Dissecting gene regulation network in human early embryos. at single-cell and single-base resolution
|
|
- Ariel Dalton
- 5 years ago
- Views:
Transcription
1 Dissecting gene regulation network in human early embryos at single-cell and single-base resolution Fuchou Tang BIOPIC, College of Life Sciences Peking University 07/10/2015
2 Cockburn and Rossant, 2010 Mammalian embryonic development starts from a single cell - zygote
3 Single Cell Transcriptome Single Cell Genome Low number of Cells Epigenome In vivo In vitro In vivo In vivo In vitro Key SNVs Key Transcription Factors Crucial epigenetic codes Gene Expression Network Epigenetic Network Cell Fate Determination (Early Embryonic Development) Mouse Model (Gene Knockout & Knockdown) Human ES Cell Model (Gene Knockdown & Overexpression) Early Embryo Dissecting Gene Regulation Network of Human Early Embryos
4 Isolation of single cells from human preimplantation embryos
5 An individual human embryonic cell expresses: 18,022 RefSeq transcripts; 13,772 Ensembl transcripts. Single cell RNA-Seq of human early embryos (Yan et al., Nature Structural & Molecular Biology, 2013)
6 Global DNA methylome changes during mammalian embryonic development (Saitou et al., Development 2012)
7 Single cell DNA methylome analysis (Guo et al., Genome Research, 2013)
8 Global DNA methylation dynamics of human early embryos (Guo et al., Nature, 2014)
9 Gene imprinting dynamics of human early embryos
10 Differentially Methylated Regions (DMRs) of human early embryos
11 Differentially Methylated Regions (DMRs) of human early embryos
12 Global DNA methylation dynamics of human early embryos
13 Discriminate male & female pronuclei within individual zygotes
14 Global DNA methylation at zygote stage within individual pronuclei
15 Global DNA methylation at zygote stage within individual pronuclei
16 Active DNA demethylation in both maternal & paternal genome in mouse zygotes (Guo et al., Cell Stem Cell, 2014)
17 Active DNA demethylation is dependent on Tet3 (Guo et al., Cell Stem Cell, 2014)
18 Active DNA demethylation removed 5mCpG on both strands
19 Active DNA demethylation leads to unmodified cytosines
20 Active DNA demethylation is independent on TDG
21 Single cell SUPER-Seq analysis of mouse early embryos (Fan et al., Genome Biology, 2015)
22 SUPER-Seq analysis of averaged single cells (HEK-293 cells)
23 SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos
24 SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos
25 SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos
26 SUPER-Seq analysis to detect novel polya minus RNAs in mouse preimplantation embryos
27 SUPER-Seq analysis to detect novel polya minus RNAs in mouse preimplantation embryos
28 SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)
29 SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)
30 SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)
31 SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)
32 SUPER-Seq analysis to detect polya minus RNAs in human preimplantation embryos (Unpublished)
33 Summary of single cell genome sequencing of human oocytes (Hou et al., Cell, 2013)
34 CNV CNV An Oocyte from Donor #1 with Chromosome Abnormality 1 st Polar Body 2 nd Polar Body Female pronucleus predicted Female pronucleus observed Total chromosome copy numbers conserved in the whole oocyte
35 Aneuploidy rate for each donor
36 8-cell stage embryos from Donor #9 with Chromosome Abnormality
37 Stage No. of Single Cells GV oocyte 8 MII oocyte 42 Sperm 7 2-cell embryo 21 4-cell embryo 25 8-cell embryo 8 TE 9 ICM 11 Total 131 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)
38 Stage No. of Samples No. of Samples Showing CNVs GV oocyte 8 0 MII oocyte 42 5 Sperm cell embryo cell embryo 25 3 TE 6 1 ICM 12 7 Blastocyst 4 1 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)
39 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)
40 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)
41 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)
42 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)
43 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)
44 DNA methylation dynamics during human early embryonic development
45 Acknowledgements Sunney Xie Jie Qiao Ruiqiang Li Yanyi Huang Guoliang Xu Jinsong Li Guanghui Liu Chuan He Jirun Peng Bing Liu Chunsheng Han Yu Hou Hongshan Guo Lin Li
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells
Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Liying Yan,2,5, Mingyu Yang,5, Hongshan Guo, Lu Yang, Jun Wu, Rong Li,2, Ping Liu, Ying Lian, Xiaoying Zheng, Jie
More informationResults. Abstract. Introduc4on. Conclusions. Methods. Funding
. expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole
More informationAllelic reprogramming of the histone modification H3K4me3 in early mammalian development
Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ
More informationResearch programs involving human early embryos
Research programs involving human early embryos 1. Understanding normal mammalian embryo development 2. Understanding errors in genetic and epigenetic programs 3. Providing research and therapeutic tools
More informationGenetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
More informationLecture 27. Epigenetic regulation of gene expression during development
Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation
More informationEmbryogenesis begins during oogenesis
7th Workshop Mammalian Folliculogenesis and Oogenesis ESHRE Campus symposium Stresa, Italy 19 21 April 2012 Acquisition of the oocyte developmental competence Maurizio Zuccotti Embryogenesis begins during
More informationName: Xueming Zhao. Professional Title: Professor. Animal embryo biotechnology, mainly including in vitro maturation (IVM), in vitro fertilization
Name: Xueming Zhao Professional Title: Professor Telephone:86-010-62815892 Fax:86-010-62895971 E-mail: zhaoxueming@caas.cn Website: http://www.iascaas.net.cn/yjspy/dsjj/sssds/dwyzyzypz1/62040.htm Research
More informationAn epigenetic approach to understanding (and predicting?) environmental effects on gene expression
www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics
More informationSUPPLEMENTARY INFORMATION
Supplementary text Collectively, we were able to detect ~14,000 expressed genes with RPKM (reads per kilobase per million) > 1 or ~16,000 with RPKM > 0.1 in at least one cell type from oocyte to the morula
More informationEpigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation
Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII
More informationProgramming and Inheritance of Parental DNA Methylomes in Mammals
Resource Programming and Inheritance of Parental DNA Methylomes in Mammals Lu Wang, 1,3,9 Jun Zhang, 4,9 Jialei Duan, 1,9 Xinxing Gao, 4,9 Wei Zhu, 1,3 Xingyu Lu, 5 Lu Yang, 6 Jing Zhang, 1 Guoqiang Li,
More informationComputational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
More informationDNA methylation Dots(+) CxxC EGFP DAP
a 1.2 b 5mC PI Merge n level Relativ ve expressio 1.0 0.8 0.6 0.4 0.2 0 a b c Wildtype Gadd45 Gadd4 45b KO Figure S1. Gadd45b-deficiency does not affect paternal DNA demethylation (a) Relative expression
More informationSingle-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells
Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells Liying Yan 1,2,5, Mingyu Yang 1,5, Hongshan Guo 1, Lu Yang 1, Jun Wu 1, Rong Li 1,2, Ping Liu 1, Ying Lian 1, Xiaoying
More informationOxidative stress in sperm affects the epigenetic reprogramming in early embryonic development
https://doi.org/10.1186/s13072-018-0224-y Epigenetics & Chromatin RESEARCH Open Access Oxidative stress in sperm affects the epigenetic reprogramming in early embryonic development Sarah Wyck 1,2,3, Carolina
More informationToday. Genomic Imprinting & X-Inactivation
Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic
More informationChanges in histone methylation during human oocyte maturation and IVF- or ICSI-derived embryo development
Changes in histone methylation during human oocyte maturation and IVF- or ICSI-derived embryo development Jie Qiao, M.D., a Yuan Chen, Ph.D., a Li-Ying Yan, Ph.D., a Jie Yan, Ph.D., a Ping Liu, Ph.D.,
More informationTet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes
Article Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes Graphical Abstract Authors Li Shen, Azusa Inoue,..., Falong Lu, Yi Zhang Correspondence
More informationSupplementary Information
Supplementary Information 1 Supplementary information, Figure S1 Establishment of PG-haESCs. (A) Summary of derivation of PG-haESCs. (B) Upper, Flow analysis of DNA content of established PG-haES cell
More informationImprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821
Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes
More informationNuclear reprogramming of sperm and somatic nuclei in eggs and oocytes
Reprod Med Biol (2013) 12:133 149 DOI 10.1007/s12522-013-0155-z REVIEW ARTICLE Nuclear reprogramming of sperm and somatic nuclei in eggs and oocytes Marta Teperek Kei Miyamoto Received: 27 March 2013 /
More informationIncrease your chance of IVF Success. PGT-A Preimplantation Genetic Testing for Aneuploidy (PGS 2.0)
Increase your chance of IVF Success PGT-A Preimplantation Genetic Testing for Aneuploidy (PGS 2.0) What is PGT-A? PGT-A, or Preimplantation Genetic Testing for Aneuploidy (PGS 2.0), is a type of genomic
More informationStrategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.
Strategic delivery: Setting standards Increasing and informing choice Demonstrating efficiency economy and value Details: Meeting Scientific and Clinical Advances Advisory Committee Agenda item 6 Paper
More informationMALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)
MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) The Power of One Adapted from Internet Single Cell Genomic Studies Ultra Low Sample Input Advances and applications of
More informationTelomeres and Genomic Instability In Preimplanation Embryos. David L. Keefe, M.D.
Telomeres and Genomic Instability In Preimplanation Embryos David L. Keefe, M.D. I. Global Genomic Instability, Including Aneuploidy, Mosaicism & Copy Number Variants, is Common In Preimplantation Embryos
More informationClinical Genomics. Ina E. Amarillo, PhD FACMGG
Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing
More informationEpigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation
Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:
More informationFoundational questions Oocyte-derived functional mediators of early embryonic development (EST and candidate gene) JY-1 Nobox Importin 8 Oocyte and cu
Models for study of oocyte competence: George W. Smith (Smithge7@msu.edu) Foundational questions Oocyte-derived functional mediators of early embryonic development (EST and candidate gene) JY-1 Nobox Importin
More informationMethylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine
Univ.-Prof. Dr. Thomas Haaf Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine Epigenetics and DNA methylation Heritable change of
More informationSelective impairment of methylation maintenance is the major cause of DNA methylation reprogramming in the early embryo
Arand et al. Epigenetics & Chromatin 2015, 8:1 RESEARCH Open Access Selective impairment of methylation maintenance is the major cause of DNA methylation reprogramming in the early embryo Julia Arand 1,4,
More informationBiology Developmental Biology Spring Quarter Midterm 1 Version A
Biology 411 - Developmental Biology Spring Quarter 2013 Midterm 1 Version A 75 Total Points Open Book Choose 15 out the 20 questions to answer (5 pts each). Only the first 15 questions that are answered
More informationEpigenetics and inheritance of phenotype variation in livestock
DOI 10.1186/s13072-016-0081-5 Epigenetics & Chromatin REVIEW Open Access Epigenetics and inheritance of phenotype variation in livestock Kostas A. Triantaphyllopoulos 1*, Ioannis Ikonomopoulos 2 and Andrew
More informationTargeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L
Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome
More informationEpigenetics: A historical overview Dr. Robin Holliday
Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.
More informationoocytes were pooled for RT-PCR analysis. The number of PCR cycles was 35. Two
Supplementary Fig. 1 a Kdm3a Kdm4b β-actin Oocyte Testis Oocyte Testis Oocyte Testis b 1.8 Relative expression.6.4.2 Kdm3a Kdm4b RT-PCR analysis of Kdm3a and Kdm4b expression in oocytes and testes. Twenty
More informationTet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes
Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes The Harvard community has made this article openly available. Please share how this access benefits
More informationRejuvenation of Gamete Cells; Past, Present and Future
Rejuvenation of Gamete Cells; Past, Present and Future Denny Sakkas PhD Scientific Director, Boston IVF Waltham, MA, USA Conflict of Interest I have no conflict of interest related to this presentation.
More informationTranscriptional repression of Xi
Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.
More informationFragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
More informationDRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018
DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018 Director:, DVM, Ph.D. 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve
More informationSession 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology
Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches
More informationDynamic CpG island methylation landscape in oocytes and preimplantation embryos
Europe PMC Funders Group Author Manuscript Published in final edited form as: Nat Genet. ; 43(8): 811 814. doi:10.1038/ng.864. Dynamic CpG island methylation landscape in oocytes and preimplantation embryos
More informationNon-invasive methods of embryo selection
Non-invasive methods of embryo selection Liow Swee Lian O & G Partners Fertility Centre Gleneagles Hospital SINGAPORE Introduction More physiological laboratory procedures and culture systems have significantly
More informationDNA methylation & demethylation
DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not
More informationGenetics and Genomics in Medicine Chapter 6. Questions & Answers
Genetics and Genomics in Medicine Chapter 6 Multiple Choice Questions Questions & Answers Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the
More informationEpigenetics: Basic Principals and role in health and disease
Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics
More informationJoanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015
Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms
More informationJayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
More informationLarge conserved domains of low DNA methylation maintained by Dnmt3a
Supplementary information Large conserved domains of low DNA methylation maintained by Dnmt3a Mira Jeong# 1, Deqiang Sun # 2, Min Luo# 1, Yun Huang 3, Grant A. Challen %1, Benjamin Rodriguez 2, Xiaotian
More informationOntogeny of CpG island methylation and specificity of DNMT3 methyltransferases during embryonic development in the mouse
Auclair et al. Genome Biology (2014) 15:545 DOI 10.1186/s13059-014-0545-5 RESEARCH Open Access Ontogeny of CpG island methylation and specificity of DNMT3 methyltransferases during embryonic development
More informationTelomeres in human oocytes. contribution to chromosome (in)stability?
Telomeres in human oocytes and embryos: maternal contribution to chromosome (in)stability? Hartshorne GM, Turner S, Rai J, Wong H-P. Warwick Medical School, University of Warwick, UK geraldine.hartshorne@warwick.ac.uk
More informationRESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)
Thursday 5 November EU-India PARTNERING EVENT Theme: Health RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) CNRS, INSERM,
More informationTransferring Fragments of Paternal Metabolism to the Offspring. Erica D. Watson 1,* UK, CB2 3EG. *Correspondence:
Transferring Fragments of Paternal Metabolism to the Offspring Erica D. Watson 1,* 1 Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge UK, CB2 3EG. *Correspondence:
More informationMethylation Dynamics in the Early Mammalian Embryo: Implications of Genome Reprogramming Defects for Development
CTMI (2006) 310:13 22 c Springer-Verlag Berlin Heidelberg 2006 Methylation Dynamics in the Early Mammalian Embryo: Implications of Genome Reprogramming Defects for Development T. Haaf ( ) Johannes Gutenberg-Universität
More informationArticle Pre-embryonic diagnosis for Sandhoff disease
RBMOnline - Vol 12. No 3. 2006 328-333 Reproductive BioMedicine Online; www.rbmonline.com/article/2100 on web 9 January 2006 Article Pre-embryonic diagnosis for Sandhoff disease Dr Anver Kuliev received
More informationDRB666 Applied Developmental and Reproductive Biology (Spring 2013)
DRB666 Applied Developmental and Reproductive Biology (Spring 2013) Director: 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve Ward Yusuke Marikawa
More informationCHAIRE ÉPIGÉNÉTIQUE ET MÉMOIRE CELLULAIRE. Année : Reprogrammations développementales, induites et pathologiques
CHAIRE ÉPIGÉNÉTIQUE ET MÉMOIRE CELLULAIRE Année 2013-2014 : Reprogrammations développementales, induites et pathologiques Cours II Etapes de la reprogrammation au cours du développement chez les mammifères
More informationDPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos
Epigenetics ISSN: 1559-2294 (Print) 1559-2308 (Online) Journal homepage: http://www.tandfonline.com/loi/kepi20 DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for
More informationTransgenerational Epigenetic Inheritance
Transgenerational Epigenetic Inheritance TOP ARTICLES SUPPLEMENT CONTENTS EDITORIAL:: Epigenetics: where environment, society and genetics meet Epigenomics Vol. 6 Issue 1 REVIEW: Transgenerational epigenetic
More informationAnimal Development. Lecture 3. Germ Cells and Sex
Animal Development Lecture 3 Germ Cells and Sex 1 The ovary of sow. The ovary of mare. The ovary of cow. The ovary of ewe. 2 3 The ovary. A generalized vertebrate ovary. (Wilt and Hake, Ch 2, 2004) 4 The
More informationOocyte and Sperm from ipscs
Key Points University of Miyazaki, RIKEN, Kyoto University, Shiga University of Medical Science, Hokkaido University Oocyte and Sperm from ipscs of an Endangered Species -Sexual flexibility of endangered
More informationDRB666 Applied Developmental and Reproductive Biology Spring Semester, 2011
DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2011 Director: 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve Ward Yusuke
More informationBIOLOGY
Int. J. Dev. Biol. 54: 1323-1328 (2010) doi: 10.1387/ijdb.092973jp THE INTERNATIONAL JOURNAL OF DEVELOPMENTAL BIOLOGY www.intjdevbiol.com Active loss of DNA methylation in two-cell stage goat embryos JUNG
More informationKing s Research Portal
King s Research Portal DOI:.86/756-8935-7-26 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA):
More informationGCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
More informationRole of Tet1 in genomic imprinting erasure
Role of Tet1 in genomic imprinting erasure The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Yamaguchi, Shinpei, Li Shen,
More informationOverview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment
Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development
More informationEllen Anckaert, Sergio Romero, Tom Adriaenssens, Johan Smitz Follicle Biology Laboratory UZ Brussel, Brussels
Effects of low methyl donor levels during mouse follicle culture on follicle development, oocyte maturation and oocyte imprinting establishment. Ellen Anckaert, Sergio Romero, Tom Adriaenssens, Johan Smitz
More informationRole of Cnot6l in maternal mrna turnover
Published Online: 16 July, 2018 Supp Info: http://doi.org/10.26508/lsa.201800084 Downloaded from life-science-alliance.org on 21 April, 2019 Role of Cnot6l in maternal mrna turnover Filip Horvat, Helena
More informationEpigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
More informationDNA methylation and hydroxymethylation in early rabbit embryos: Consequences of in vitro culture. Bedhane Mohammed
European Master in Animal Breeding and Geneti cs (EM-ABG) Master Scie ces et Tech ologies du Viva t et de l E viro e e t Spécialité : Génétique Animale, Génome et Diversité DNA methylation and hydroxymethylation
More informationbut it still needs a bit of work
but it still needs a bit of work jc@embryos.net Reprogenetics ART Institute of Washington Life Global Principle investigator of cytoplasmic transfer series (1996-2001) Is there an alternative to MRT? Lessons
More informationIntroduction: DNA methylation in mammals. DNA+Histones=Chromatin. Long-lasting cellular memory
Séminaire de présentation des projets de l APR 2010 MIISTÈREDEL ÉCOLOGIE DU DÉVELOPPEMET DURABLE, DU TRASPORT ETDELAMER MethylED: Impact of Endocrine Disruptors on genomic DA methylation patterns in the
More informationAre you the way you are because of the
EPIGENETICS Are you the way you are because of the It s my fault!! Nurture Genes you inherited from your parents? Nature Experiences during your life? Similar DNA Asthma, Autism, TWINS Bipolar Disorders
More informationDynamic Reprogramming of DNA Methylation in the Early Mouse Embryo
Developmental Biology 241, 172 182 (2002) doi:10.1006/dbio.2001.0501, available online at http://www.idealibrary.com on Dynamic Reprogramming of DNA Methylation in the Early Mouse Embryo Fátima Santos,*
More informationPaternal Poly (ADP-ribose) Metabolism Modulates Retention of Inheritable Sperm Histones and Early Embryonic Gene Expression
University of Pennsylvania ScholarlyCommons Departmental Papers (Biology) Department of Biology 5-2014 Paternal Poly (ADP-ribose) Metabolism Modulates Retention of Inheritable Sperm Histones and Early
More informationThe effects of PGS/PGT-A on IVF outcomes
The effects of PGS/PGT-A on IVF outcomes Raoul Orvieto M.D. - Department of Obstetrics and Gynecology, Chaim Sheba Medical Center, Ramat Gan, Israel - The Tarnesby-Tarnowski Chair for Family Planning and
More informationDNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations. Peter de Boer
DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations Peter de Boer Department of Obst.& Gynaecology, Div. Reproductive Medicine Radboud University Nijmegen Medical
More informationPaternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale
Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental
More informationGenome Analyses of Single Human Oocytes
enome nalyses of Single Human Oocytes Yu Hou, 1,6 Wei Fan, 1,4,6 Liying Yan, 1,6 Rong Li, 1 Ying Lian, 1 Jin Huang, 1 Jinsen Li, 1 Liya Xu, 1 Fuchou ang, 1,5, * X. Sunney Xie, 1,2, * and Jie Qiao 1,3,
More information4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider
Objectives Epigentics: You Might Be What Your Grandmother Ate Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome
More informationTHE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15
THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 What you must know: Inheritance in sex-linked genes. Inheritance of linked genes and chromosomal mapping. How alteration of chromosome number or structurally
More informationRegulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
More informationEpigenetic Inheritance
(2) The role of Epigenetic Inheritance Lamarck Revisited Lamarck was incorrect in thinking that the inheritance of acquired characters is the main mechanism of evolution (Natural Selection more common)
More informationStem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
More informationArticles Somatic cell haploidization: an update
RBMOnline - Vol 6. No 1. 60 65 Reproductive BioMedicine Online; www.rbmonline.com/article/717 on web 4 November 2002 Articles Somatic cell haploidization: an update Jan Tesarik obtained his MD degree in
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationDNA METHYLATION IN EARLY MAMMALIAN DEVELOPMENT
ARISTEA MARIA MAGARAKI DNA METHYLATION IN EARLY MAMMALIAN DEVELOPMENT Supervised by Dr. Petra de Graaf Physiological Chemistry, UMC DNA METHYLATION DURING EARLY MAMMALIAN DEVELOPMENT Master student: Aristea
More informationDiagnostic Techniques to Improve the Assessment of Human IVF Embryos: Genomics and Proteomics
Diagnostic Techniques to Improve the Assessment of Human IVF Embryos: Genomics and Proteomics Mandy G Katz-Jaffe Introduction A fundamental component of assisted reproductive technologies (ART) is the
More informationSupplementary tables and figure legends
Supplementary tables and figure legends Suzuki et al., Mitotic Reprogramming of Sperm, Supplementary Information, 5/7/16, page 1 Supplementary Figure 1 Characteristics of mouse preimplantation development
More informationPreimplantation genetic diagnosis: polar body and embryo biopsy
Human Reproduction, Vol. 15, (Suppl. 4), pp. 69-75, 2000 Preimplantation genetic diagnosis: polar body and embryo biopsy Luca Gianaroli SISMER, Via Mazzini 12, 40138 Bologna, Italy Scientific Director
More informationEpigenetic processes are fundamental to development because they permit a
Early Life Nutrition and Epigenetic Markers Mark Hanson, PhD Epigenetic processes are fundamental to development because they permit a range of phenotypes to be formed from a genotype. Across many phyla
More informationOVERVIEW OF EPIGENETICS
OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive
More informationDNA Methylation and Cancer
DNA Methylation and Cancer October 25, 2016 Dominic Smiraglia, Ph.D. Department of Cancer Genetics From Alan Wolffe, Science and Medicine, 1999 Vital Statistics Human genome contains 3 billion bp ~ 50,000
More informationEPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
More informationZongliang (Carl) Jiang. 333 Cedar St, New Haven, CT OBJECTIVE
Zongliang (Carl) Jiang 333 Cedar St, New Haven, CT 06510 860-786-8766 zongliang.jiang@yale.edu OBJECTIVE To conduct research and teaching in the areas of animal reproduction, epigenetics, and stem cell
More informationStudy on Several Factors Involved in IVF-ET of Human Beings
Study on Several Factors Involved in IVF-ET of Human Beings Lei X 1, Zhuoran W 1, Bin L 1, Huiming L 1, Hongxiu Z 1, Yajuan Z 1, Yingbo Q 1, Guixue Z 2 1 The First Clinical College of Harbin Medical University,
More informationEpigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm
Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.
More informationSupplementary Materials and Methods
Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph
More information