Supplementary Note. Nature Genetics: doi: /ng.2928

Size: px
Start display at page:

Download "Supplementary Note. Nature Genetics: doi: /ng.2928"

Transcription

1 Supplementary Note Loss of heterozygosity analysis (LOH). We used VCFtools v to extract only singlenucleotide variants with minimum depth of 15X and minimum mapping quality of 20 to create a ped file. SNPs with a call rate of 0.2 were plotted from the ped file in R version using the pheatmap version package. DNA methylation analysis. Global DNA methylation was evaluated using the Infinium HumanMethylation450 BeadChip Array. Briefly, 1 µg of each sample DNA underwent bisulfite conversion using using the EZ DNA methylation kit according to the manufacturer s recommendation for the Illumina Infinium Assay. Bisulfite-treated DNA was then hybridized to arrays according to the manufacturer s protocol. We used GenomeStudio V (Illumina) for methylation data assembly and acquisition as well as background correction and normalization. Methylation levels for each CpG residue are presented as β values, estimating the ratio of the methylated signal intensity over the sum of the methylated and unmethylated intensities at each locus. The average β value reports a methylation signal ranging from 0 to 1 representing completely unmethylated to completely methylated values, respectively. All probes with detection p-values >0.01 were removed. Differential methylation was performed in GenomeStudio by comparing 8 SCCOHT samples to two individual pools of normal fallopian tissue. Resultant β values were assigned a DiffScore to measure statistical significance. All p- values were corrected by calculating a false discovery rate. Probes with DiffScores 13 or -13 and delta β values 0.2 or -0.2 were considered statistically significant and differentially methylated.

2 Figures Supplementary Figure 1. LOH analysis in SCCOHT tumors with SMARCA4 mutations. LOH analysis was performed using bcbio- nextgen 0.7.7a- e91123c to map reads with BWA 0.7.5a to GRCh37 and freebayes v for joint variant calling restricted to chr. 19: 10,667,750 11,554,548. The heat map shows SNPs with a call rate of 0.2. No evidence of LOH was observed. Supplementary Figure 2. Genome view of SMARCA4 450K methylation data. The top panel is a scatter plot displaying differential β values for all 44 SMARCA4 CpG probes in eight SCCOHT samples. Only two probes demonstrate differential hypomethylation (indicated by a red box). The upper limit of the y axis does not exceed 0.11, indicative of a lack of differential hypermethylation for any probe.

3 Supplementary Figure 3. SMARCA4 methylation status in SCCOHT tumors and normal fallopian tube tissues. Vertical scatter plot of the average β values for 44 SMARCA4 450K CpG methylation probes in 8 SCCOHTs and 2 pools of normal fallopian tissue. There is no significant difference in SMARCA4 methylation between normal tissue and SCCOHT.

4 Supplementary Figure 4. SMARCA4 immunohistochemistry in normal premenopausal ovary and fallopian tube. H&E- stained sections (A, C, E) and SMARCA4 immunohistochemistry (B, D, F) demonstrating strong, uniform positive nuclear staining in oocytes (B), granulosa cells of primordial (B) and secondary (D) follicles, theca cells (D) and secretory and ciliated cells throughout the fallopian tube ampulla (F) and fimbria (data not shown). In contrast, the ovarian stroma stains weakly (B) or is negative (data not shown). 400 magnification. Scale bars, 50 μm.

5 Tables Supplementary Table 1. Characteristics of SCCOHT patient samples analyzed by next- generation sequencing. Sample Age at diagnosis (years) FIGO Stage Ethnicity SCCOHT tissue source Hypercalcemia SCCO- 002* 26 IA European Tumor recurrence Yes SCCO IA European Primary tumor Yes SCCO IC European Primary tumor Yes SCCO IIIC European Primary tumor Yes SCCO IIIC African American Tumor recurrence Yes SCCO IIIA African American Primary tumor Yes SCCO IIIC European Primary tumor N/A DAH23 30 IA N/A Primary tumor Yes DAH456* 39 IIIC Hispanic Primary tumor N/A DAH IV European Primary tumor N/A DG1006* 34 N/A N/A Primary tumor Yes DG1219* 37 I European Tumor recurrence Yes *Cases with sequenced Tumor/Normal pair. N/A, information not available.

6 Supplementary Table 3. Immunohistochemistry (IHC) analysis of SCCOHT tumors. Age at diagnosis SMARCA4 mutations Sample SMARCA4 IHC SMARCB1 IHC (years) (protein) SCCO- 002* 26 None Negative Positive SCCO p.arg979* N/A N/A SCCO None Positive Negative SCCO p.gly241fs Negative Positive SCCO None Negative Positive SCCO p.glu667fs p.leu1161fs N/A N/A SCCO p.arg1189* N/A N/A DAH23 30 Splice site mutation Negative N/A DAH456* 39 None Positive N/A DAH p.arg1093* N/A N/A DG1006* 34 p.glu952fs p.ser1591fs Negative N/A DG1219* 37 Splice site mutation Negative N/A BIN- 67 Tumor cell line 2 Splice site mutations Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Negative Positive SCCO N/A Positive N/A SCCO N/A Negative N/A *Cases with sequenced Tumor/Normal pair. N/A, sample not available.

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon

FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic

More information

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing.

CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Supplementary Figure 1 CDH1 truncating alterations were detected in all six plasmacytoid-variant bladder tumors analyzed by whole-exome sequencing. Whole-exome sequencing of six plasmacytoid-variant bladder

More information

DNA-seq Bioinformatics Analysis: Copy Number Variation

DNA-seq Bioinformatics Analysis: Copy Number Variation DNA-seq Bioinformatics Analysis: Copy Number Variation Elodie Girard elodie.girard@curie.fr U900 institut Curie, INSERM, Mines ParisTech, PSL Research University Paris, France NGS Applications 5C HiC DNA-seq

More information

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer.

SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Supplementary Figure 1 SSM signature genes are highly expressed in residual scar tissues after preoperative radiotherapy of rectal cancer. Scatter plots comparing expression profiles of matched pretreatment

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Pan-cancer analysis of global and local DNA methylation variation a) Variations in global DNA methylation are shown as measured by averaging the genome-wide

More information

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017

Epigenetics. Jenny van Dongen Vrije Universiteit (VU) Amsterdam Boulder, Friday march 10, 2017 Epigenetics Jenny van Dongen Vrije Universiteit (VU) Amsterdam j.van.dongen@vu.nl Boulder, Friday march 10, 2017 Epigenetics Epigenetics= The study of molecular mechanisms that influence the activity of

More information

Nature Methods: doi: /nmeth.3115

Nature Methods: doi: /nmeth.3115 Supplementary Figure 1 Analysis of DNA methylation in a cancer cohort based on Infinium 450K data. RnBeads was used to rediscover a clinically distinct subgroup of glioblastoma patients characterized by

More information

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute

Whole Genome and Transcriptome Analysis of Anaplastic Meningioma. Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Whole Genome and Transcriptome Analysis of Anaplastic Meningioma Patrick Tarpey Cancer Genome Project Wellcome Trust Sanger Institute Outline Anaplastic meningioma compared to other cancers Whole genomes

More information

Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs

Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs Roos et al. Clinical Epigenetics (2016) 8:7 DOI 10.1186/s13148-016-0172-y RESEARCH Integrative DNA methylome analysis of pan-cancer biomarkers in cancer discordant monozygotic twin-pairs Open Access Leonie

More information

Integrated genomic analysis of human osteosarcomas

Integrated genomic analysis of human osteosarcomas Integrated genomic analysis of human osteosarcomas Leonardo A. Meza-Zepeda Project Leader Genomic Section Department of Tumor Biology The Norwegian Radium Hospital Head Microarray Core Facility Norwegian

More information

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH

EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2

More information

Epigenetics and Autoimmune Disease

Epigenetics and Autoimmune Disease Epigenetics and Autoimmune Disease Lisa F. Barcellos, PhD, MPH Associate Professor UC Berkeley School of Public Health QB3 Genetic Epidemiology and Genomics Laboratory ACTRIMS, May 30, 2014 Dallas, TX

More information

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library

Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Advance Your Genomic Research Using Targeted Resequencing with SeqCap EZ Library Marilou Wijdicks International Product Manager Research For Life Science Research Only. Not for Use in Diagnostic Procedures.

More information

No evidence of clonally selected somatic genomic alterations in cancer associated

No evidence of clonally selected somatic genomic alterations in cancer associated Supplementary Data Resource No evidence of clonally selected somatic genomic alterations in cancer associated fibroblasts from human breast and ovarian carcinomas Wen Qiu, Min Hu, Anita Sridhar, Ken Opeskin,

More information

Introduction to LOH and Allele Specific Copy Number User Forum

Introduction to LOH and Allele Specific Copy Number User Forum Introduction to LOH and Allele Specific Copy Number User Forum Jonathan Gerstenhaber Introduction to LOH and ASCN User Forum Contents 1. Loss of heterozygosity Analysis procedure Types of baselines 2.

More information

Supplementary Methods

Supplementary Methods Supplementary Methods Short Read Preprocessing Reads are preprocessed differently according to how they will be used: detection of the variant in the tumor, discovery of an artifact in the normal or for

More information

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits

AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits AVENIO family of NGS oncology assays ctdna and Tumor Tissue Analysis Kits Accelerating clinical research Next-generation sequencing (NGS) has the ability to interrogate many different genes and detect

More information

DiffVar: a new method for detecting differential variability with application to methylation in cancer and aging

DiffVar: a new method for detecting differential variability with application to methylation in cancer and aging Genome Biology This Provisional PDF corresponds to the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. DiffVar: a new method for detecting

More information

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The Supplementary Figures Figure S1. Patient cohorts and study design. To define and interrogate the genetic alterations underlying metastasis and recurrence in HNSCC, we analyzed two groups of patients. The

More information

Nature Genetics: doi: /ng.2995

Nature Genetics: doi: /ng.2995 Supplementary Figure 1 Kaplan-Meier survival curves of patients with brainstem tumors. (a) Comparison of patients with PPM1D mutation versus wild-type PPM1D. (b) Comparison of patients with PPM1D mutation

More information

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers).

iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). Supplementary Materials Supplementary Methods iplex genotyping IDH1 and IDH2 assays utilized the following primer sets (forward and reverse primers along with extension primers). IDH1 R132H and R132L Forward:

More information

SUPPLEMENTARY INFORMATION

SUPPLEMENTARY INFORMATION doi:10.1038/nature10866 a b 1 2 3 4 5 6 7 Match No Match 1 2 3 4 5 6 7 Turcan et al. Supplementary Fig.1 Concepts mapping H3K27 targets in EF CBX8 targets in EF H3K27 targets in ES SUZ12 targets in ES

More information

Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for

Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for Meta-analysis of IDH-mutant cancers identifies EBF1 as a novel interaction partner for TET2 Paul Guilhamon 1, Malihe Eskandarpour 2, Dina Halai 3, Gareth A. Wilson 1, Andrew Feber 1, Andrew E. Teschendorff

More information

MSI positive MSI negative

MSI positive MSI negative Pritchard et al. 2014 Supplementary Figure 1 MSI positive MSI negative Hypermutated Median: 673 Average: 659.2 Non-Hypermutated Median: 37.5 Average: 43.6 Supplementary Figure 1: Somatic Mutation Burden

More information

Case Presentation Diana Lim, MBBS, FRCPA, FRCPath Senior Consultant Department of Pathology, National University Health System, Singapore Assistant Pr

Case Presentation Diana Lim, MBBS, FRCPA, FRCPath Senior Consultant Department of Pathology, National University Health System, Singapore Assistant Pr Case Presentation Diana Lim, MBBS, FRCPA, FRCPath Senior Consultant Department of Pathology, National University Health System, Singapore Assistant Professor Yong Loo Lin School of Medicine, National University

More information

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data.

Nature Genetics: doi: /ng Supplementary Figure 1. PCA for ancestry in SNV data. Supplementary Figure 1 PCA for ancestry in SNV data. (a) EIGENSTRAT principal-component analysis (PCA) of SNV genotype data on all samples. (b) PCA of only proband SNV genotype data. (c) PCA of SNV genotype

More information

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing

Figure S4. 15 Mets Whole Exome. 5 Primary Tumors Cancer Panel and WES. Next Generation Sequencing Figure S4 Next Generation Sequencing 15 Mets Whole Exome 5 Primary Tumors Cancer Panel and WES Get coverage of all variant loci for all three Mets Variant Filtering Sequence Alignments Index and align

More information

Integrative genomic analysis identifies epigenetic marks that mediate genetic risk for epithelial ovarian cancer

Integrative genomic analysis identifies epigenetic marks that mediate genetic risk for epithelial ovarian cancer Koestler et al. BMC Medical Genomics 2014, 7:8 RESEARCH ARTICLE Open Access Integrative genomic analysis identifies epigenetic marks that mediate genetic risk for epithelial ovarian cancer Devin C Koestler

More information

Hands-On Ten The BRCA1 Gene and Protein

Hands-On Ten The BRCA1 Gene and Protein Hands-On Ten The BRCA1 Gene and Protein Objective: To review transcription, translation, reading frames, mutations, and reading files from GenBank, and to review some of the bioinformatics tools, such

More information

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression.

Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. Supplementary Figure 1 Lentiviral Delivery of Combinatorial mirna Expression Constructs Provides Efficient Target Gene Repression. a, Design for lentiviral combinatorial mirna expression and sensor constructs.

More information

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research

Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Mutation Detection and CNV Analysis for Illumina Sequencing data from HaloPlex Target Enrichment Panels using NextGENe Software for Clinical Research Application Note Authors John McGuigan, Megan Manion,

More information

Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET

Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET Supplemental Figure Legends Figure 1 Gene expression profiles define 3 molecular sub-groups of CNS-PNET Multiple unsupervised analyses were performed on human HT-1v4 expression array (Illumina) data from

More information

Analysis of shotgun bisulfite sequencing of cancer samples

Analysis of shotgun bisulfite sequencing of cancer samples Analysis of shotgun bisulfite sequencing of cancer samples Kasper Daniel Hansen Postdoc with Rafael Irizarry Johns Hopkins Bloomberg School of Public Health Brixen, July 1st, 2011 The

More information

DNA methylation profiling in peripheral lung tissues of smokers and patients with COPD

DNA methylation profiling in peripheral lung tissues of smokers and patients with COPD https://helda.helsinki.fi DNA methylation profiling in peripheral lung tissues of smokers and patients with COPD Sundar, Isaac K. 2017-04-14 Sundar, I K, Yin, Q, Baier, B S, Yan, L, Mazur, W, Li, D, Susiarjo,

More information

Barrett s Esophagus and Esophageal Adenocarcinoma Epigenetic Biomarker Discovery Using Infinium Methylation

Barrett s Esophagus and Esophageal Adenocarcinoma Epigenetic Biomarker Discovery Using Infinium Methylation February 2008 Application Note arrett s Esophagus and Esophageal Adenocarcinoma Epigenetic iomarker Discovery Using Infinium Methylation Contributed by Patricia C. Galipeau, Dennis L. Chao, Xiaohong Li,

More information

The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis

The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis The 16th KJC Bioinformatics Symposium Integrative analysis identifies potential DNA methylation biomarkers for pan-cancer diagnosis and prognosis Tieliu Shi tlshi@bio.ecnu.edu.cn The Center for bioinformatics

More information

Understanding DNA Copy Number Data

Understanding DNA Copy Number Data Understanding DNA Copy Number Data Adam B. Olshen Department of Epidemiology and Biostatistics Helen Diller Family Comprehensive Cancer Center University of California, San Francisco http://cc.ucsf.edu/people/olshena_adam.php

More information

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells.

Nature Immunology: doi: /ni Supplementary Figure 1. DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. Supplementary Figure 1 DNA-methylation machinery is essential for silencing of Cd4 in cytotoxic T cells. (a) Scheme for the retroviral shrna screen. (b) Histogram showing CD4 expression (MFI) in WT cytotoxic

More information

DNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas

DNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas Paul et al. Clinical Epigenetics (2017) 9:32 DOI 10.1186/s13148-017-0331-9 RESEARCH Open Access DNA methylation signatures for 2016 WHO classification subtypes of diffuse gliomas Yashna Paul, Baisakhi

More information

Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns

Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns RESEARCH Open Access Tissue of origin determines cancer-associated CpG island promoter hypermethylation patterns Duncan Sproul 1,2, Robert R Kitchen 1,3, Colm E Nestor 1,2, J Michael Dixon 1, Andrew H

More information

Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a,

Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Supplementary Figure 1: Expression of Gli1-lacZ in E17.5 ovary and mesonephros. a, Transverse sections of E17.5 ovary and mesonephros from Gli1-LacZ reporter embryos (n=3) after LacZ staining (blue). The

More information

Validation of the MethylationEPIC BeadChip for fresh-frozen and formalin-fixed paraffinembedded

Validation of the MethylationEPIC BeadChip for fresh-frozen and formalin-fixed paraffinembedded Kling et al. Clinical Epigenetics (2017) 9:33 DOI 10.1186/s13148-017-0333-7 SHORT REPORT Validation of the MethylationEPIC BeadChip for fresh-frozen and formalin-fixed paraffinembedded tumours Teresia

More information

Supplementary methods:

Supplementary methods: Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA

More information

Low levels of IGFBP7 expression in high-grade serous ovarian carcinoma is associated with patient outcome

Low levels of IGFBP7 expression in high-grade serous ovarian carcinoma is associated with patient outcome Gambaro et al. BMC Cancer (2015) 15:135 DOI 10.1186/s12885-015-1138-8 RESEARCH ARTICLE Low levels of IGFBP7 expression in high-grade serous ovarian carcinoma is associated with patient outcome Open Access

More information

Supplementary information. Supplementary figure 1. Flow chart of study design

Supplementary information. Supplementary figure 1. Flow chart of study design Supplementary information Supplementary figure 1. Flow chart of study design Supplementary Figure 2. Quantile-quantile plot of stage 1 results QQ plot of the observed -log10 P-values (y axis) versus the

More information

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was

Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was Supplementary Figure 1. Experimental paradigm. A combination of genome and exome sequencing coupled with array-comparative genome hybridization was performed on a total of 85 SS patients. Data filtration

More information

Supplementary Tables. Supplementary Figures

Supplementary Tables. Supplementary Figures Supplementary Files for Zehir, Benayed et al. Mutational Landscape of Metastatic Cancer Revealed from Prospective Clinical Sequencing of 10,000 Patients Supplementary Tables Supplementary Table 1: Sample

More information

Phenotype prediction based on genome-wide DNA methylation data

Phenotype prediction based on genome-wide DNA methylation data Wilhelm BMC Bioinformatics 2014, 15:193 METHODOLOGY ARTICLE Open Access Phenotype prediction based on genome-wide DNA methylation data Thomas Wilhelm Abstract Background: DNA methylation (DNAm) has important

More information

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies

Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Supplementary note: Comparison of deletion variants identified in this study and four earlier studies Here we compare the results of this study to potentially overlapping results from four earlier studies

More information

SUPPLEMENTARY FIGURES: Supplementary Figure 1

SUPPLEMENTARY FIGURES: Supplementary Figure 1 SUPPLEMENTARY FIGURES: Supplementary Figure 1 Supplementary Figure 1. Glioblastoma 5hmC quantified by paired BS and oxbs treated DNA hybridized to Infinium DNA methylation arrays. Workflow depicts analytic

More information

Measuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16

Measuring DNA Methylation with the MinION. Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Measuring DNA Methylation with the MinION Winston Timp Department of Biomedical Engineering Johns Hopkins University 12/1/16 Epigenetics: Modern Modern Definition of epigenetics involves heritable changes

More information

gliomas. Fetal brain expected who each low-

gliomas. Fetal brain expected who each low- Supplementary Figure S1. Grade-specificity aberrant expression of HOXA genes in gliomas. (A) Representative RT-PCR analyses of HOXA gene expression in human astrocytomas. Exemplified glioma samples include

More information

Supplementary Figures

Supplementary Figures Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )

More information

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS

Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS Breast and ovarian cancer in Serbia: the importance of mutation detection in hereditary predisposition genes using NGS dr sc. Ana Krivokuća Laboratory for molecular genetics Institute for Oncology and

More information

Stage 3 ovarian cancer survival rate

Stage 3 ovarian cancer survival rate Search Stage 3 ovarian cancer survival rate 19-5-2017 If you've been diagnosed with ovarian cancer, it's natural to wonder about your prognosis. Learn about survival rates, outlook, and more. Take the

More information

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng,

Bin Liu, Lei Yang, Binfang Huang, Mei Cheng, Hui Wang, Yinyan Li, Dongsheng Huang, Jian Zheng, The American Journal of Human Genetics, Volume 91 Supplemental Data A Functional Copy-Number Variation in MAPKAPK2 Predicts Risk and Survival of Lung Cancer Bin Liu, Lei Yang, Binfang Huang, Mei Cheng,

More information

Nature Medicine: doi: /nm.4439

Nature Medicine: doi: /nm.4439 Figure S1. Overview of the variant calling and verification process. This figure expands on Fig. 1c with details of verified variants identification in 547 additional validation samples. Somatic variants

More information

Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum

Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Epigenetic Biomarkers of Breast Cancer Risk: Across the Breast Cancer Prevention Continuum Mary Beth Terry, Jasmine A. McDonald, Hui Chen Wu, Sybil Eng and Regina M. Santella Abstract Epigenetic biomarkers,

More information

Global variation in copy number in the human genome

Global variation in copy number in the human genome Global variation in copy number in the human genome Redon et. al. Nature 444:444-454 (2006) 12.03.2007 Tarmo Puurand Study 270 individuals (HapMap collection) Affymetrix 500K Whole Genome TilePath (WGTP)

More information

Stage 3 ovarian cancer survival rate

Stage 3 ovarian cancer survival rate Stage 3 ovarian cancer survival rate Gogamz Menu The latest ovarian cancer survival statistics for the UK for Health Professionals. See data for age, trends over time, stage at diagnosis and more. 5-8-2014

More information

TCGA. The Cancer Genome Atlas

TCGA. The Cancer Genome Atlas TCGA The Cancer Genome Atlas TCGA: History and Goal History: Started in 2005 by the National Cancer Institute (NCI) and the National Human Genome Research Institute (NHGRI) with $110 Million to catalogue

More information

Package MethPed. September 1, 2018

Package MethPed. September 1, 2018 Type Package Version 1.8.0 Date 2016-01-01 Package MethPed September 1, 2018 Title A DNA methylation classifier tool for the identification of pediatric brain tumor subtypes Depends R (>= 3.0.0), Biobase

More information

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel)

(a) Significant biological processes (upper panel) and disease biomarkers (lower panel) Supplementary Figure 1. Functional enrichment analyses of secretomic proteins. (a) Significant biological processes (upper panel) and disease biomarkers (lower panel) 2 involved by hrab37-mediated secretory

More information

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III

Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III Supplementary Materials: Supplementary Figure 1. IDH1 and IDH2 mutation site sequences on WHO grade III patient samples. Genomic DNA samples extracted from punch biopsies from either FFPE or frozen tumor

More information

Forward Looking Statements

Forward Looking Statements Forward Looking Statements Some of the information presented here today may contain projections or other forward-looking statements regarding future events or the future financial performance 15M Patient

More information

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB

AVENIO ctdna Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits The complete NGS liquid biopsy solution EMPOWER YOUR LAB Analysis Kits Next-generation performance in liquid biopsies 2 Accelerating clinical research From liquid biopsy to next-generation

More information

Platform Approach to Cancer Discovery and Diagnostics Development

Platform Approach to Cancer Discovery and Diagnostics Development Platform Approach to Cancer Discovery and Diagnostics Development Joanne Yeakley Staff Manager, Scientific Research Diagnostic Assay Development 2009 Illumina, Inc. All rights reserved. Illumina, illuminadx,

More information

Deregulation of STING Signaling in Colorectal Carcinoma Constrains DNA Damage Responses and Correlates With Tumorigenesis

Deregulation of STING Signaling in Colorectal Carcinoma Constrains DNA Damage Responses and Correlates With Tumorigenesis Cell Reports Supplemental Information Deregulation of STING Signaling in Colorectal Carcinoma Constrains DNA Damage Responses and Correlates With Tumorigenesis Tianli Xia, Hiroyasu Konno, Jeonghyun Ahn,

More information

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer

Dominic J Smiraglia, PhD Department of Cancer Genetics. DNA methylation in prostate cancer Dominic J Smiraglia, PhD Department of Cancer Genetics DNA methylation in prostate cancer Overarching theme Epigenetic regulation allows the genome to be responsive to the environment Sets the tone for

More information

What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine?

What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine? What are the determinants of DNA demethylation following treatment of AML cell lines and patient samples with decitabine? by Robert John Hollows This project is submitted in partial fulfilment of the requirements

More information

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study.

Supplemental Figure 1. Genes showing ectopic H3K9 dimethylation in this study are DNA hypermethylated in Lister et al. study. mc mc mc mc SUP mc mc Supplemental Figure. Genes showing ectopic HK9 dimethylation in this study are DNA hypermethylated in Lister et al. study. Representative views of genes that gain HK9m marks in their

More information

Evaluation of BRCA1/2 and homologous recombination defects in ovarian cancer and impact on clinical outcomes

Evaluation of BRCA1/2 and homologous recombination defects in ovarian cancer and impact on clinical outcomes Evaluation of BRCA1/2 and homologous recombination defects in ovarian cancer and impact on clinical outcomes Melinda S. Yates, PhD Department of Gynecologic Oncology & Reproductive Medicine University

More information

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA

Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) cancer DNA www.impactjournals.com/oncotarget/ Oncotarget, Supplementary Materials 2016 Single-strand DNA library preparation improves sequencing of formalin-fixed and paraffin-embedded (FFPE) DNA Supplementary Materials

More information

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11

p.r623c p.p976l p.d2847fs p.t2671 p.d2847fs p.r2922w p.r2370h p.c1201y p.a868v p.s952* RING_C BP PHD Cbp HAT_KAT11 ARID2 p.r623c KMT2D p.v650fs p.p976l p.r2922w p.l1212r p.d1400h DNA binding RFX DNA binding Zinc finger KMT2C p.a51s p.d372v p.c1103* p.d2847fs p.t2671 p.d2847fs p.r4586h PHD/ RING DHHC/ PHD PHD FYR N

More information

DNA methylation profiling in the Carolina Breast Cancer Study defines cancer subclasses differing in clinicopathologic characteristics and survival

DNA methylation profiling in the Carolina Breast Cancer Study defines cancer subclasses differing in clinicopathologic characteristics and survival Conway et al. Breast Cancer Research 2014, 16:450 RESEARCH ARTICLE Open Access DNA methylation profiling in the Carolina Breast Cancer Study defines cancer subclasses differing in clinicopathologic characteristics

More information

Supplementary Information

Supplementary Information Supplementary Information - chimeric fusion transcript in human gastric cancer promotes tumorigenesis through activation of PI3K/AKT signaling Sun Mi Yun, Kwiyeom Yoon, Sunghoon Lee, Eunjeong Kim, Seong-Ho

More information

SUPPLEMENTAL INFORMATION

SUPPLEMENTAL INFORMATION SUPPLEMENTAL INFORMATION GO term analysis of differentially methylated SUMIs. GO term analysis of the 458 SUMIs with the largest differential methylation between human and chimp shows that they are more

More information

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014

Not IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:

More information

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics

ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics ACE ImmunoID Biomarker Discovery Solutions ACE ImmunoID Platform for Tumor Immunogenomics Precision Genomics for Immuno-Oncology Personalis, Inc. ACE ImmunoID When one biomarker doesn t tell the whole

More information

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep

Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Using the Bravo Liquid-Handling System for Next Generation Sequencing Sample Prep Tom Walsh, PhD Division of Medical Genetics University of Washington Next generation sequencing Sanger sequencing gold

More information

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays

RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Supplementary Materials RASA: Robust Alternative Splicing Analysis for Human Transcriptome Arrays Junhee Seok 1*, Weihong Xu 2, Ronald W. Davis 2, Wenzhong Xiao 2,3* 1 School of Electrical Engineering,

More information

Epigenetics and Chromatin Remodeling

Epigenetics and Chromatin Remodeling Epigenetics and Chromatin Remodeling Bradford Coffee, PhD, FACMG Emory University Atlanta, GA Speaker Disclosure Information Grant/Research Support: none Salary/Consultant Fees: none Board/Committee/Advisory

More information

Interpretation of p53 Immunostains. P53 Mutations are Ubiquitous in High Grade Serous Carcinoma. Diffuse strong positive nuclear staining

Interpretation of p53 Immunostains. P53 Mutations are Ubiquitous in High Grade Serous Carcinoma. Diffuse strong positive nuclear staining Stains for Tumor Classification p53 p16 WT1 HMGA2 P53 Mutations are Ubiquitous in High Grade Serous Carcinoma Source Ahmed et al Australian Ovarian Cancer Study Cancer Genome Atlas Research Network Cases

More information

EVALUATION OF FOLLICULAR ATRESIA AND ELECTROPHORETIC PATTERN OF FOLLICULAR FLUID PROTEINS IN ACYCLIC BUFFALO (Bubalus bubalis)

EVALUATION OF FOLLICULAR ATRESIA AND ELECTROPHORETIC PATTERN OF FOLLICULAR FLUID PROTEINS IN ACYCLIC BUFFALO (Bubalus bubalis) Original Article Buffalo Bulletin (December 2013) Vol.32 No.4 EVALUATION OF FOLLICULAR ATRESIA AND ELECTROPHORETIC PATTERN OF FOLLICULAR FLUID PROTEINS IN ACYCLIC BUFFALO (Bubalus bubalis) F.A. Khan 1,*,

More information

Supplementary Figure 1 Overall study design

Supplementary Figure 1 Overall study design Supplementary Figure 1 Overall study design We obtained 19 tumour specimens from 14 men with prostate cancer who harboured pathogenic germline BRCA2-mutations. Germline DNA was available for five patients

More information

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG)

MEDICAL GENOMICS LABORATORY. Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Peripheral Nerve Sheath Tumor Panel by Next-Gen Sequencing (PNT-NG) Ordering Information Acceptable specimen types: Blood (3-6ml EDTA; no time limitations associated with receipt) Saliva (OGR-575 DNA Genotek;

More information

HHS Public Access Author manuscript Int J Obes (Lond). Author manuscript; available in PMC 2015 November 01.

HHS Public Access Author manuscript Int J Obes (Lond). Author manuscript; available in PMC 2015 November 01. Epigenetic Patterns in Successful Weight Loss Maintainers: A Pilot Study Yen-Tsung Huang, MD, MPH, SM, ScD #1, Jennifer Z.J. Maccani, PhD #2, Nicola L. Hawley, PhD 3,4,5, Rena R. Wing, PhD 3,4, Karl T.

More information

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies

Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Statistical Analysis of Single Nucleotide Polymorphism Microarrays in Cancer Studies Stanford Biostatistics Workshop Pierre Neuvial with Henrik Bengtsson and Terry Speed Department of Statistics, UC Berkeley

More information

Assignment 5: Integrative epigenomics analysis

Assignment 5: Integrative epigenomics analysis Assignment 5: Integrative epigenomics analysis Due date: Friday, 2/24 10am. Note: no late assignments will be accepted. Introduction CpG islands (CGIs) are important regulatory regions in the genome. What

More information

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers

Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Analysis of Massively Parallel Sequencing Data Application of Illumina Sequencing to the Genetics of Human Cancers Gordon Blackshields Senior Bioinformatician Source BioScience 1 To Cancer Genetics Studies

More information

Meaning-based guidance of attention in scenes as revealed by meaning maps

Meaning-based guidance of attention in scenes as revealed by meaning maps SUPPLEMENTARY INFORMATION Letters DOI: 1.138/s41562-17-28- In the format provided by the authors and unedited. -based guidance of attention in scenes as revealed by meaning maps John M. Henderson 1,2 *

More information

Clonal evolution of human cancers

Clonal evolution of human cancers Clonal evolution of human cancers -Pathology-based microdissection and genetic analysis precisely demonstrates molecular evolution of neoplastic clones- Hiroaki Fujii, MD Ageo Medical Laboratories, Yashio

More information

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc.

Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Complete Genomics, Inc. Dr Rick Tearle Senior Applications Specialist, EMEA Complete Genomics Topics Overview of Data Processing Pipeline Overview of Data Files 2 DNA Nano-Ball (DNB) Read Structure Genome : acgtacatgcattcacacatgcttagctatctctcgccag

More information

Supplemental Table 1. Cell Lines used in the CRISPR pooled screen.

Supplemental Table 1. Cell Lines used in the CRISPR pooled screen. Supplemental Table 1. Cell Lines used in the CRISPR pooled screen. 5637_URINARY_TRACT HEC1B_ENDOMETRIUM NCIH1975_LUNG RCCGS_KIDNEY 639V_URINARY_TRACT HPAFII_PANCREAS NCIH1993_LUNG RCCJW_KIDNEY 647V_URINARY_TRACT

More information

Epigenetic drift in aging twins

Epigenetic drift in aging twins Epigenetic drift in aging twins Qihua Tan, MD, PhD Kaare Christensen, MD, PhD Lene Christiansen, PhD Epidemiology, Biostatistics and Biodemography, Institute of Public Health Unit of Human Genetics, Institute

More information

Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers

Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers Zhang et al. BMC Genomics 2014, 15:868 RESEARCH ARTICLE Open Access Comparative DNA methylome analysis of endometrial carcinoma reveals complex and distinct deregulation of cancer promoters and enhancers

More information

Lynch Syndrome Screening for Endometrial Cancer: Basic Concepts 1/16/2017

Lynch Syndrome Screening for Endometrial Cancer: Basic Concepts 1/16/2017 1 Hi, my name is Sarah Kerr. I m a pathologist at Mayo Clinic, where I participate in our high volume Lynch syndrome tumor testing practice. Today I hope to cover some of the basics needed to understand

More information

Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D.

Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Predictive Blood DNA Markers for Breast Cancer Xiang Zhang, Ph.D. Department of Environmental Health University of Cincinnati Background Breast cancer (BCa) The second most common cancer among women in

More information

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols.

Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. Supplementary Figure 1. Schematic diagram of o2n-seq. Double-stranded DNA was sheared, end-repaired, and underwent A-tailing by standard protocols. A-tailed DNA was ligated to T-tailed dutp adapters, circularized

More information

Gentilini et al. Clinical Epigenetics (2018) 10:77

Gentilini et al. Clinical Epigenetics (2018) 10:77 Gentilini et al. Clinical Epigenetics (2018) 10:77 https://doi.org/10.1186/s13148-018-0510-3 RESEARCH Open Access Multifactorial analysis of the stochastic epigenetic variability in cord blood confirmed

More information