FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon
|
|
|
- Anthony Morgan
- 5 years ago
- Views:
Transcription
1 FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon
2 Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic markers, Minimal Residual Disease
3 t(14;18) CN changes UPD Mutation Methylation
4 Features of Follicular Lymphoma GC B-cell disease t(14;18) >> IgH-Bcl new cases in UK 10 yr median survival Relapse-remitting Rituximab Transformation: 1-2yr survival Epigenetics FL FL1 FL2 FL N = Years
5 Epigenetic Modifications DNA Methylation Histone Modifications Regulation of gene expression
6 Published Literature in FL - Individual Genes
7 Array-based Methylation Analysis (Illumina ) GoldenGate Infinium HumanMethylation27- BeadChip New Platform >400, C 220
8 Infinium HumanMethylation27 BeadChip Quantitative methylation measurement at the single-cpg level CpG loci genes 1000 cancer related genes 200 microrna promoters 12 sample BeadArray format
9 Infinium HumanMethylation27 BeadChip Courtesy of Dr Andrew Teschendorff- UCL
10 Infinium HumanMethylation27 BeadChip The workflow... Bisulfate conversion Whole genome amplification Enzymatic fragmentation Hybridization Scanning
11 Infinium HumanMethylation27 BeadChip Background Bisulfate modification: - unmethylated C converted to U - methylated C protected from conversion Site specific probes - U & M bead type (unmethylated and methylated) - hybridization followed by a single base extension Continuous measurement: β value: 0-1
12 Aim of the Project Determine extent and frequency of methylation in FL Correlate with gene expression Correlate with clinical data Follow anything exciting
13 Methylation Profiling Samples Sample n Mean Age, (Range) Malignant Lymph Node DNA 184 Previously untreated Follicular Lymphoma (FL) (23-90) Paired FL and transformed FL: Pre-transformation FL 10 Transformed FL 10 Benign Lymph Node DNA* (4-55) Hyperplastic 14 Granulomatous 3 PTGC 3 Dermatopathic lymphadenitis 2 Granulation Tissue 1 Tonsils / Adenoids 4 13 (7-27) Hyperplastic 4
14 Methylation Profiling Cluster analyisis CpG Loci Cluster analysis FL (n=164) Non-tumour (n=27) Robust discriminator between malignant vs benign samples O Riain et al, Leukemia 2009
15 Methylation Profiling Cluster analyisis Low Change High Change No difference in age, grade, stage, clinical outcome between extremes!
16 Microenvironment samples FL cells genes Immune cells (infiltrating) Dave et al NEJM 2004
17 Methylation Profiling Cluster analysis Low Change High Change Heterogeneity due to variable proportion of B cells CELL SORTING: CD3+ T cells CD19+ B cells
18 The Role of Polycomb Repressor Complex : enrichment for PRC2 target genes among hypermethylated gene sets in carcinoma
19 Hypermethylated genes -PRC2 targets in ES cells.
20 The PRC2 complex and Histone methylation UTX EZH2 EED SUZ12 PRC2 Complex DNMT Direct interaction with DNA methyltransferases Trimethylated H3K27 Repressive chromatin mark
21 Link PRC2 and Hypermethylation loci in FL EED EZH2 SUZ12 DNMTs EED EZH2 SUZ12
22 Histone Methyl marks (K4, K27) Gene expression stopped Histone tails Histones H3K27Me3
23 EZH2 Y641 mutated in FL (Vancouver Morin 10) 225 FL : 26 mutations (11%)...Barts series 20 FL tfl pairs: 30% Y641F (14), Y641N (8), Y641H (3), Y641S (1) Y641F EZH2 mutated _ H3K27Me3 expression Y641S S Y641H +
24 EZH2 Y641 mutated in FL (Vancouver Morin 10) 225 FL : 26 mutations (11%)...Barts series 20 FL tfl pairs: 30% Y641F (14), Y641N (8), Y641H (3), Y641S (1) Y641F EZH2 mutated _ H3K27Me3 expression Y641S S Y641H + Mechanisms other than mutation ->30%
25 EZH2 Y641 not linked with outcome Overall survival 0.50 EZH2 +ve n= chi2(1) = 1.80 Pr>chi2 = EZH2 ve n= analysis time
26 Histone Methyl marks (K4, K27) Gene expression stopped Histone tails Histones H3K27Me3
27 Histone Methyl marks (K4, K27) Gene expression ON Histone tails Histones H3K4Me3
28 Histone Methyl marks (K4, K27) State of readiness Lose marks as required for differentiation Histone tails Histones H3K27Me3 H3K4Me3
29 Enrichment for genes with bivalent domains in ES cells p< Genome-wide (n=18216) Infinium Array (n=9037) Hypermethylated gene set (n=689) Based on mapping by :Ku et al., PLoS Genetics 2008
30 Data on frequency of Histone modifications. Hypermethylated Infinium Array Genome Wide n= % n= % n= % No Marks K K K4 and K TOTAL
31 Gene Ontology (GO) in hypermethylated gene set. GO term Hypermethylated genes Infinium array set Adjusted P value (%) (%) Multicellular organismal development x10-25 Anatomical structure development x10-21 System development x10-19 Nervous system development x10-14 Cell-cell signalling x10-14 Organ development x10-11
32 DNA Methylation vs Histone Methylation DNMT? EZH2 EED SUZ12 PRC2 Complex Azacytidine Both can be pharmacologically manipulated! DZNep
33 Summary Aberrant hypermethylation in >700 genes in FL Early pre-programmed methylation of large number of development-related genes Occurs in approximately 8% of CpG islands Genes marked by bivalent domains in ES cells Wide variability in immunohistochemical H3K27Me3 expression in FL Frequent mutation of histone methylase EZH2 in FL
34 Current Plans To test methylation profile as an outcome predictor (choosing high tumour burden biopsies 600 cases). Determine the effects of EZH2 Y641 mutation on clinical outcome. To correlate EZH2/H3K27me3 promoter occupancy with DNA methylation in order to identify methylation dependent and independent PRC2 target genes Determine the effects of EZH2/H3K27m3 and DNA methylation inhibition on primary and FL cell lines. Other mechanisms regulating H3K27me3
35 Acknowledgements Centre for Medical Oncology Ciaran O Riain Csaba Bodor T Andrew Lister Genome Centre, Queen Mary University of London Charles Mein
36 Acknowledgements
Follicular Lymphoma It s not just the t(14;18) anymore. UK Cytogenetics, Newcastle. Jude Fitzgibbon
Follicular Lymphoma It s not just the t(14;18) anymore UK Cytogenetics, Newcastle Jude Fitzgibbon Centre for Haemato-Oncology 16 th March 2015 Technology has Improved Late 80s: My First PCRs by Water bath.
DNA methylation in follicular lymphoma
DNA methylation in follicular lymphoma Ó Riain, Ciarán Liam The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without the prior
Stem Cell Epigenetics
Stem Cell Epigenetics Philippe Collas University of Oslo Institute of Basic Medical Sciences Norwegian Center for Stem Cell Research www.collaslab.com Source of stem cells in the body Somatic ( adult )
TARGETING EZH2 WITH TAZEMETOSTAT IN FOLLICULAR LYMPHOMA
TARGETING EZH2 WITH TAZEMETOSTAT IN FOLLICULAR LYMPHOMA VINCENT RIBRAG Chairman hematological multidisciplinary committee Ditep (chief molecular therapeutics in hematological early drug development) Bologna
EZH2 Inhibitors as Novel Cancer Therapeutics!!!! Robert A. Copeland, Ph.D.! Epizyme, Inc.!!! 20 November 2014!
EZH2 Inhibitors as Novel Cancer Therapeutics Robert A. Copeland, Ph.D. Epizyme, Inc. 20 November 2014 2013 Accomplishments Disclosure Information EORTC-NCI-AACR Meeting, 20 November 2014 Robert A. Copeland,
Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer
Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for
An epigenetic approach to understanding (and predicting?) environmental effects on gene expression
www.collaslab.com An epigenetic approach to understanding (and predicting?) environmental effects on gene expression Philippe Collas University of Oslo Institute of Basic Medical Sciences Stem Cell Epigenetics
An annotated list of bivalent chromatin regions in human ES cells: a new tool for cancer epigenetic research
An annotated list of bivalent chromatin regions in human ES cells: a new tool for cancer epigenetic research Franck Court, Philippe Arnaud To cite this version: Franck Court, Philippe Arnaud. An annotated
Epigenetics. Lyle Armstrong. UJ Taylor & Francis Group. f'ci Garland Science NEW YORK AND LONDON
... Epigenetics Lyle Armstrong f'ci Garland Science UJ Taylor & Francis Group NEW YORK AND LONDON Contents CHAPTER 1 INTRODUCTION TO 3.2 CHROMATIN ARCHITECTURE 21 THE STUDY OF EPIGENETICS 1.1 THE CORE
Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
Epigenetics DNA methylation. Biosciences 741: Genomics Fall, 2013 Week 13. DNA Methylation
Epigenetics DNA methylation Biosciences 741: Genomics Fall, 2013 Week 13 DNA Methylation Most methylated cytosines are found in the dinucleotide sequence CG, denoted mcpg. The restriction enzyme HpaII
PRC2 crystal clear. Matthieu Schapira
PRC2 crystal clear Matthieu Schapira Epigenetic mechanisms control the combination of genes that are switched on and off in any given cell. In turn, this combination, called the transcriptional program,
Epigene.cs: What is it and how it effects our health? Overview. Dr. Bill Stanford, PhD OFawa Hospital Research Ins.tute University of OFawa
Epigene.cs: What is it and how it effects our health? Dr. Bill Stanford, PhD OFawa Hospital Research Ins.tute University of OFawa Overview Basic Background Epigene.cs in general Epigene.cs in cancer Epigene.cs
Supplementary Note. Nature Genetics: doi: /ng.2928
Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v0.1.11 to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped
Participating Institutions Insitut Gustave Roussy, Villejuif, France Institut Bergonie, Bourdeaux, France. Sponsor Epizyme, Inc
Phase 1 Study of EPZ-6438 (E7438), an Enhancer of Zeste Homolog-2 (EZH2) Inhibitor: Dose Determination and Preliminary Activity in Non-Hodgkin Lymphoma V. Ribrag, J-C. Soria, B. Thomson, L. Reyderman,
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3
Jayanti Tokas 1, Puneet Tokas 2, Shailini Jain 3 and Hariom Yadav 3 1 Department of Biotechnology, JMIT, Radaur, Haryana, India 2 KITM, Kurukshetra, Haryana, India 3 NIDDK, National Institute of Health,
Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for
Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for TET2 Paul Guilhamon 1, Malihe Eskandarpour 2, Dina Halai 3, Gareth A. Wilson 1, Andrew Feber 1, Andrew E. Teschendorff
Epigenetic Heterogeneity of B-Cell Lymphoma: DNA Methylation, Gene Expression and Chromatin States
Genes 2015, 6, 812-840; doi:10.3390/genes6030812 Article OPEN ACCESS genes ISSN 2073-4425 www.mdpi.com/journal/genes Epigenetic Heterogeneity of B-Cell Lymphoma: DNA Methylation, Gene Expression and Chromatin
CBL and EZH2 as new molecular markers in MPN
CBL and EZH2 as new molecular markers in MPN Andy Chase University of Southampton and Wessex Regional Genetics Laboratory Salisbury, UK Munich 2011 * Myeloproliferative neoplasms MDS/MPN Myelodysplastic
Lecture 8. Eukaryotic gene regulation: post translational modifications of histones
Lecture 8 Eukaryotic gene regulation: post translational modifications of histones Recap.. Eukaryotic RNA polymerases Core promoter elements General transcription factors Enhancers and upstream activation
Molecular Cell Biology. Prof. D. Karunagaran. Department of Biotechnology. Indian Institute of Technology Madras
Molecular Cell Biology Prof. D. Karunagaran Department of Biotechnology Indian Institute of Technology Madras Module-9 Molecular Basis of Cancer, Oncogenes and Tumor Suppressor Genes Lecture 6 Epigenetics
Integrated genomic analysis of human osteosarcomas
Integrated genomic analysis of human osteosarcomas Leonardo A. Meza-Zepeda Project Leader Genomic Section Department of Tumor Biology The Norwegian Radium Hospital Head Microarray Core Facility Norwegian
Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine?
What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine? by Robert John Hollows This project is submitted in partial fulfilment of the requirements
Supplementary Figures
Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide
DNA methylation signatures for breast cancer classification and prognosis
REVIEW DNA methylation signatures for breast cancer classification and prognosis Moshe Szyf* Abstract Changes in gene expression that reset a cell program from a normal to a diseased state involve multiple
SUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
Epigenetics Armstrong_Prelims.indd 1 04/11/2013 3:28 pm
Epigenetics Epigenetics Lyle Armstrong vi Online resources Accessible from www.garlandscience.com, the Student and Instructor Resource Websites provide learning and teaching tools created for Epigenetics.
PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland
AD Award Number: W81XWH-06-1-0093 TITLE: An Epigenetic Link to Prostate Cancer PRINCIPAL INVESTIGATOR: Raphael F Margueron, Ph.D. CONTRACTING ORGANIZATION: University of Medicine and Dentistry of New Jersey
Epigenetic programming in chronic lymphocytic leukemia
Epigenetic programming in chronic lymphocytic leukemia Christopher Oakes 10 th Canadian CLL Research Meeting September 18-19 th, 2014 Epigenetics and DNA methylation programming in normal and tumor cells:
The silence of the genes: clinical applications of (colorectal) cancer epigenetics
The silence of the genes: clinical applications of (colorectal) cancer epigenetics Manon van Engeland, PhD Dept. of Pathology GROW - School for Oncology & Developmental Biology Maastricht University Medical
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS
R. Piazza (MD, PhD), Dept. of Medicine and Surgery, University of Milano-Bicocca EPIGENETICS EPIGENETICS THE STUDY OF CHANGES IN GENE EXPRESSION THAT ARE POTENTIALLY HERITABLE AND THAT DO NOT ENTAIL A
mirna Dr. S Hosseini-Asl
mirna Dr. S Hosseini-Asl 1 2 MicroRNAs (mirnas) are small noncoding RNAs which enhance the cleavage or translational repression of specific mrna with recognition site(s) in the 3 - untranslated region
Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns
RESEARCH Open Access Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns Duncan Sproul 1,2, Robert R Kitchen 1,3, Colm E Nestor 1,2, J Michael Dixon 1, Andrew H
Histones modifications and variants
Histones modifications and variants Dr. Institute of Molecular Biology, Johannes Gutenberg University, Mainz www.imb.de Lecture Objectives 1. Chromatin structure and function Chromatin and cell state Nucleosome
Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure
Biochemical Determinants Governing Redox Regulated Changes in Gene Expression and Chromatin Structure Frederick E. Domann, Ph.D. Associate Professor of Radiation Oncology The University of Iowa Iowa City,
Fragile X Syndrome. Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype
Fragile X Syndrome Genetics, Epigenetics & the Role of Unprogrammed Events in the expression of a Phenotype A loss of function of the FMR-1 gene results in severe learning problems, intellectual disability
SUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum
Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Mary Beth Terry, Jasmine A. McDonald, Hui Chen Wu, Sybil Eng and Regina M. Santella Abstract Epigenetic biomarkers,
Epigenetic Analysis of KSHV Latent and Lytic Genomes
Epigenetic Analysis of KSHV Latent and Lytic Genomes Zsolt Toth 1, Dennis T. Maglinte 2, Sun Hwa Lee 1, Hye-Ra Lee 1, Lai-Yee Wong 1, Kevin F. Brulois 1, Stacy Lee 1, Jonathan D. Buckley 2,3, Peter W.
Identification of endometrial cancer methylation features using a combined. methylation analysis method DISSERTATION
Identification of endometrial cancer methylation features using a combined methylation analysis method DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy
Solving Problems of Clustering and Classification of Cancer Diseases Based on DNA Methylation Data 1,2
APPLIED PROBLEMS Solving Problems of Clustering and Classification of Cancer Diseases Based on DNA Methylation Data 1,2 A. N. Polovinkin a, I. B. Krylov a, P. N. Druzhkov a, M. V. Ivanchenko a, I. B. Meyerov
Genome-Wide DNA Methylation Analysis in Cohesin Mutant Human Cell Lines
University of Pennsylvania ScholarlyCommons BBB Major Publications Biological Basis of Behavior Program 9-2010 Genome-Wide DNA Methylation Analysis in Cohesin Mutant Human Cell Lines Jinglan Liu The Children's
SUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
How I treat High-risk follicular lymphoma
How I treat High-risk follicular lymphoma Michele Ghielmini Oncology Institute of Southern Switzerland Bellinzona 1) median OS raised from 10 to 18 y 2) advanced FL remains uncurable Stanford, n = 1334
A Phase 1 Study of Tazemetostat (EPZ-6438), an Enhancer of Zeste-Homolog 2 (EZH2) Inhibitor: Preliminary Activity in INI1-Negative Tumors
A Phase 1 Study of Tazemetostat (EPZ-6438), an Enhancer of Zeste-Homolog 2 (EZH2) Inhibitor: Preliminary Activity in INI1-Negative Tumors A Italiano, H Keilhack, M Toulmonde, J-M Coindre, J-M Michot, C
Transcriptional repression of Xi
Transcriptional repression of Xi Xist Transcription of Xist Xist RNA Spreading of Xist Recruitment of repression factors. Stable repression Translocated Xic cannot efficiently silence autosome regions.
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq
Computational Analysis of UHT Sequences Histone modifications, CAGE, RNA-Seq Philipp Bucher Wednesday January 21, 2009 SIB graduate school course EPFL, Lausanne ChIP-seq against histone variants: Biological
Epigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
STEM CELL GENETICS AND GENOMICS
STEM CELL GENETICS AND GENOMICS Concise Review: Roles of Polycomb Group Proteins in Development and Disease: A Stem Cell Perspective VINAGOLU K. RAJASEKHAR, a MARTIN BEGEMANN b a Memorial Sloan-Kettering
Dynamic reprogramming of DNA methylation in SETD2- deregulated renal cell carcinoma
/, Vol. 7, No. 2 Dynamic reprogramming of DNA methylation in SETD2- deregulated renal cell carcinoma Rochelle L. Tiedemann 1, Ryan A. Hlady 2, Paul D. Hanavan 3, Douglas F. Lake 3, Raoul Tibes 4,5, Jeong-Heon
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD
RALYL Hypermethylation: A Potential Diagnostic Marker of Esophageal Squamous Cell Carcinoma (ESCC) Junwei Liu, MD Aurora Healthcare, Milwaukee, WI INTRODUCTION v Epigenetic aberration and genetic alteration
Antagonism between DNA and H3K27 Methylation at the Imprinted Rasgrf1 Locus
Antagonism between DNA and H3K27 Methylation at the Imprinted Rasgrf1 Locus Anders M. Lindroth 1., Yoon Jung Park 1., Chelsea M. McLean 1, Gregoriy A. Dokshin 1, Jenna M. Persson 1, Herry Herman 1,2, Diego
The Epigenome Tools 2: ChIP-Seq and Data Analysis
The Epigenome Tools 2: ChIP-Seq and Data Analysis Chongzhi Zang zang@virginia.edu http://zanglab.com PHS5705: Public Health Genomics March 20, 2017 1 Outline Epigenome: basics review ChIP-seq overview
The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis
The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis Tieliu Shi tlshi@bio.ecnu.edu.cn The Center for bioinformatics
according to the functional status of the CDKN2A gene Abdulmohsen G. Alhejaily
Defining clinically relevant subgroups of follicular lymphoma cases according to the functional status of the CDKN2A gene by Abdulmohsen G. Alhejaily A thesis submitted to the Department of Pathology and
Whitehead Institute for Biomedical Research and Department of Biology, Massachusetts Institute of Technology (MIT), Cambridge, Massachusetts, USA.
Eveline J. Steine, 1 Mathias Ehrich, 2 George W. Bell, 1 Arjun Raj, 3 Seshamma Reddy, 1 Alexander van Oudenaarden, 3 Rudolf Jaenisch, 1 and Heinz G. Linhart 1,4,5 1 Whitehead Institute for Biomedical Research
Review Article The Epigenetic Landscape of Acute Myeloid Leukemia
Advances in Hematology, Article ID 103175, 15 pages http://dx.doi.org/10.1155/2014/103175 Review Article The Epigenetic Landscape of Acute Myeloid Leukemia Emma Conway O Brien, Steven Prideaux, and Timothy
EPIGENOMICS PROFILING SERVICES
EPIGENOMICS PROFILING SERVICES Chromatin analysis DNA methylation analysis RNA-seq analysis Diagenode helps you uncover the mysteries of epigenetics PAGE 3 Integrative epigenomics analysis DNA methylation
Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos 3, Hui Yang 1, and Guillermo Garcia-Manero 1
Genome-wide CHIP-Seq Analysis of Histone Methylation Reveals Modulators of NF- B Signaling And the Histone Demethylase JMJD3 Implicated in Myelodysplastic Syndrome Yue Wei 1, Rui Chen 2, Carlos E. Bueso-Ramos
Hox genes. Discovered in Drosophila in 1923 by Bridges and Morgan Antennapaedia complex ANT-C Bithorax complex BX-C
Hox genes Establish body plan during development Specify head to tail axis of animal embryos Head Hox genes, abdomen hox genes. Mutations can cause one body part to transform to another 39 transcription
September 20, Submitted electronically to: Cc: To Whom It May Concern:
History Study (NOT-HL-12-147), p. 1 September 20, 2012 Re: Request for Information (RFI): Building a National Resource to Study Myelodysplastic Syndromes (MDS) The MDS Cohort Natural History Study (NOT-HL-12-147).
GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG
Lecture 6 GCATCCATCTTGGGGCGTCCCAATTGCTGAGTAACAAATGAGACGC TGTGGCCAAACTCAGTCATAACTAATGACATTTCTAGACAAAGTGAC TTCAGATTTTCAAAGCGTACCCTGTTTACATCATTTTGCCAATTTCG CGTACTGCAACCGGCGGGCCACGCCCCCGTGAAAAGAAGGTTGTT TTCTCCACATTTCGGGGTTCTGGACGTTTCCCGGCTGCGGGGCGG
Epigenetics: The Future of Psychology & Neuroscience. Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1
Epigenetics: The Future of Psychology & Neuroscience Richard E. Brown Psychology Department Dalhousie University Halifax, NS, B3H 4J1 Nature versus Nurture Despite the belief that the Nature vs. Nurture
DiffVar: a new method for detecting differential variability with application to methylation in cancer and aging
Genome Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. DiffVar: a new method for detecting
Feature Selection and Extraction Framework for DNA Methylation in Cancer
Feature Selection and Extraction Framework for DNA Methylation in Cancer Abeer A. Raweh Dept. of Computer Science, Faculty of Computers and Information, Cairo University Cairo, Egypt Mohammad Nassef Dept.
Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers
Zhang et al. BMC Genomics 2014, 15:868 RESEARCH ARTICLE Open Access Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers
Nature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
UKnowledge. University of Kentucky. Matthew Rea University of Kentucky, Meredith Eckstein University of Kentucky,
University of Kentucky UKnowledge Molecular and Cellular Biochemistry Faculty Publications Molecular and Cellular Biochemistry 2-2-2017 Genome-Wide DNA Methylation Reprogramming in Response to Inorganic
Trace Metals and Placental Methylation
Trace Metals and Placental Methylation Carmen J. Marsit, PhD Pharmacology & Toxicology Epidemiology Geisel School of Medicine at Dartmouth Developmental Origins Environmental Exposure Metabolic Cardiovascular
Genomic Methods in Cancer Epigenetic Dysregulation
Genomic Methods in Cancer Epigenetic Dysregulation Clara, Lyon 2018 Jacek Majewski, Associate Professor Department of Human Genetics, McGill University Montreal, Canada A few words about my lab Genomics
Regulation of Gene Expression in Eukaryotes
Ch. 19 Regulation of Gene Expression in Eukaryotes BIOL 222 Differential Gene Expression in Eukaryotes Signal Cells in a multicellular eukaryotic organism genetically identical differential gene expression
Epigenomics. Ivana de la Serna Block Health Science
Epigenomics Ivana de la Serna Block Health Science 388 383-4111 ivana.delaserna@utoledo.edu Outline 1. Epigenetics-definition and overview 2. DNA methylation/hydroxymethylation 3. Histone modifications
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region
Supplemental Figure S1. Tertiles of FKBP5 promoter methylation and internal regulatory region methylation in relation to PSS and fetal coupling. A, PSS values for participants whose placentas showed low,
Epigenetics and Autoimmune Disease
Epigenetics and Autoimmune Disease Lisa F. Barcellos, PhD, MPH Associate Professor UC Berkeley School of Public Health QB3 Genetic Epidemiology and Genomics Laboratory ACTRIMS, May 30, 2014 Dallas, TX
DNA and Histone Methylation in Learning and Memory
EXPERIMENTAL BIOLOGY ANNUAL MEETING April 2010 DNA and Histone Methylation in Learning and Memory J. David Sweatt Dept of Neurobiology McKnight Brain Institute UAB School of Medicine The Molecular Basis
Targeted Inhibition of Polycomb Repressive Complexes in Multiple Myeloma
Digital Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1296 Targeted Inhibition of Polycomb Repressive Complexes in Multiple Myeloma Implications for Biology and Therapy
Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
Analysis of shotgun bisulfite sequencing of cancer samples
Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The
DNA Methylation and Cancer
DNA Methylation and Cancer October 25, 2016 Dominic Smiraglia, Ph.D. Department of Cancer Genetics From Alan Wolffe, Science and Medicine, 1999 Vital Statistics Human genome contains 3 billion bp ~ 50,000
Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus
Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino
An integrative pan-cancer-wide analysis of epigenetic enzymes reveals universal patterns of epigenomic deregulation in cancer
Yang et al. Genome Biology (2015) 16:140 DOI 10.1186/s13059-015-0699-9 RESEARCH Open Access An integrative pan-cancer-wide analysis of epigenetic enzymes reveals universal patterns of epigenomic deregulation
Epigenetics and Toxicology
Epigenetics and Toxicology Aline.deconti@fda.hhs.gov Division of Biochemical Toxicology National Center for Toxicology Research U.S.-Food and Drug Administration The views expressed in this presentation
Liquid Biopsy. Jesus Garcia-Foncillas MD PhD. Director
Liquid Biopsy Jesus Garcia-Foncillas MD PhD Director Main issues about liquid biopsies New paradigm: Precision Medicine Heterogeneity & Dynamics Surrogate mirror for the tumor CTCs in colon cancer ctdna:
Environmental programming of respiratory allergy in childhood: the applicability of saliva
Environmental programming of respiratory allergy in childhood: the applicability of saliva 10/12/2013 to study the effect of environmental exposures on DNA methylation Dr. Sabine A.S. Langie Flemish Institute
Solomon Graf, MD February 22, 2013
Solomon Graf, MD February 22, 2013 Case Review of FL pathology, prognosis Grading of FL Grade 3 disease High proliferative index in grade 1/2 disease Pediatric FL Future of FL classification 57 yo man
Epigenetics and Colorectal Cancer Pathogenesis
Cancers 2013, 5, 676-713; doi:10.3390/cancers5020676 Article OPEN ACCESS cancers ISSN 2072-6694 www.mdpi.com/journal/cancers Epigenetics and Colorectal Cancer Pathogenesis Kankana Bardhan and Kebin Liu
Highlights of ICML 2015
Highlights of ICML 2015 Jonathan W. Friedberg M.D. Director, James P. Wilmot Cancer Center Statistics, ICML 2015: a global meeting Almost 3700 participants. 90 countries represented. Attendees: USA 465
ESMO DOUBLE-HIT LYMPHOMAS
ESMO DOUBLE-HIT LYMPHOMAS Professor Dr. med. Georg Lenz Director Department of Hematology and Oncology Universitätsklinikum Münster, Germany OVERVIEW Definition of double-hit lymphomas Introduction in
Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs
Roos et al. Clinical Epigenetics (2016) 8:7 DOI 10.1186/s13148-016-0172-y RESEARCH Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs Open Access Leonie
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients. Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA
OverView Circulating Nucleic Acids (CFNA) in Cancer Patients Dave S.B. Hoon John Wayne Cancer Institute Santa Monica, CA, USA cfna Blood Assays Cell-free nucleic acids as biomarkers in cancer patients.
Chromatin-Based Regulation of Gene Expression
Chromatin-Based Regulation of Gene Expression.George J. Quellhorst, Jr., PhD.Associate Director, R&D.Biological Content Development Topics to be Discussed Importance of Chromatin-Based Regulation Mechanism
USCAP Pediatrics Evening Subspecialty Conference 2015
USCAP Pediatrics Evening Subspecialty Conference 2015 Sunday 22 March 2015 Alexander Lazar MD/PhD Department of Pathology S Section of Bone Soft TIssue Pathology Sarcoma Research Center The Case Patient
Session 6: Integration of epigenetic data. Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016
Session 6: Integration of epigenetic data Peter J Park Department of Biomedical Informatics Harvard Medical School July 18-19, 2016 Utilizing complimentary datasets Frequent mutations in chromatin regulators
Abstract. KEY WORDS: epigenetics, DNA methylation, histone modification, one-carbon metabolism, stem cell aging, anti-aging medicine
Glycative Stress Research Online edition : ISSN 2188-3610 Print edition : ISSN 2188-3602 Received : May 17, 2018 Accepted : July 18, 2018 Published online : September 30, 2018 doi:10.24659/gsr.5.3_129
Carcinogenesis in IBD
Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in IBD Dr Simon Leedham, Oxford, UK Oxford Inflammatory Bowel Disease MasterClass Carcinogenesis in Inflammatory Bowel Disease Dr Simon Leedham
TITLE: Insight Into Skin Tumorigenesis Highlighting the Function of Epigenetic Regulators in SCC Formation
AD Award Number: W81XWH-12-1-0463 TITLE: Insight Into Skin Tumorigenesis Highlighting the Function of Epigenetic Regulators in SCC Formation PRINCIPAL INVESTIGATOR: Jisheng Zhang CONTRACTING ORGANIZATION:
Please Silence Your Cell Phones. Thank You
Please Silence Your Cell Phones Thank You Utility of NGS and Comprehensive Genomic Profiling in Hematopathology Practice Maria E. Arcila M.D. Memorial Sloan Kettering Cancer Center New York, NY Disclosure
Genetics and Genomics in Medicine Chapter 6 Questions
Genetics and Genomics in Medicine Chapter 6 Questions Multiple Choice Questions Question 6.1 With respect to the interconversion between open and condensed chromatin shown below: Which of the directions
Harnessing Killer T Cells
Harnessing Killer T Cells Julie Nielsen, PhD BC Cancer Agency May 2, 2015 Overview The immune response to cancer What T cells are & how they work Immune-based therapies for cancer Using T cells to target