 Gadd4 45b KO Figure S1. Gadd45b-deficiency does not affect paternal DNA demethylation (a) Relative expression
More informationGel-Loading Tip Vitrification of In Vitro- Matured Bovine Oocytes and Subsequent Embryo Production by IVF and Nuclear Transfer
J. Mamm. Ova Res. Vol. 22, 178 184, 2005 178 Original Gel-Loading Tip Vitrification of In Vitro- Matured Bovine Oocytes and Subsequent Embryo Production by IVF and Nuclear Transfer Keiichiro Tominaga 1
More informationTitle. Author(s)TEKELI, Tevfik; KWEON, Oh Kyeong; KANAGAWA, Hiroshi. CitationJapanese Journal of Veterinary Research, 35(4): 283-
Title THE VIABILITY OF DEEP-FROZEN AGGREGATED MOUSE EMBRYO Author(s)TEKELI, Tevfik; KWEON, Oh Kyeong; KANAGAWA, Hiroshi CitationJapanese Journal of Veterinary Research, 35(4): 283- Issue Date 1987-10-30
More information