Supplementary Note. Nature Genetics: doi: /ng.2928
|
|
- Sharon Mason
- 5 years ago
- Views:
Transcription
1 Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped file. SNPs with a call rate of 0.2 were plotted from the ped file in R version using the pheatmap version package. DNA methylation analysis. Global DNA methylation was evaluated using the Infinium HumanMethylation450 BeadChip Array. Briefly, 1 µg of each sample DNA underwent bisulfite conversion using using the EZ DNA methylation kit according to the manufacturer s recommendation for the Illumina Infinium Assay. Bisulfite-treated DNA was then hybridized to arrays according to the manufacturer s protocol. We used GenomeStudio V (Illumina) for methylation data assembly and acquisition as well as background correction and normalization. Methylation levels for each CpG residue are presented as β values, estimating the ratio of the methylated signal intensity over the sum of the methylated and unmethylated intensities at each locus. The average β value reports a methylation signal ranging from 0 to 1 representing completely unmethylated to completely methylated values, respectively. All probes with detection p-values >0.01 were removed. Differential methylation was performed in GenomeStudio by comparing 8 SCCOHT samples to two individual pools of normal fallopian tissue. Resultant β values were assigned a DiffScore to measure statistical significance. All p- values were corrected by calculating a false discovery rate. Probes with DiffScores 13 or -13 and delta β values 0.2 or -0.2 were considered statistically significant and differentially methylated.
2 Figures Supplementary Figure 1. LOH analysis in SCCOHT tumors with SMARCA4 mutations. LOH analysis was performed using bcbio- nextgen 0.7.7a- e91123c to map reads with BWA 0.7.5a to GRCh37 and freebayes v for joint variant calling restricted to chr. 19: 10,667,750 11,554,548. The heat map shows SNPs with a call rate of 0.2. No evidence of LOH was observed. Supplementary Figure 2. Genome view of SMARCA4 450K methylation data. The top panel is a scatter plot displaying differential β values for all 44 SMARCA4 CpG probes in eight SCCOHT samples. Only two probes demonstrate differential hypomethylation (indicated by a red box). The upper limit of the y axis does not exceed 0.11, indicative of a lack of differential hypermethylation for any probe.
3 Supplementary Figure 3. SMARCA4 methylation status in SCCOHT tumors and normal fallopian tube tissues. Vertical scatter plot of the average β values for 44 SMARCA4 450K CpG methylation probes in 8 SCCOHTs and 2 pools of normal fallopian tissue. There is no significant difference in SMARCA4 methylation between normal tissue and SCCOHT.
4 Supplementary Figure 4. SMARCA4 immunohistochemistry in normal premenopausal ovary and fallopian tube. H&E- stained sections (A, C, E) and SMARCA4 immunohistochemistry (B, D, F) demonstrating strong, uniform positive nuclear staining in oocytes (B), granulosa cells of primordial (B) and secondary (D) follicles, theca cells (D) and secretory and ciliated cells throughout the fallopian tube ampulla (F) and fimbria (data not shown). In contrast, the ovarian stroma stains weakly (B) or is negative (data not shown). 400 magnification. Scale bars, 50 μm.
5 Tables Supplementary Table 1. Characteristics of SCCOHT patient samples analyzed by next- generation sequencing. Sample Age at diagnosis (years) FIGO Stage Ethnicity SCCOHT tissue source Hypercalcemia SCCO- 002* 26 IA European Tumor recurrence Yes SCCO IA European Primary tumor Yes SCCO IC European Primary tumor Yes SCCO IIIC European Primary tumor Yes SCCO IIIC African American Tumor recurrence Yes SCCO IIIA African American Primary tumor Yes SCCO IIIC European Primary tumor N/A DAH23 30 IA N/A Primary tumor Yes DAH456* 39 IIIC Hispanic Primary tumor N/A DAH IV European Primary tumor N/A DG1006* 34 N/A N/A Primary tumor Yes DG1219* 37 I European Tumor recurrence Yes *Cases with sequenced Tumor/Normal pair. N/A, information not available.
6 Supplementary Table 3. Immunohistochemistry (IHC) analysis of SCCOHT tumors. Age at diagnosis SMARCA4 mutations Sample SMARCA4 IHC SMARCB1 IHC (years) (protein) SCCO- 002* 26 None Negative Positive SCCO p.arg979* N/A N/A SCCO None Positive Negative SCCO p.gly241fs Negative Positive SCCO None Negative Positive SCCO p.glu667fs p.leu1161fs N/A N/A SCCO p.arg1189* N/A N/A DAH23 30 Splice site mutation Negative N/A DAH456* 39 None Positive N/A DAH p.arg1093* N/A N/A DG1006* 34 p.glu952fs p.ser1591fs Negative N/A DG1219* 37 Splice site mutation Negative N/A BIN- 67 Tumor cell line 2 Splice site mutations Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Positive N/A SCCO N/A Negative N/A *Cases with sequenced Tumor/Normal pair. N/A, sample not available.
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic
More informationCDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.
Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder
More informationDNA-seq Bioinformatics Analysis: Copy Number Variation
DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq
More informationSSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.
Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide
More informationEpigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017
Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of
More informationNature Methods: doi: /nmeth.3115
Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by
More informationWhole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute
Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes
More informationIntegrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs
Roos et al. Clinical Epigenetics (2016) 8:7 DOI 10.1186/s13148-016-0172-y RESEARCH Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs Open Access Leonie
More informationIntegrated genomic analysis of human osteosarcomas
Integrated genomic analysis of human osteosarcomas Leonardo A. Meza-Zepeda Project Leader Genomic Section Department of Tumor Biology The Norwegian Radium Hospital Head Microarray Core Facility Norwegian
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationEpigenetics and Autoimmune Disease
Epigenetics and Autoimmune Disease Lisa F. Barcellos, PhD, MPH Associate Professor UC Berkeley School of Public Health QB3 Genetic Epidemiology and Genomics Laboratory ACTRIMS, May 30, 2014 Dallas, TX
More informationAdvance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library
Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.
More informationNo evidence of clonally selected somatic genomic alterations in cancer associated
Supplementary Data Resource No evidence of clonally selected somatic genomic alterations in cancer associated fibroblasts from human breast and ovarian carcinomas Wen Qiu, Min Hu, Anita Sridhar, Ken Opeskin,
More informationIntroduction to LOH and Allele Specific Copy Number User Forum
Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.
More informationSupplementary Methods
Supplementary Methods Short Read Preprocessing Reads are preprocessed differently according to how they will be used: detection of the variant in the tumor, discovery of an artifact in the normal or for
More informationAVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits
AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect
More informationDiffVar: a new method for detecting differential variability with application to methylation in cancer and aging
Genome Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. DiffVar: a new method for detecting
More informationunderlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The
More informationNature Genetics: doi: /ng.2995
Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation
More informationiplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).
Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES
More informationMeta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for
Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for TET2 Paul Guilhamon 1, Malihe Eskandarpour 2, Dina Halai 3, Gareth A. Wilson 1, Andrew Feber 1, Andrew E. Teschendorff
More informationMSI positive MSI negative
Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden
More informationCase Presentation Diana Lim, MBBS, FRCPA, FRCPath Senior Consultant Department of Pathology, National University Health System, Singapore Assistant Pr
Case Presentation Diana Lim, MBBS, FRCPA, FRCPath Senior Consultant Department of Pathology, National University Health System, Singapore Assistant Professor Yong Loo Lin School of Medicine, National University
More informationNature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.
Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype
More informationFigure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing
Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align
More informationIntegrative genomic analysis identifies epigenetic marks that mediate genetic risk for epithelial ovarian cancer
Koestler et al. BMC Medical Genomics 2014, 7:8 RESEARCH ARTICLE Open Access Integrative genomic analysis identifies epigenetic marks that mediate genetic risk for epithelial ovarian cancer Devin C Koestler
More informationHands-On Ten The BRCA1 Gene and Protein
Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such
More informationLentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.
Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.
More informationMutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research
Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,
More informationFigure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET
Supplemental Figure Legends Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET Multiple unsupervised analyses were performed on human HT-1v4 expression array (Illumina) data from
More informationAnalysis of shotgun bisulfite sequencing of cancer samples
Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The
More informationDNA methylation profiling in peripheral lung tissues of smokers and patients with COPD
https://helda.helsinki.fi DNA methylation profiling in peripheral lung tissues of smokers and patients with COPD Sundar, Isaac K. 2017-04-14 Sundar, I K, Yin, Q, Baier, B S, Yan, L, Mazur, W, Li, D, Susiarjo,
More informationBarrett s Esophagus and Esophageal Adenocarcinoma Epigenetic Biomarker Discovery Using Infinium Methylation
February 2008 Application Note arrett s Esophagus and Esophageal Adenocarcinoma Epigenetic iomarker Discovery Using Infinium Methylation Contributed by Patricia C. Galipeau, Dennis L. Chao, Xiaohong Li,
More informationThe 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis
The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis Tieliu Shi tlshi@bio.ecnu.edu.cn The Center for bioinformatics
More informationUnderstanding DNA Copy Number Data
Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php
More informationNature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.
Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic
More informationDNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas
Paul et al. Clinical Epigenetics (2017) 9:32 DOI 10.1186/s13148-017-0331-9 RESEARCH Open Access DNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas Yashna Paul, Baisakhi
More informationTissue of origin determines cancer-associated CpG island promoter hypermethylation patterns
RESEARCH Open Access Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns Duncan Sproul 1,2, Robert R Kitchen 1,3, Colm E Nestor 1,2, J Michael Dixon 1, Andrew H
More informationSupplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,
Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The
More informationValidation of the MethylationEPIC BeadChip for fresh-frozen and formalin-fixed paraffinembedded
Kling et al. Clinical Epigenetics (2017) 9:33 DOI 10.1186/s13148-017-0333-7 SHORT REPORT Validation of the MethylationEPIC BeadChip for fresh-frozen and formalin-fixed paraffinembedded tumours Teresia
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationLow levels of IGFBP7 expression in high-grade serous ovarian carcinoma is associated with patient outcome
Gambaro et al. BMC Cancer (2015) 15:135 DOI 10.1186/s12885-015-1138-8 RESEARCH ARTICLE Low levels of IGFBP7 expression in high-grade serous ovarian carcinoma is associated with patient outcome Open Access
More informationSupplementary information. Supplementary figure 1. Flow chart of study design
Supplementary information Supplementary figure 1. Flow chart of study design Supplementary Figure 2. Quantile-quantile plot of stage 1 results QQ plot of the observed -log10 P-values (y axis) versus the
More informationSupplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was
Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration
More informationSupplementary Tables. Supplementary Figures
Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample
More informationPhenotype prediction based on genome-wide DNA methylation data
Wilhelm BMC Bioinformatics 2014, 15:193 METHODOLOGY ARTICLE Open Access Phenotype prediction based on genome-wide DNA methylation data Thomas Wilhelm Abstract Background: DNA methylation (DNAm) has important
More informationSupplementary note: Comparison of deletion variants identified in this study and four earlier studies
Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies
More informationSUPPLEMENTARY FIGURES: Supplementary Figure 1
SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic
More informationMeasuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16
Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Epigenetics: Modern Modern Definition of epigenetics involves heritable changes
More informationgliomas. Fetal brain expected who each low-
Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationBreast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS
Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and
More informationStage 3 ovarian cancer survival rate
Search Stage 3 ovarian cancer survival rate 19-5-2017 If you've been diagnosed with ovarian cancer, it's natural to wonder about your prognosis. Learn about survival rates, outlook, and more. Take the
More informationBin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,
The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,
More informationNature Medicine: doi: /nm.4439
Figure S1. Overview of the variant calling and verification process. This figure expands on Fig. 1c with details of verified variants identification in 547 additional validation samples. Somatic variants
More informationEpigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum
Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Mary Beth Terry, Jasmine A. McDonald, Hui Chen Wu, Sybil Eng and Regina M. Santella Abstract Epigenetic biomarkers,
More informationGlobal variation in copy number in the human genome
Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)
More informationStage 3 ovarian cancer survival rate
Stage 3 ovarian cancer survival rate Gogamz Menu The latest ovarian cancer survival statistics for the UK for Health Professionals. See data for age, trends over time, stage at diagnosis and more. 5-8-2014
More informationTCGA. The Cancer Genome Atlas
TCGA The Cancer Genome Atlas TCGA: History and Goal History: Started in 2005 by the National Cancer Institute (NCI) and the National Human Genome Research Institute (NHGRI) with $110 Million to catalogue
More informationPackage MethPed. September 1, 2018
Type Package Version 1.8.0 Date 2016-01-01 Package MethPed September 1, 2018 Title A DNA methylation classifier tool for the identification of pediatric brain tumor subtypes Depends R (>= 3.0.0), Biobase
More information(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)
Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory
More informationSupplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III
Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor
More informationForward Looking Statements
Forward Looking Statements Some of the information presented here today may contain projections or other forward-looking statements regarding future events or the future financial performance 15M Patient
More informationAVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB
Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation
More informationPlatform Approach to Cancer Discovery and Diagnostics Development
Platform Approach to Cancer Discovery and Diagnostics Development Joanne Yeakley Staff Manager, Scientific Research Diagnostic Assay Development 2009 Illumina, Inc. All rights reserved. Illumina, illuminadx,
More informationDeregulation of STING Signaling in Colorectal Carcinoma Constrains DNA Damage Responses and Correlates With Tumorigenesis
Cell Reports Supplemental Information Deregulation of STING Signaling in Colorectal Carcinoma Constrains DNA Damage Responses and Correlates With Tumorigenesis Tianli Xia, Hiroyasu Konno, Jeonghyun Ahn,
More informationDominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer
Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for
More informationWhat are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine?
What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine? by Robert John Hollows This project is submitted in partial fulfilment of the requirements
More informationSupplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.
mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their
More informationEvaluation of BRCA1/2 and homologous recombination defects in ovarian cancer and impact on clinical outcomes
Evaluation of BRCA1/2 and homologous recombination defects in ovarian cancer and impact on clinical outcomes Melinda S. Yates, PhD Department of Gynecologic Oncology & Reproductive Medicine University
More informationSingle-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA
www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials
More informationp.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11
ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N
More informationDNA methylation profiling in the Carolina Breast Cancer Study defines cancer subclasses differing in clinicopathologic characteristics and survival
Conway et al. Breast Cancer Research 2014, 16:450 RESEARCH ARTICLE Open Access DNA methylation profiling in the Carolina Breast Cancer Study defines cancer subclasses differing in clinicopathologic characteristics
More informationSupplementary Information
Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho
More informationSUPPLEMENTAL INFORMATION
SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics
ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole
More informationUsing the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep
Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold
More informationRASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays
Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,
More informationEpigenetics and Chromatin Remodeling
Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory
More informationInterpretation of p53 Immunostains. P53 Mutations are Ubiquitous in High Grade Serous Carcinoma. Diffuse strong positive nuclear staining
Stains for Tumor Classification p53 p16 WT1 HMGA2 P53 Mutations are Ubiquitous in High Grade Serous Carcinoma Source Ahmed et al Australian Ovarian Cancer Study Cancer Genome Atlas Research Network Cases
More informationEVALUATION OF FOLLICULAR ATRESIA AND ELECTROPHORETIC PATTERN OF FOLLICULAR FLUID PROTEINS IN ACYCLIC BUFFALO (Bubalus bubalis)
Original Article Buffalo Bulletin (December 2013) Vol.32 No.4 EVALUATION OF FOLLICULAR ATRESIA AND ELECTROPHORETIC PATTERN OF FOLLICULAR FLUID PROTEINS IN ACYCLIC BUFFALO (Bubalus bubalis) F.A. Khan 1,*,
More informationSupplementary Figure 1 Overall study design
Supplementary Figure 1 Overall study design We obtained 19 tumour specimens from 14 men with prostate cancer who harboured pathogenic germline BRCA2-mutations. Germline DNA was available for five patients
More informationMEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)
Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;
More informationHHS Public Access Author manuscript Int J Obes (Lond). Author manuscript; available in PMC 2015 November 01.
Epigenetic Patterns in Successful Weight Loss Maintainers: A Pilot Study Yen-Tsung Huang, MD, MPH, SM, ScD #1, Jennifer Z.J. Maccani, PhD #2, Nicola L. Hawley, PhD 3,4,5, Rena R. Wing, PhD 3,4, Karl T.
More informationStatistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies
Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley
More informationAssignment 5: Integrative epigenomics analysis
Assignment 5: Integrative epigenomics analysis Due date: Friday, 2/24 10am. Note: no late assignments will be accepted. Introduction CpG islands (CGIs) are important regulatory regions in the genome. What
More informationAnalysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers
Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies
More informationMeaning-based guidance of attention in scenes as revealed by meaning maps
SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41562-17-28- In the format provided by the authors and unedited. -based guidance of attention in scenes as revealed by meaning maps John M. Henderson 1,2 *
More informationClonal evolution of human cancers
Clonal evolution of human cancers -Pathology-based microdissection and genetic analysis precisely demonstrates molecular evolution of neoplastic clones- Hiroaki Fujii, MD Ageo Medical Laboratories, Yashio
More informationDr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.
Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag
More informationSupplemental Table 1. Cell Lines used in the CRISPR pooled screen.
Supplemental Table 1. Cell Lines used in the CRISPR pooled screen. 5637_URINARY_TRACT HEC1B_ENDOMETRIUM NCIH1975_LUNG RCCGS_KIDNEY 639V_URINARY_TRACT HPAFII_PANCREAS NCIH1993_LUNG RCCJW_KIDNEY 647V_URINARY_TRACT
More informationEpigenetic drift in aging twins
Epigenetic drift in aging twins Qihua Tan, MD, PhD Kaare Christensen, MD, PhD Lene Christiansen, PhD Epidemiology, Biostatistics and Biodemography, Institute of Public Health Unit of Human Genetics, Institute
More informationComparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers
Zhang et al. BMC Genomics 2014, 15:868 RESEARCH ARTICLE Open Access Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers
More informationLynch Syndrome Screening for Endometrial Cancer: Basic Concepts 1/16/2017
1 Hi, my name is Sarah Kerr. I m a pathologist at Mayo Clinic, where I participate in our high volume Lynch syndrome tumor testing practice. Today I hope to cover some of the basics needed to understand
More informationPredictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D.
Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Department of Environmental Health University of Cincinnati Background Breast cancer (BCa) The second most common cancer among women in
More informationSupplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.
Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized
More informationGentilini et al. Clinical Epigenetics (2018) 10:77
Gentilini et al. Clinical Epigenetics (2018) 10:77 https://doi.org/10.1186/s13148-018-0510-3 RESEARCH Open Access Multifactorial analysis of the stochastic epigenetic variability in cord blood confirmed
More information