Dissecting gene regulation network in human early embryos. at single-cell and single-base resolution

Size: px
Start display at page:

Download "Dissecting gene regulation network in human early embryos. at single-cell and single-base resolution"

Transcription

1 Dissecting gene regulation network in human early embryos at single-cell and single-base resolution Fuchou Tang BIOPIC, College of Life Sciences Peking University 07/10/2015

2 Cockburn and Rossant, 2010 Mammalian embryonic development starts from a single cell - zygote

3 Single Cell Transcriptome Single Cell Genome Low number of Cells Epigenome In vivo In vitro In vivo In vivo In vitro Key SNVs Key Transcription Factors Crucial epigenetic codes Gene Expression Network Epigenetic Network Cell Fate Determination (Early Embryonic Development) Mouse Model (Gene Knockout & Knockdown) Human ES Cell Model (Gene Knockdown & Overexpression) Early Embryo Dissecting Gene Regulation Network of Human Early Embryos

4 Isolation of single cells from human preimplantation embryos

5 An individual human embryonic cell expresses: 18,022 RefSeq transcripts; 13,772 Ensembl transcripts. Single cell RNA-Seq of human early embryos (Yan et al., Nature Structural & Molecular Biology, 2013)

6 Global DNA methylome changes during mammalian embryonic development (Saitou et al., Development 2012)

7 Single cell DNA methylome analysis (Guo et al., Genome Research, 2013)

8 Global DNA methylation dynamics of human early embryos (Guo et al., Nature, 2014)

9 Gene imprinting dynamics of human early embryos

10 Differentially Methylated Regions (DMRs) of human early embryos

11 Differentially Methylated Regions (DMRs) of human early embryos

12 Global DNA methylation dynamics of human early embryos

13 Discriminate male & female pronuclei within individual zygotes

14 Global DNA methylation at zygote stage within individual pronuclei

15 Global DNA methylation at zygote stage within individual pronuclei

16 Active DNA demethylation in both maternal & paternal genome in mouse zygotes (Guo et al., Cell Stem Cell, 2014)

17 Active DNA demethylation is dependent on Tet3 (Guo et al., Cell Stem Cell, 2014)

18 Active DNA demethylation removed 5mCpG on both strands

19 Active DNA demethylation leads to unmodified cytosines

20 Active DNA demethylation is independent on TDG

21 Single cell SUPER-Seq analysis of mouse early embryos (Fan et al., Genome Biology, 2015)

22 SUPER-Seq analysis of averaged single cells (HEK-293 cells)

23 SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos

24 SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos

25 SUPER-Seq analysis to detect circrnas in mouse preimplantation embryos

26 SUPER-Seq analysis to detect novel polya minus RNAs in mouse preimplantation embryos

27 SUPER-Seq analysis to detect novel polya minus RNAs in mouse preimplantation embryos

28 SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)

29 SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)

30 SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)

31 SUPER-Seq analysis to detect circrnas in human preimplantation embryos (Unpublished)

32 SUPER-Seq analysis to detect polya minus RNAs in human preimplantation embryos (Unpublished)

33 Summary of single cell genome sequencing of human oocytes (Hou et al., Cell, 2013)

34 CNV CNV An Oocyte from Donor #1 with Chromosome Abnormality 1 st Polar Body 2 nd Polar Body Female pronucleus predicted Female pronucleus observed Total chromosome copy numbers conserved in the whole oocyte

35 Aneuploidy rate for each donor

36 8-cell stage embryos from Donor #9 with Chromosome Abnormality

37 Stage No. of Single Cells GV oocyte 8 MII oocyte 42 Sperm 7 2-cell embryo 21 4-cell embryo 25 8-cell embryo 8 TE 9 ICM 11 Total 131 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

38 Stage No. of Samples No. of Samples Showing CNVs GV oocyte 8 0 MII oocyte 42 5 Sperm cell embryo cell embryo 25 3 TE 6 1 ICM 12 7 Blastocyst 4 1 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

39 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

40 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

41 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

42 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

43 Single cell multiple omics sequencing of human preimplantation embryos (Unpublished)

44 DNA methylation dynamics during human early embryonic development

45 Acknowledgements Sunney Xie Jie Qiao Ruiqiang Li Yanyi Huang Guoliang Xu Jinsong Li Guanghui Liu Chuan He Jirun Peng Bing Liu Chunsheng Han Yu Hou Hongshan Guo Lin Li

Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells

Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Single-cell RNA-Seq profiling of human pre-implantation embryos and embryonic stem cells Liying Yan,2,5, Mingyu Yang,5, Hongshan Guo, Lu Yang, Jun Wu, Rong Li,2, Ping Liu, Ying Lian, Xiaoying Zheng, Jie

More information

Results. Abstract. Introduc4on. Conclusions. Methods. Funding

Results. Abstract. Introduc4on. Conclusions. Methods. Funding . expression that plays a role in many cellular processes affecting a variety of traits. In this study DNA methylation was assessed in neuronal tissue from three pigs (frontal lobe) and one great tit (whole

More information

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development

Allelic reprogramming of the histone modification H3K4me3 in early mammalian development Allelic reprogramming of the histone modification H3K4me3 in early mammalian development 张戈 Method and material STAR ChIP seq (small-scale TELP-assisted rapid ChIP seq) 200 mouse embryonic stem cells PWK/PhJ

More information

Research programs involving human early embryos

Research programs involving human early embryos Research programs involving human early embryos 1. Understanding normal mammalian embryo development 2. Understanding errors in genetic and epigenetic programs 3. Providing research and therapeutic tools

More information

Genetics and Genomics in Medicine Chapter 6 Questions

Genetics and Genomics in Medicine Chapter 6 Questions Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions

More information

Lecture 27. Epigenetic regulation of gene expression during development

Lecture 27. Epigenetic regulation of gene expression during development Lecture 27 Epigenetic regulation of gene expression during development Development of a multicellular organism is not only determined by the DNA sequence but also epigenetically through DNA methylation

More information

Embryogenesis begins during oogenesis

Embryogenesis begins during oogenesis 7th Workshop Mammalian Folliculogenesis and Oogenesis ESHRE Campus symposium Stresa, Italy 19 21 April 2012 Acquisition of the oocyte developmental competence Maurizio Zuccotti Embryogenesis begins during

More information

Name: Xueming Zhao. Professional Title: Professor. Animal embryo biotechnology, mainly including in vitro maturation (IVM), in vitro fertilization

Name: Xueming Zhao. Professional Title: Professor. Animal embryo biotechnology, mainly including in vitro maturation (IVM), in vitro fertilization Name: Xueming Zhao Professional Title: Professor Telephone:86-010-62815892 Fax:86-010-62895971 E-mail: zhaoxueming@caas.cn Website: http://www.iascaas.net.cn/yjspy/dsjj/sssds/dwyzyzypz1/62040.htm Research

More information

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression

An epigenetic approach to understanding (and predicting?) environmental effects on gene expression www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION Supplementary text Collectively, we were able to detect ~14,000 expressed genes with RPKM (reads per kilobase per million) > 1 or ~16,000 with RPKM > 0.1 in at least one cell type from oocyte to the morula

More information

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation

Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII

More information

Programming and Inheritance of Parental DNA Methylomes in Mammals

Programming and Inheritance of Parental DNA Methylomes in Mammals Resource Programming and Inheritance of Parental DNA Methylomes in Mammals Lu Wang, 1,3,9 Jun Zhang, 4,9 Jialei Duan, 1,9 Xinxing Gao, 4,9 Wei Zhu, 1,3 Xingyu Lu, 5 Lu Yang, 6 Jing Zhang, 1 Guoqiang Li,

More information

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq

Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological

More information

DNA methylation Dots(+) CxxC EGFP DAP

DNA methylation Dots(+) CxxC EGFP DAP a 1.2 b 5mC PI Merge n level Relativ ve expressio 1.0 0.8 0.6 0.4 0.2 0 a b c Wildtype Gadd45 Gadd4 45b KO Figure S1. Gadd45b-deficiency does not affect paternal DNA demethylation (a) Relative expression

More information

Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells

Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells Single-cell RNA-Seq profiling of human preimplantation embryos and embryonic stem cells Liying Yan 1,2,5, Mingyu Yang 1,5, Hongshan Guo 1, Lu Yang 1, Jun Wu 1, Rong Li 1,2, Ping Liu 1, Ying Lian 1, Xiaoying

More information

Oxidative stress in sperm affects the epigenetic reprogramming in early embryonic development

Oxidative stress in sperm affects the epigenetic reprogramming in early embryonic development https://doi.org/10.1186/s13072-018-0224-y Epigenetics & Chromatin RESEARCH Open Access Oxidative stress in sperm affects the epigenetic reprogramming in early embryonic development Sarah Wyck 1,2,3, Carolina

More information

Today. Genomic Imprinting & X-Inactivation

Today. Genomic Imprinting & X-Inactivation Today 1. Quiz (~12 min) 2. Genomic imprinting in mammals 3. X-chromosome inactivation in mammals Note that readings on Dosage Compensation and Genomic Imprinting in Mammals are on our web site. Genomic

More information

Changes in histone methylation during human oocyte maturation and IVF- or ICSI-derived embryo development

Changes in histone methylation during human oocyte maturation and IVF- or ICSI-derived embryo development Changes in histone methylation during human oocyte maturation and IVF- or ICSI-derived embryo development Jie Qiao, M.D., a Yuan Chen, Ph.D., a Li-Ying Yan, Ph.D., a Jie Yan, Ph.D., a Ping Liu, Ph.D.,

More information

Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes

Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes Article Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes Graphical Abstract Authors Li Shen, Azusa Inoue,..., Falong Lu, Yi Zhang Correspondence

More information

Supplementary Information

Supplementary Information Supplementary Information 1 Supplementary information, Figure S1 Establishment of PG-haESCs. (A) Summary of derivation of PG-haESCs. (B) Upper, Flow analysis of DNA content of established PG-haES cell

More information

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821

Imprinting. Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Imprinting Joyce Ohm Cancer Genetics and Genomics CGP-L2-319 x8821 Learning Objectives 1. To understand the basic concepts of genomic imprinting Genomic imprinting is an epigenetic phenomenon that causes

More information

Nuclear reprogramming of sperm and somatic nuclei in eggs and oocytes

Nuclear reprogramming of sperm and somatic nuclei in eggs and oocytes Reprod Med Biol (2013) 12:133 149 DOI 10.1007/s12522-013-0155-z REVIEW ARTICLE Nuclear reprogramming of sperm and somatic nuclei in eggs and oocytes Marta Teperek Kei Miyamoto Received: 27 March 2013 /

More information

Increase your chance of IVF Success. PGT-A Preimplantation Genetic Testing for Aneuploidy (PGS 2.0)

Increase your chance of IVF Success. PGT-A Preimplantation Genetic Testing for Aneuploidy (PGS 2.0) Increase your chance of IVF Success PGT-A Preimplantation Genetic Testing for Aneuploidy (PGS 2.0) What is PGT-A? PGT-A, or Preimplantation Genetic Testing for Aneuploidy (PGS 2.0), is a type of genomic

More information

Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice.

Strategic delivery: Setting standards Increasing and. Details: Output: Demonstrating efficiency. informing choice. Strategic delivery: Setting standards Increasing and informing choice Demonstrating efficiency economy and value Details: Meeting Scientific and Clinical Advances Advisory Committee Agenda item 6 Paper

More information

MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS)

MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) MALBAC Technology and Its Application in Non-invasive Chromosome Screening (NICS) The Power of One Adapted from Internet Single Cell Genomic Studies Ultra Low Sample Input Advances and applications of

More information

Telomeres and Genomic Instability In Preimplanation Embryos. David L. Keefe, M.D.

Telomeres and Genomic Instability In Preimplanation Embryos. David L. Keefe, M.D. Telomeres and Genomic Instability In Preimplanation Embryos David L. Keefe, M.D. I. Global Genomic Instability, Including Aneuploidy, Mosaicism & Copy Number Variants, is Common In Preimplantation Embryos

More information

Clinical Genomics. Ina E. Amarillo, PhD FACMGG

Clinical Genomics. Ina E. Amarillo, PhD FACMGG Clinical Genomics Ina E. Amarillo, PhD FACMGG Associate Medical Director, Cytogenetics Lab (CaTG), Lab and Genomic Medicine Assistant Professor, Pathology and Immunology Outline Clinical Genomics Testing

More information

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation

Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Epigenetic Regulation of Health and Disease Nutritional and environmental effects on epigenetic regulation Robert FEIL Director of Research CNRS & University of Montpellier, Montpellier, France. E-mail:

More information

Foundational questions Oocyte-derived functional mediators of early embryonic development (EST and candidate gene) JY-1 Nobox Importin 8 Oocyte and cu

Foundational questions Oocyte-derived functional mediators of early embryonic development (EST and candidate gene) JY-1 Nobox Importin 8 Oocyte and cu Models for study of oocyte competence: George W. Smith (Smithge7@msu.edu) Foundational questions Oocyte-derived functional mediators of early embryonic development (EST and candidate gene) JY-1 Nobox Importin

More information

Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine

Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine Univ.-Prof. Dr. Thomas Haaf Methylation reprogramming dynamics and defects in gametogenesis and embryogenesis: implications for reproductive medicine Epigenetics and DNA methylation Heritable change of

More information

Selective impairment of methylation maintenance is the major cause of DNA methylation reprogramming in the early embryo

Selective impairment of methylation maintenance is the major cause of DNA methylation reprogramming in the early embryo Arand et al. Epigenetics & Chromatin 2015, 8:1 RESEARCH Open Access Selective impairment of methylation maintenance is the major cause of DNA methylation reprogramming in the early embryo Julia Arand 1,4,

More information

Biology Developmental Biology Spring Quarter Midterm 1 Version A

Biology Developmental Biology Spring Quarter Midterm 1 Version A Biology 411 - Developmental Biology Spring Quarter 2013 Midterm 1 Version A 75 Total Points Open Book Choose 15 out the 20 questions to answer (5 pts each). Only the first 15 questions that are answered

More information

Epigenetics and inheritance of phenotype variation in livestock

Epigenetics and inheritance of phenotype variation in livestock DOI 10.1186/s13072-016-0081-5 Epigenetics & Chromatin REVIEW Open Access Epigenetics and inheritance of phenotype variation in livestock Kostas A. Triantaphyllopoulos 1*, Ioannis Ikonomopoulos 2 and Andrew

More information

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L

Targeted qpcr. Debate on PGS Technology: Targeted vs. Whole genome approach. Discolsure Stake shareholder of GENETYX S.R.L Antonio Capalbo, PhD Laboratory Director GENETYX, reproductive genetics laboratory, Italy PGT responsible GENERA centers for reproductive medicine, Italy Debate on PGS Technology: Targeted vs. Whole genome

More information

Epigenetics: A historical overview Dr. Robin Holliday

Epigenetics: A historical overview Dr. Robin Holliday Epigenetics 1 Rival hypotheses Epigenisis - The embryo is initially undifferentiated. As development proceeds, increasing levels of complexity emerge giving rise to the larval stage or to the adult organism.

More information

oocytes were pooled for RT-PCR analysis. The number of PCR cycles was 35. Two

oocytes were pooled for RT-PCR analysis. The number of PCR cycles was 35. Two Supplementary Fig. 1 a Kdm3a Kdm4b β-actin Oocyte Testis Oocyte Testis Oocyte Testis b 1.8 Relative expression.6.4.2 Kdm3a Kdm4b RT-PCR analysis of Kdm3a and Kdm4b expression in oocytes and testes. Twenty

More information

Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes

Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes Tet3 and DNA Replication Mediate Demethylation of Both the Maternal and Paternal Genomes in Mouse Zygotes The Harvard community has made this article openly available. Please share how this access benefits

More information

Rejuvenation of Gamete Cells; Past, Present and Future

Rejuvenation of Gamete Cells; Past, Present and Future Rejuvenation of Gamete Cells; Past, Present and Future Denny Sakkas PhD Scientific Director, Boston IVF Waltham, MA, USA Conflict of Interest I have no conflict of interest related to this presentation.

More information

Transcriptional repression of Xi

Transcriptional repression of Xi Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.

More information

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype

Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability

More information

DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018

DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018 DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2018 Director:, DVM, Ph.D. 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve

More information

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology

Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Session 2: Biomarkers of epigenetic changes and their applicability to genetic toxicology Bhaskar Gollapudi, Ph.D The Dow Chemical Company Workshop: Genetic Toxicology: Opportunities to Integrate New Approaches

More information

Dynamic CpG island methylation landscape in oocytes and preimplantation embryos

Dynamic CpG island methylation landscape in oocytes and preimplantation embryos Europe PMC Funders Group Author Manuscript Published in final edited form as: Nat Genet. ; 43(8): 811 814. doi:10.1038/ng.864. Dynamic CpG island methylation landscape in oocytes and preimplantation embryos

More information

Non-invasive methods of embryo selection

Non-invasive methods of embryo selection Non-invasive methods of embryo selection Liow Swee Lian O & G Partners Fertility Centre Gleneagles Hospital SINGAPORE Introduction More physiological laboratory procedures and culture systems have significantly

More information

DNA methylation & demethylation

DNA methylation & demethylation DNA methylation & demethylation Lars Schomacher (Group Christof Niehrs) What is Epigenetics? Epigenetics is the study of heritable changes in gene expression (active versus inactive genes) that do not

More information

Genetics and Genomics in Medicine Chapter 6. Questions & Answers

Genetics and Genomics in Medicine Chapter 6. Questions & Answers Genetics and Genomics in Medicine Chapter 6 Multiple Choice Questions Questions & Answers Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the

More information

Epigenetics: Basic Principals and role in health and disease

Epigenetics: Basic Principals and role in health and disease Epigenetics: Basic Principals and role in health and disease Cambridge Masterclass Workshop on Epigenetics in GI Health and Disease 3 rd September 2013 Matt Zilbauer Overview Basic principals of Epigenetics

More information

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015

Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 Joanna Hillman Michael Higgins Lab Oncology for Scientists I 10/29/2015 ! Define Epigenetics & Genomic Imprinting! Discovery! What is the imprint! Lifecycle of an Imprint DMRs and ICEs! 2 main mechanisms

More information

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3

Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,

More information

Large conserved domains of low DNA methylation maintained by Dnmt3a

Large conserved domains of low DNA methylation maintained by Dnmt3a Supplementary information Large conserved domains of low DNA methylation maintained by Dnmt3a Mira Jeong# 1, Deqiang Sun # 2, Min Luo# 1, Yun Huang 3, Grant A. Challen %1, Benjamin Rodriguez 2, Xiaotian

More information

Ontogeny of CpG island methylation and specificity of DNMT3 methyltransferases during embryonic development in the mouse

Ontogeny of CpG island methylation and specificity of DNMT3 methyltransferases during embryonic development in the mouse Auclair et al. Genome Biology (2014) 15:545 DOI 10.1186/s13059-014-0545-5 RESEARCH Open Access Ontogeny of CpG island methylation and specificity of DNMT3 methyltransferases during embryonic development

More information

Telomeres in human oocytes. contribution to chromosome (in)stability?

Telomeres in human oocytes. contribution to chromosome (in)stability? Telomeres in human oocytes and embryos: maternal contribution to chromosome (in)stability? Hartshorne GM, Turner S, Rai J, Wong H-P. Warwick Medical School, University of Warwick, UK geraldine.hartshorne@warwick.ac.uk

More information

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC)

RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) Thursday 5 November EU-India PARTNERING EVENT Theme: Health RESEARCHER S NAME: Làszlò Tora RESEARCHER S ORGANISATION: Institut de Génétique et de Biologie Moléculaire et Cellulaire (IGBMC) CNRS, INSERM,

More information

Transferring Fragments of Paternal Metabolism to the Offspring. Erica D. Watson 1,* UK, CB2 3EG. *Correspondence:

Transferring Fragments of Paternal Metabolism to the Offspring. Erica D. Watson 1,* UK, CB2 3EG. *Correspondence: Transferring Fragments of Paternal Metabolism to the Offspring Erica D. Watson 1,* 1 Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge UK, CB2 3EG. *Correspondence:

More information

Methylation Dynamics in the Early Mammalian Embryo: Implications of Genome Reprogramming Defects for Development

Methylation Dynamics in the Early Mammalian Embryo: Implications of Genome Reprogramming Defects for Development CTMI (2006) 310:13 22 c Springer-Verlag Berlin Heidelberg 2006 Methylation Dynamics in the Early Mammalian Embryo: Implications of Genome Reprogramming Defects for Development T. Haaf ( ) Johannes Gutenberg-Universität

More information

Article Pre-embryonic diagnosis for Sandhoff disease

Article Pre-embryonic diagnosis for Sandhoff disease RBMOnline - Vol 12. No 3. 2006 328-333 Reproductive BioMedicine Online; www.rbmonline.com/article/2100 on web 9 January 2006 Article Pre-embryonic diagnosis for Sandhoff disease Dr Anver Kuliev received

More information

DRB666 Applied Developmental and Reproductive Biology (Spring 2013)

DRB666 Applied Developmental and Reproductive Biology (Spring 2013) DRB666 Applied Developmental and Reproductive Biology (Spring 2013) Director: 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve Ward Yusuke Marikawa

More information

CHAIRE ÉPIGÉNÉTIQUE ET MÉMOIRE CELLULAIRE. Année : Reprogrammations développementales, induites et pathologiques

CHAIRE ÉPIGÉNÉTIQUE ET MÉMOIRE CELLULAIRE. Année : Reprogrammations développementales, induites et pathologiques CHAIRE ÉPIGÉNÉTIQUE ET MÉMOIRE CELLULAIRE Année 2013-2014 : Reprogrammations développementales, induites et pathologiques Cours II Etapes de la reprogrammation au cours du développement chez les mammifères

More information

DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos

DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for normal development in bovine embryos Epigenetics ISSN: 1559-2294 (Print) 1559-2308 (Online) Journal homepage: http://www.tandfonline.com/loi/kepi20 DPPA3 prevents cytosine hydroxymethylation of the maternal pronucleus and is required for

More information

Transgenerational Epigenetic Inheritance

Transgenerational Epigenetic Inheritance Transgenerational Epigenetic Inheritance TOP ARTICLES SUPPLEMENT CONTENTS EDITORIAL:: Epigenetics: where environment, society and genetics meet Epigenomics Vol. 6 Issue 1 REVIEW: Transgenerational epigenetic

More information

Animal Development. Lecture 3. Germ Cells and Sex

Animal Development. Lecture 3. Germ Cells and Sex Animal Development Lecture 3 Germ Cells and Sex 1 The ovary of sow. The ovary of mare. The ovary of cow. The ovary of ewe. 2 3 The ovary. A generalized vertebrate ovary. (Wilt and Hake, Ch 2, 2004) 4 The

More information

Oocyte and Sperm from ipscs

Oocyte and Sperm from ipscs Key Points University of Miyazaki, RIKEN, Kyoto University, Shiga University of Medical Science, Hokkaido University Oocyte and Sperm from ipscs of an Endangered Species -Sexual flexibility of endangered

More information

DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2011

DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2011 DRB666 Applied Developmental and Reproductive Biology Spring Semester, 2011 Director: 651 Ilalo Street, BSB163-3 e-mail: yyamazak@hawaii.edu Phone: (808) 692-1416 Instructors (e-mail): Steve Ward Yusuke

More information

BIOLOGY

BIOLOGY Int. J. Dev. Biol. 54: 1323-1328 (2010) doi: 10.1387/ijdb.092973jp THE INTERNATIONAL JOURNAL OF DEVELOPMENTAL BIOLOGY www.intjdevbiol.com Active loss of DNA methylation in two-cell stage goat embryos JUNG

More information

King s Research Portal

King s Research Portal King s Research Portal DOI:.86/756-8935-7-26 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA):

More information

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG

GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG

More information

Role of Tet1 in genomic imprinting erasure

Role of Tet1 in genomic imprinting erasure Role of Tet1 in genomic imprinting erasure The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Yamaguchi, Shinpei, Li Shen,

More information

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment

Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment Overview: Conducting the Genetic Orchestra Prokaryotes and eukaryotes alter gene expression in response to their changing environment In multicellular eukaryotes, gene expression regulates development

More information

Ellen Anckaert, Sergio Romero, Tom Adriaenssens, Johan Smitz Follicle Biology Laboratory UZ Brussel, Brussels

Ellen Anckaert, Sergio Romero, Tom Adriaenssens, Johan Smitz Follicle Biology Laboratory UZ Brussel, Brussels Effects of low methyl donor levels during mouse follicle culture on follicle development, oocyte maturation and oocyte imprinting establishment. Ellen Anckaert, Sergio Romero, Tom Adriaenssens, Johan Smitz

More information

Role of Cnot6l in maternal mrna turnover

Role of Cnot6l in maternal mrna turnover Published Online: 16 July, 2018 Supp Info: http://doi.org/10.26508/lsa.201800084 Downloaded from life-science-alliance.org on 21 April, 2019 Role of Cnot6l in maternal mrna turnover Filip Horvat, Helena

More information

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON

Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON ... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE

More information

DNA methylation and hydroxymethylation in early rabbit embryos: Consequences of in vitro culture. Bedhane Mohammed

DNA methylation and hydroxymethylation in early rabbit embryos: Consequences of in vitro culture. Bedhane Mohammed European Master in Animal Breeding and Geneti cs (EM-ABG) Master Scie ces et Tech ologies du Viva t et de l E viro e e t Spécialité : Génétique Animale, Génome et Diversité DNA methylation and hydroxymethylation

More information

but it still needs a bit of work

but it still needs a bit of work but it still needs a bit of work jc@embryos.net Reprogenetics ART Institute of Washington Life Global Principle investigator of cytoplasmic transfer series (1996-2001) Is there an alternative to MRT? Lessons

More information

Introduction: DNA methylation in mammals. DNA+Histones=Chromatin. Long-lasting cellular memory

Introduction: DNA methylation in mammals. DNA+Histones=Chromatin. Long-lasting cellular memory Séminaire de présentation des projets de l APR 2010 MIISTÈREDEL ÉCOLOGIE DU DÉVELOPPEMET DURABLE, DU TRASPORT ETDELAMER MethylED: Impact of Endocrine Disruptors on genomic DA methylation patterns in the

More information

Are you the way you are because of the

Are you the way you are because of the EPIGENETICS Are you the way you are because of the It s my fault!! Nurture Genes you inherited from your parents? Nature Experiences during your life? Similar DNA Asthma, Autism, TWINS Bipolar Disorders

More information

Dynamic Reprogramming of DNA Methylation in the Early Mouse Embryo

Dynamic Reprogramming of DNA Methylation in the Early Mouse Embryo Developmental Biology 241, 172 182 (2002) doi:10.1006/dbio.2001.0501, available online at http://www.idealibrary.com on Dynamic Reprogramming of DNA Methylation in the Early Mouse Embryo Fátima Santos,*

More information

Paternal Poly (ADP-ribose) Metabolism Modulates Retention of Inheritable Sperm Histones and Early Embryonic Gene Expression

Paternal Poly (ADP-ribose) Metabolism Modulates Retention of Inheritable Sperm Histones and Early Embryonic Gene Expression University of Pennsylvania ScholarlyCommons Departmental Papers (Biology) Department of Biology 5-2014 Paternal Poly (ADP-ribose) Metabolism Modulates Retention of Inheritable Sperm Histones and Early

More information

The effects of PGS/PGT-A on IVF outcomes

The effects of PGS/PGT-A on IVF outcomes The effects of PGS/PGT-A on IVF outcomes Raoul Orvieto M.D. - Department of Obstetrics and Gynecology, Chaim Sheba Medical Center, Ramat Gan, Israel - The Tarnesby-Tarnowski Chair for Family Planning and

More information

DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations. Peter de Boer

DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations. Peter de Boer DNA double-strand break repair of parental chromatin in ooplasm and origin of de novo mutations Peter de Boer Department of Obst.& Gynaecology, Div. Reproductive Medicine Radboud University Nijmegen Medical

More information

Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale

Paternal exposure and effects on microrna and mrna expression in developing embryo. Department of Chemical and Radiation Nur Duale Paternal exposure and effects on microrna and mrna expression in developing embryo Department of Chemical and Radiation Nur Duale Our research question Can paternal preconceptional exposure to environmental

More information

Genome Analyses of Single Human Oocytes

Genome Analyses of Single Human Oocytes enome nalyses of Single Human Oocytes Yu Hou, 1,6 Wei Fan, 1,4,6 Liying Yan, 1,6 Rong Li, 1 Ying Lian, 1 Jin Huang, 1 Jinsen Li, 1 Liya Xu, 1 Fuchou ang, 1,5, * X. Sunney Xie, 1,2, * and Jie Qiao 1,3,

More information

4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider

4/20/2016. Objectives. Epigenetic Definitions. Gene Expression. More Questions. Questions to Consider Objectives Epigentics: You Might Be What Your Grandmother Ate Lynda Britton, Ph.D., MLS(ASCP) CM Professor LSU Health Shreveport Discuss epigenetics and its role in cancer, imprinting and X chromosome

More information

THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15

THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 THE CHROMOSOMAL BASIS OF INHERITANCE CHAPTER 15 What you must know: Inheritance in sex-linked genes. Inheritance of linked genes and chromosomal mapping. How alteration of chromosome number or structurally

More information

Regulation of Gene Expression in Eukaryotes

Regulation of Gene Expression in Eukaryotes Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression

More information

Epigenetic Inheritance

Epigenetic Inheritance (2) The role of Epigenetic Inheritance Lamarck Revisited Lamarck was incorrect in thinking that the inheritance of acquired characters is the main mechanism of evolution (Natural Selection more common)

More information

Stem Cell Epigenetics

Stem Cell Epigenetics Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )

More information

Articles Somatic cell haploidization: an update

Articles Somatic cell haploidization: an update RBMOnline - Vol 6. No 1. 60 65 Reproductive BioMedicine Online; www.rbmonline.com/article/717 on web 4 November 2002 Articles Somatic cell haploidization: an update Jan Tesarik obtained his MD degree in

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

DNA METHYLATION IN EARLY MAMMALIAN DEVELOPMENT

DNA METHYLATION IN EARLY MAMMALIAN DEVELOPMENT ARISTEA MARIA MAGARAKI DNA METHYLATION IN EARLY MAMMALIAN DEVELOPMENT Supervised by Dr. Petra de Graaf Physiological Chemistry, UMC DNA METHYLATION DURING EARLY MAMMALIAN DEVELOPMENT Master student: Aristea

More information

Diagnostic Techniques to Improve the Assessment of Human IVF Embryos: Genomics and Proteomics

Diagnostic Techniques to Improve the Assessment of Human IVF Embryos: Genomics and Proteomics Diagnostic Techniques to Improve the Assessment of Human IVF Embryos: Genomics and Proteomics Mandy G Katz-Jaffe Introduction A fundamental component of assisted reproductive technologies (ART) is the

More information

Supplementary tables and figure legends

Supplementary tables and figure legends Supplementary tables and figure legends Suzuki et al., Mitotic Reprogramming of Sperm, Supplementary Information, 5/7/16, page 1 Supplementary Figure 1 Characteristics of mouse preimplantation development

More information

Preimplantation genetic diagnosis: polar body and embryo biopsy

Preimplantation genetic diagnosis: polar body and embryo biopsy Human Reproduction, Vol. 15, (Suppl. 4), pp. 69-75, 2000 Preimplantation genetic diagnosis: polar body and embryo biopsy Luca Gianaroli SISMER, Via Mazzini 12, 40138 Bologna, Italy Scientific Director

More information

Epigenetic processes are fundamental to development because they permit a

Epigenetic processes are fundamental to development because they permit a Early Life Nutrition and Epigenetic Markers Mark Hanson, PhD Epigenetic processes are fundamental to development because they permit a range of phenotypes to be formed from a genotype. Across many phyla

More information

OVERVIEW OF EPIGENETICS

OVERVIEW OF EPIGENETICS OVERVIEW OF EIENETICS Date: * Time: 9:00 am - 9:50 am * Room: Berryhill 103 Lecturer: Terry Magnuson 4312 MBRB trm4@med.unc.edu 843-6475 *lease consult the online schedule for this course for the definitive

More information

DNA Methylation and Cancer

DNA Methylation and Cancer DNA Methylation and Cancer October 25, 2016 Dominic Smiraglia, Ph.D. Department of Cancer Genetics From Alan Wolffe, Science and Medicine, 1999 Vital Statistics Human genome contains 3 billion bp ~ 50,000

More information

EPIGENOMICS PROFILING SERVICES

EPIGENOMICS PROFILING SERVICES EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation

More information

Zongliang (Carl) Jiang. 333 Cedar St, New Haven, CT OBJECTIVE

Zongliang (Carl) Jiang. 333 Cedar St, New Haven, CT OBJECTIVE Zongliang (Carl) Jiang 333 Cedar St, New Haven, CT 06510 860-786-8766 zongliang.jiang@yale.edu OBJECTIVE To conduct research and teaching in the areas of animal reproduction, epigenetics, and stem cell

More information

Study on Several Factors Involved in IVF-ET of Human Beings

Study on Several Factors Involved in IVF-ET of Human Beings Study on Several Factors Involved in IVF-ET of Human Beings Lei X 1, Zhuoran W 1, Bin L 1, Huiming L 1, Hongxiu Z 1, Yajuan Z 1, Yingbo Q 1, Guixue Z 2 1 The First Clinical College of Harbin Medical University,

More information

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm

Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.

More information

Supplementary Materials and Methods

Supplementary Materials and Methods Supplementary Materials and Methods Whole Mount X-Gal Staining Whole tissues were collected, rinsed with PBS and fixed with 4% PFA. Tissues were then rinsed in rinse buffer (100 mm Sodium Phosphate ph

More information