Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus
|
|
- Rosalyn Fitzgerald
- 5 years ago
- Views:
Transcription
1 Chen et al. 1 Polycomb protein Ezh2 regulates pancreatic β-cell Ink4a/Arf expression and regeneration in streptozotocin-induced diabetes mellitus Hainan Chen 1, Xueying Gu 1, I-hsin Su 2, Rita Bottino 3, Juan L. Contreras 4, Alexander Tarakhovsky 2, Seung K. Kim 1,5 1 Department of Developmental Biology, Stanford University School of Medicine, Stanford, CA 2 Laboratory of Lymphocyte Signaling, The Rockefeller University, New York, NY 3 Department of Pediatrics, Division of Immunogenetics, Diabetes Institute, University of Pittsburgh, School of Medicine, Pittsburgh, PA 4 Department of Surgery, Division of Transplantation, University of Alabama School of Medicine, Birmingham, AL 5 Department of Medicine, Oncology Division, Stanford University School of Medicine, Stanford, CA Current address: Dept. of Genomics and Genetics, Nanyang Technological University, Singapore Running title: β-cell Ink4a/Arf regulation by Ezh2 Keywords: pancreas; islet of Langerhans; histone; epigenetics; diabetes; cell cycle Supplementary Information Supplementary Tables 1 and 2 Supplementary Figures 1, 2 and 3, and Figure legends
2 Chen et al. 2 Supplementary Tables Table 1. qrt-pcr s used for mouse islet mrna expression assays Gene Forward Probe Reverse Ezh2 5 -GACAAATACATGTGCAGCTTTCTGT 5 -CAACTTGAACAATGATTTTGTGGTG 5 -GCCCTTTCGGGTTGCAT Ezh1 5 -GGATGCTACCCGGAAAGGA 5 -CGCTTTGCAAACCATTCAGTGAACCC 5 -ACCATAACCACTTTGGCATAACAG Suz12 5 -GAAGCTGTGGAACCTCCATGTC 5 -TGAAGCATGGATTTATTGCTGACAA 5 -ACAGCATACAGGCATGATTCATTT Eed 5 -GCGATGGTTAGGCGATTTGAT 5 -TCCAAGTCTTGTGAAAATGCCATT 5 -TTTTGCCAGGTTTCCAGCAT Bmi-1 5 -CAGATTGGATCGGAAAGTAAATAAAGAG 5 -AGCCTAAGGAAGAGGTGAATGATAAAAGGT 5 -TTGCTGCTGGGCATCGTA Phc1 5 -CCCAGCAGAGCAGTTTCGA 5 -TCTAAGAGGTTCTGCTCCATGACGT 5 -CTGCAGCTCACATTGTACCTCTTT Cbx4 5 -TGCTGATCGCCTTCCAGAA 5 -AGGGAAAGGCAGGAGCAGCTGATG 5 -GGGCCCTCTCTTGCGATATC Ink4a 5 -GTACCCCGATTCAGGTGATGA 5 -CGTTCACGTAGCAGCTCTTCTGC 5 -CAGTTCGAATCTGCACCGTAGT Arf 5 -TGAGGCTAGAGAGGATCTTGAGAAG 5 -CCGGAATCCTGGACCAGGTGA 5 -CGTGAACGTTGCCCATCAT Ink4b 5 -GCAGGCCTTCCAAAACTTGA 5 -CCTACCCAGTAAGACAAAGCCAATCAGAAATA 5 -AGCTGCAGAAAATGCGTAGGA Ink4c 5 -AAATAATGTAAACGTCAACGCTCAAA 5 -TGGATTTGGGAGAACTGCGCTGC 5 -CCGGATTTCCAAGTTTCATAACC Ink4d 5 -AGACGGCCTTGCAGGTCAT 5 -CCTGAAGCAAGGTGCCAGCCC 5 -CCGGAGGCATCTTGGACAT p21 Cip1 5 -CCACAGCGATATCCAGACATTC 5 -CCACAGGCACCATGTCCAATCC 5 -CGGAACAGGTCGGACATCA p27 Kip1 5 -CAGACAATCCGGCTGGGTTA 5 -AGGGATGAGGAAGCGACCTGCTG 5 -GCCCTTTTGTTTTGCGAAGA Trp53 5 -CAAAAGAAAAAACCACTTGATGGA 5 -TTCACCCTCAAGATCCGCGGGC 5 -CGGAACATCTCGAAGCGTTTA PPIA 5 -TGCTGGACCAAACACAAACG 5 -TTCCCAGTTTTTTATCTGCACTG 5 -TGCTTGCCATCCAGCCATTCA
3 Chen et al. 3 Table 2. qpcr s used for ChIP analysis on mouse Ink4b and Ink4a/Arf Loci Location Forward Probe Reverse set 1 set 2 set 3 set 4 set 5 Ink4b promoter Arf promoter Ink4a promoter End of exon 1α Between exon 2 and 3 5 -CGACGGGAGGCAGGTTTT 5 -CAAGAGCAAAAATCCTGAAAAACAAAAACGATC 5 -CAATCTAGTGCCGAGGGATGTT 5 -GAGTACAGCAGCGGGAGCAT 5 -TGAGGATTCAGCGCGCGGG 5 -GAACTTCACCAAGAAAACCCTCTCT 5 -GTCCGATCCTTTAGCGCTGTT 5 -ACGCCCAGCTCTCCTCCTGAA 5 -AGCCCGGACTACAGAAGAGATG 5 -CCGGAGCCACCCATTAAACTA 5 -TAGTGAAACCATTTTGGCATCGAG 5 -CAAGACTTCTCAAAAATAAGACACTGAAA 5 -CCCAACACCCACTTGAGGAA 5 -TATATCAGCCTGGAATTTCAGCTCC 5 -CAGAGGTCACAGGCATCGAA
4 Chen et al. 4 Supplementary figure legends Supplementary Fig. 1. Expression of genes encoding Polycomb group factors in pancreatic islets from C57BL/6 mice during aging. Relative mrna levels of Eed, Suz12, Cbx4 and Phc1 in islets from the mice of the indicated ages were determined by real-time RT- PCR. n=3 to 10 mice per time point. Unlike Ezh2, no significant change in the levels of mrna expression of these genes in pancreatic islets was detected during aging. Supplementary Fig. 2. Expression of Ezh2 and genes encoding CDK inhibitors or p53 and the association of H3K9/14Ac and H3K9me3 with the Ink4a/Arf locus in βezh2ko islets. (A) Representative Western blot analysis of the indicated proteins in islets from one-month-old Ezh2 f/f and βezh2ko mice. (B) Relative mrna levels of the indicated CDK inhibitors in isolated islets from one-month-old Ezh2 f/f and βezh2ko mice. n=4 to 10 mice. (C-E) ChIP analysis of the Ink4b and Ink4a/Arf loci using the indicated antibodies in islets isolated from one-month-old control Ezh2 f/f and βezh2ko mice. Three to five independent ChIP experiments were performed for each antibody using separate islet preparations. Supplementary Fig. 3. βezh2ko mice have normal insulin sensitivity and islet insulin secretion function. (A) Mass of βezh2ko and littermate Ezh2 f/f mice during aging. n=11 to 29 for each group at each time point. (B) Glucose tolerance testing and (C) Area under curve (AUC) from (B) performed in 2-month-old mice with glucose injection (2 g/kg body weight). n=3 to 5 mice for each group. Glucose regulation in Ezh2 f/+ ; RipCre mice was indistinguishable from Ezh2 f/f control mice, indicating that the RIP-Cre transgene alone did not impair glucose regulation in vivo. (D) Box-whisker plot showing fasting blood glucose and (E) Glucose tolerance testing performed in 8-month-old mice (3 g/kg body weight glucose). n=5 for each group. (F) Insulin tolerance test performed in one-month-old mice. n=4 mice for each group. Pancreatic islet insulin content (G) and in vitro insulin secretion by glucose (H) or arginine (I)
5 Chen et al. 5 stimulation in one-month-old βezh2ko and Ezh2 f/f mouse islets. No significant difference in islet insulin content and insulin secretion between βezh2ko and control was detected (P>0.05). n=8-30 independent measurements from 4 independent islet preparations per group.
6
7
8
E10.5 E18.5 P2 10w 83w NF1 HF1. Sham ISO. Bmi1. H3K9me3. Lung weight (g)
Myociyte cross-sectional Relative mrna levels Relative levels Relative mrna levels Supplementary Figures and Legends a 8 6 4 2 Ezh2 E1.5 E18.5 P2 1w 83w b Ezh2 p16 amhc b-actin P2 43w kd 37 86 16 wt mouse
More informationZL ZDF ZDF + E2 *** Visceral (g) ZDF
Body Weight (g) 4 3 2 1 ** * ZL ZDF 6 8 1 12 14 16 Age (weeks) B * Sub-cutaneous (g) 16 12 8 4 ZL ZDF Visceral (g) 25 2 15 1 5 ZL ZDF Total fat pad weight (g) 4 3 2 1 ZDF ZL Supplemental Figure 1: Effect
More informationFigure legends Supplemental Fig.1. Glucose-induced insulin secretion and insulin content of islets. Supplemental Fig. 2.
Figure legends Supplemental Fig.. Glucose-induced insulin secretion and insulin content of islets. Insulin secretory responses to.,., and. mm glucose (A) (n = 7-), and the insulin content in the islets
More informationFigure S1A. Blood glucose levels in mice after glucose injection
## Figure S1A. Blood glucose levels in mice after glucose injection Blood glucose (mm/l) 25 2 15 1 5 # 15 3 6 3+3 Time after glucose injection (min) # Figure S1B. α-kg levels in mouse livers after glucose
More informationislets scored 1 week month months
Supplementary Table 1. Sampling parameters for the morphometrical analyses Time (post- DT) Control mice (age-matched) α-cells mice pancreatic surface (mm 2 ) scored DT-treated mice islets scored mice pancreatic
More information7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans.
Supplementary Figure 1 7SK ChIRP-seq is specifically RNA dependent and conserved between mice and humans. Regions targeted by the Even and Odd ChIRP probes mapped to a secondary structure model 56 of the
More informationComparison of open chromatin regions between dentate granule cells and other tissues and neural cell types.
Supplementary Figure 1 Comparison of open chromatin regions between dentate granule cells and other tissues and neural cell types. (a) Pearson correlation heatmap among open chromatin profiles of different
More informationSupplementary Information. Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase
Journal: Nature Medicine Supplementary Information Induction of human pancreatic beta cell replication by inhibitors of dual specificity tyrosine regulated kinase 1,2 Peng Wang PhD, 1,2 Juan-Carlos Alvarez-Perez
More informationSupplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 )
770 771 Supplementary Table 1. The primers used for quantitative RT-PCR. Gene name Forward (5 > 3 ) Reverse (5 > 3 ) Human CXCL1 GCGCCCAAACCGAAGTCATA ATGGGGGATGCAGGATTGAG PF4 CCCCACTGCCCAACTGATAG TTCTTGTACAGCGGGGCTTG
More informationRole and Regulation of Cdk Inhibitors in Development and Cancer Prof. Martine F. Roussel, PhD
Role and Regulation of Cdk Inhibitors in Dept. of Genetics & Tumor Cell Biology St. Jude Children s Research Hospital Memphis, Tennessee USA 1 2 Somatic cell cycles Cdk1/Cyclin B M G2 Cdk1/Cyclin A Quiescence
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1. Confirmation of Dnmt1 conditional knockout out mice. a, Representative images of sorted stem (Lin - CD49f high CD24 + ), luminal (Lin - CD49f low CD24 + )
More informationSupplementary Figure 1. ETBF activate Stat3 in B6 and Min mice colons
Supplementary Figure 1 ETBF activate Stat3 in B6 and Min mice colons a pstat3 controls Pos Neg ETBF 1 2 3 4 b pstat1 pstat2 pstat3 pstat4 pstat5 pstat6 Actin Figure Legend: (a) ETBF induce predominantly
More informationAn excessive increase in glutamate contributes to glucose-toxicity in. β-cells via activation of pancreatic NMDA receptors in rodent diabetes
An excessive increase in glutamate contributes to glucose-toxicity in β-cells via activation of pancreatic NMDA receptors in rodent diabetes Xiao-Ting Huang 1, Chen Li 1,3, Xiang-Ping Peng 1, Jia Guo 1,5,
More informationA cullin 4B-RING E3 ligase complex fine-tunes pancreatic d cell paracrine interactions
A cullin 4B-RING E3 ligase complex fine-tunes pancreatic d cell paracrine interactions Qing Li,, Yaoqin Gong, Xiao Yu J Clin Invest. 2017;127(7):2631-2646. https://doi.org/10.1172/jci91348. Research Article
More informationTcf21 MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W. Postn MCM ; R26 mtmg Sham GFP Col 1/3 TAC 8W TAC 2W
A Tcf21 MCM ; R26 mtmg Sham GFP Col 1/3 Tcf21 MCM ; R26 mtmg TAC 2W Tcf21 MCM ; R26 mtmg TAC 8W B Postn MCM ; R26 mtmg Sham GFP Col 1/3 Postn MCM ; R26 mtmg TAC 2W Postn MCM ; R26 mtmg TAC 8W Supplementary
More informationTranscription factor Foxp3 and its protein partners form a complex regulatory network
Supplementary figures Resource Paper Transcription factor Foxp3 and its protein partners form a complex regulatory network Dipayan Rudra 1, Paul deroos 1, Ashutosh Chaudhry 1, Rachel Niec 1, Aaron Arvey
More informationNature Immunology: doi: /ni Supplementary Figure 1. Huwe1 has high expression in HSCs and is necessary for quiescence.
Supplementary Figure 1 Huwe1 has high expression in HSCs and is necessary for quiescence. (a) Heat map visualizing expression of genes with a known function in ubiquitin-mediated proteolysis (KEGG: Ubiquitin
More informationTable S1. Primer sequences used for qrt-pcr. CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT ACTB AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT LCOR
Table S1. Primer sequences used for qrt-pcr. ACTB LCOR KLF6 CTBP1 CDKN1A CDH1 ATF3 PLAU MMP9 TFPI2 CACCATTGGCAATGAGCGGTTC AGGTCTTTGCGGATGTCCACGT AAGTCCATGTGCTGGCAGCACT ATCACCACTCCGAAGTCCGTCT CGGCTGCAGGAAAGTTTACA
More informationSupplementary Figure 1.
Supplementary Figure 1. Female Pro-ins2 -/- mice at 5-6 weeks of age were either inoculated i.p. with a single dose of CVB4 (1x10 5 PFU/mouse) or PBS and treated with αgalcer or control vehicle. On day
More informationSupplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung
Supplementary Figure 1. A. Bar graph representing the expression levels of the 19 indicated genes in the microarrays analyses comparing human lung immortalized broncho-epithelial cells (AALE cells) expressing
More informationIslets of Langerhans consist mostly of insulin-producing β cells. They will appear to be densely labeled
Are adult pancreatic beta cells formed by self-duplication or stem cell differentiation? Introduction Researchers have long been interested in how tissues produce and maintain the correct number of cells
More informationSupplementary methods:
Supplementary methods: Primers sequences used in real-time PCR analyses: β-actin F: GACCTCTATGCCAACACAGT β-actin [11] R: AGTACTTGCGCTCAGGAGGA MMP13 F: TTCTGGTCTTCTGGCACACGCTTT MMP13 R: CCAAGCTCATGGGCAGCAACAATA
More informationMPB333:Molecular Endocrinology of Obesity and Diabetes
MPB333:Molecular Endocrinology of Obesity and Diabetes The Use of Stem Cells as a Cure for Type 1 Diabetes January 15, 2010 Trish Labosky 9415C MRBIV trish.labosky@vanderbilt.edu In theory. 2. ~Easy and
More informationControlled induction of human pancreatic progenitors produces functional beta-like cells in vitro.
Manuscript EMBO-2015-91058 Controlled induction of human pancreatic progenitors produces functional beta-like cells in vitro. Holger A Russ, Audrey V Parent, Jennifer J Ringler, Thomas G Hennings, Gopika
More informationNot IN Our Genes - A Different Kind of Inheritance.! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014
Not IN Our Genes - A Different Kind of Inheritance! Christopher Phiel, Ph.D. University of Colorado Denver Mini-STEM School February 4, 2014 Epigenetics in Mainstream Media Epigenetics *Current definition:
More informationSupplementary Figures
Supplementary Figures Supplementary Figure 1 DOT1L regulates the expression of epithelial and mesenchymal markers. (a) The expression levels and cellular localizations of EMT markers were confirmed by
More informationSupplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63.
Supplementary Figure Legends Supplementary Figure S1. Gene expression analysis of epidermal marker genes and TP63. A. Screenshot of the UCSC genome browser from normalized RNAPII and RNA-seq ChIP-seq data
More informationControl of Glucose Metabolism
Glucose Metabolism Control of Glucose Metabolism The pancreas is both an exocrine and endocrine gland. It secretes digestive enzymes into the duodenum (exocrine) and 3 specific hormones into the bloodstream
More informationAmniotic fluid stem cells provide considerable advantages in epidermal. regeneration: B7H4 creates a moderate inflammation
Amniotic fluid stem cells provide considerable advantages in epidermal regeneration: B7H4 creates a moderate inflammation microenvironment to promote wound repair Qing Sun 1, +, Fang Li 1, +, Hong Li 2,
More informationSupplementary Figure 1. Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Nature Immunology: doi: /ni.
Supplementary Figure 1 Efficiency of Mll4 deletion and its effect on T cell populations in the periphery. Expression of Mll4 floxed alleles (16-19) in naive CD4 + T cells isolated from lymph nodes and
More informationNature Structural & Molecular Biology: doi: /nsmb Supplementary Figure 1
Supplementary Figure 1 Effect of HSP90 inhibition on expression of endogenous retroviruses. (a) Inducible shrna-mediated Hsp90 silencing in mouse ESCs. Immunoblots of total cell extract expressing the
More informationSupplementary Figure S1. Generation of LSL-EZH2 conditional transgenic mice.
Downstream Col1A locus S P P P EP Genotyping with P1, P2 frt PGKneopA + frt hygro-pa Targeting vector Genotyping with P3, P4 P1 pcag-flpe P2 P3 P4 frt SApA CAG LSL PGKATG frt hygro-pa C. D. E. ormal KRAS
More informationThe autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep
SUPPLEMENTARY INFORMATION The autoimmune disease-associated PTPN22 variant promotes calpain-mediated Lyp/Pep degradation associated with lymphocyte and dendritic cell hyperresponsiveness Jinyi Zhang, Naima
More informationSupplementary Table 1. List of primers used in this study
Supplementary Table 1. List of primers used in this study Gene Forward primer Reverse primer Rat Met 5 -aggtcgcttcatgcaggt-3 5 -tccggagacacaggatgg-3 Rat Runx1 5 -cctccttgaaccactccact-3 5 -ctggatctgcctggcatc-3
More informationPlasma exposure levels from individual mice 4 hours post IP administration at the
Supplemental Figure Legends Figure S1. Plasma exposure levels of MKC-3946 in mice. Plasma exposure levels from individual mice 4 hours post IP administration at the indicated dose mg/kg. Data represent
More informationSupplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.
Supplementary Figure 1: Attenuation of association signals after conditioning for the lead SNP. a) attenuation of association signal at the 9p22.32 PCOS locus after conditioning for the lead SNP rs10993397;
More informationEpigene.cs: What is it and how it effects our health? Overview. Dr. Bill Stanford, PhD OFawa Hospital Research Ins.tute University of OFawa
Epigene.cs: What is it and how it effects our health? Dr. Bill Stanford, PhD OFawa Hospital Research Ins.tute University of OFawa Overview Basic Background Epigene.cs in general Epigene.cs in cancer Epigene.cs
More informationNature Immunology: doi: /ni Supplementary Figure 1. Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice.
Supplementary Figure 1 Gene expression profile of CD4 + T cells and CTL responses in Bcl6-deficient mice. (a) Gene expression profile in the resting CD4 + T cells were analyzed by an Affymetrix microarray
More informationPotentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC
Supplementary information Potentiation of Glucose-stimulated Insulin Secretion by the GPR40 PLC TRPC Pathway in Pancreatic -Cells Authors: Hodaka Yamada 1,*, Masashi Yoshida 1,*, Kiyonori Ito 1, Katsuya
More informationSupplemental methods. Total RNA was extracted from the stomach, liver, pancreas, pituitary, and
Supplemental methods Real-time quantitative RT-PCR and Semi-quantitative PCR Total RNA was extracted from the stomach, liver, pancreas, pituitary, and hypothalamus as previously described (). Primers and
More informationNature Immunology: doi: /ni Supplementary Figure 1. Characteristics of SEs in T reg and T conv cells.
Supplementary Figure 1 Characteristics of SEs in T reg and T conv cells. (a) Patterns of indicated transcription factor-binding at SEs and surrounding regions in T reg and T conv cells. Average normalized
More informationSUPPLEMENTARY INFORMATION
DOI:.3/ncb7 Hematopoiesis Expression (Protein) Competition PRC integration Polycomb-mediated gene repression Cell fate HSC PRC SELF-RENEWAL Cbx Cbx4 PRC progenitor genes PROG Cbx PRC Cbx4 DIFFERENTIATION
More informationSupplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity.
Supplementary Figure 1. DNA methylation of the adiponectin promoter R1, Pparg2, and Tnfa promoter in adipocytes is not affected by obesity. (a) Relative amounts of adiponectin, Ppar 2, C/ebp, and Tnf mrna
More informationA novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets
Diabetologia () 5:77 DOI.7/s5--- SHORT COMMUNICATION A novel role for vitamin D: modulation of expression and function of the local renin angiotensin system in mouse pancreatic islets Q. Cheng & Y. C.
More informationPharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma
Supplementary information for: Pharmacologic inhibition of histone demethylation as a therapy for pediatric brainstem glioma Rintaro Hashizume 1, Noemi Andor 2, Yuichiro Ihara 2, Robin Lerner 2, Haiyun
More informationlncrna Functional Networks in Oligodendrocytes Reveal Stage-Specific Myelination Control by an lncol1/suz12 Complex in the CNS
Article lncrna Functional Networks in Oligodendrocytes Reveal Stage-Specific Myelination Control by an lncol1/suz12 Complex in the CNS Highlights d d d d Transcriptome reconstruction reveals a dynamic
More informationSupplementary Information. PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small
Sato T, et al. Supplementary Information PRC2 overexpression and PRC2-target gene repression relating to poorer prognosis in small cell lung cancer Teruyuki Sato 1,2, Atsushi Kaneda 1,3,4 *, Shingo Tsuji
More informationTGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement
Supplementary Information Title: TGF-β Signaling Regulates Neuronal C1q Expression and Developmental Synaptic Refinement Authors: Allison R. Bialas and Beth Stevens Supplemental Figure 1. In vitro characterization
More informationFOLLICULAR LYMPHOMA- ILLUMINA METHYLATION. Jude Fitzgibbon
FOLLICULAR LYMPHOMA- ILLUMINA METHYLATION Jude Fitzgibbon j.fitzgibbon@qmul.ac.uk Molecular Predictors of Clinical outcome Responders Alive Non-responders Dead TUMOUR GENETICS Targeted therapy, Prognostic
More informationOnline Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h)
Online Appendix Material and Methods: Pancreatic RNA isolation and quantitative real-time (q)rt-pcr. Mice were fasted overnight and killed 1 hour (h) after feeding. A small slice (~5-1 mm 3 ) was taken
More informationSupplementary Figure 1
Supplementary Figure 1 Control Pancreatitis Supplementary Figure 2 A Panc Liver SI Spleen H 2 O B EZH2 fl/fl C EZH2 fl/fl 37bp EZH2 ERK2 D E 5 EZH2 fl/fl Fasting Glucose (mg/dl) 2 18 16 14 12 1 8 6 4 2
More informationSupplemental Material for:
Supplemental Material for: Transcriptional silencing of γ-globin by BCL11A involves long-range interactions and cooperation with SOX6 Jian Xu, Vijay G. Sankaran, Min Ni, Tobias F. Menne, Rishi V. Puram,
More informationSupplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion.
Supplementary Figure 1. Blood glucose and insulin levels in mice during 4-day infusion. (A-B) WT and HT mice infused with saline or glucose had overlapping achieved blood glucose and insulin levels, necessitating
More informationSupplementary Table 1. Metabolic parameters in GFP and OGT-treated mice
Supplementary Table 1. Metabolic parameters in GFP and OGT-treated mice Fasted Refed GFP OGT GFP OGT Liver G6P (mmol/g) 0.03±0.01 0.04±0.02 0.60±0.04 0.42±0.10 A TGs (mg/g of liver) 20.08±5.17 16.29±0.8
More informationSupplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained
Supplementary Figure 1. Dynamic Response of WT and mir-21 -/- mice to caerulein. (a) Representative histological sections of mouse pancreas stained with hematoxylin from caerulein-treated WT and mir-21
More informationSupplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle.
Supplementary Figure 1. DJ-1 modulates ROS concentration in mouse skeletal muscle. (a) mrna levels of Dj1 measured by quantitative RT-PCR in soleus, gastrocnemius (Gastroc.) and extensor digitorum longus
More informationRegulation of p16 INK4A
Regulation of p16 INK4A The Cyclin Dependent Kinase Inhibitor & the Tumor Suppressor Gözde Işık Master Thesis Cancer Genomics and Developmental Biology Masters May-2009 Supervised by Dr. Inge The Department
More informationFigures S1-S5, Figure Legends, Table S1 List of primers used in the study
Insulin receptor alternative splicing is regulated by insulin signaling and modulates beta cell survival Pushkar Malakar,4, Lital Chartarifsky,4, Ayat Hija, Gil Leibowitz 3, Benjamin Glaser 3, Yuval Dor,
More informationHistone H3K9 methyltransferase G9a represses PPARc expression and adipogenesis
The EMBO Journal (2013) 32, 45 59 www.embojournal.org Histone H3K9 methyltransferase G9a represses PPARc expression and adipogenesis THE EMBO JOURNAL Lifeng Wang 1, Shiliyang Xu 1,2, Ji-Eun Lee 1, Anne
More informationSUPPLEMENTARY INFORMATION
doi:.38/nature8975 SUPPLEMENTAL TEXT Unique association of HOTAIR with patient outcome To determine whether the expression of other HOX lincrnas in addition to HOTAIR can predict patient outcome, we measured
More informationSUPPLEMENTARY DATA. Supplementary Table 1. Primers used in qpcr
Supplementary Table 1. Primers used in qpcr Gene forward primer (5'-3') reverse primer (5'-3') β-actin AGAGGGAAATCGTGCGTGAC CAATAGTGATGACCTGGCCGT Hif-p4h-2 CTGGGCAACTACAGGATAAAC GCGTCCCAGTCTTTATTTAGATA
More informationThe controversial role of the Polycomb group proteins in transcription and cancer: how much do we not understand Polycomb proteins?
REVIEW ARTICLE The controversial role of the Polycomb group proteins in transcription and cancer: how much do we not understand Polycomb proteins? Andrea Scelfo, Andrea Piunti and Diego Pasini Department
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12215 Supplementary Figure 1. The effects of full and dissociated GR agonists in supporting BFU-E self-renewal divisions. BFU-Es were cultured in self-renewal medium with indicated GR
More informationMaternal diet induced micrornas and mtor underlie b cell dysfunction in offspring
Maternal diet induced micrornas and mtor underlie b cell dysfunction in offspring Emilyn U. Alejandro,, Peter Arvan, Ernesto Bernal- Mizrachi J Clin Invest. 2014;124(10):4395-4410. https://doi.org/10.1172/jci74237.
More informationImproving Diabetes Research: Moving Beyond Animal Models. Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D.
Improving Diabetes Research: Moving Beyond Animal Models Charu Chandrasekera, Ph.D. Anne Bunner, Ph.D. July 19, 2014 From Bench-to-Bedside Sulfonylurea Biguanide Dipeptidyl peptidase-4 inhibitor Glucagon-like
More informationDioxin induces Ahr-dependent robust DNA demethylation of the Cyp1a1 promoter via Tdg in the mouse liver
Dioxin induces Ahr-dependent robust DNA demethylation of the Cypa promoter via Tdg in the mouse liver Hesbon Z. Amenya, Chiharu Tohyama, Seiichiroh Ohsako Laboratory of Environmental Health Sciences, Center
More informationSUPPLEMENTARY FIGURES
SUPPLEMENTARY FIGURES 1 Supplementary Figure 1, Adult hippocampal QNPs and TAPs uniformly express REST a-b) Confocal images of adult hippocampal mouse sections showing GFAP (green), Sox2 (red), and REST
More informationSupplementary Materials for
www.sciencesignaling.org/cgi/content/full/8/407/ra127/dc1 Supplementary Materials for Loss of FTO in adipose tissue decreases Angptl4 translation and alters triglyceride metabolism Chao-Yung Wang,* Shian-Sen
More informationGlucose Homeostasis. Liver. Glucose. Muscle, Fat. Pancreatic Islet. Glucose utilization. Glucose production, storage Insulin Glucagon
Glucose Homeostasis Liver Glucose Glucose utilization Glucose production, storage Insulin Glucagon Muscle, Fat Pancreatic Islet Classification of Diabetes Type 1 diabetes Type 2 diabetes Other types of
More informationSupplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies
Supplemental Table 1 Primer sequences (mouse) used for real-time qrt-pcr studies Gene symbol Forward primer Reverse primer ACC1 5'-TGAGGAGGACCGCATTTATC 5'-GCATGGAATGGCAGTAAGGT ACLY 5'-GACACCATCTGTGATCTTG
More informationEPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH
EPIGENETIC RE-EXPRESSION OF HIF-2α SUPPRESSES SOFT TISSUE SARCOMA GROWTH Supplementary Figure 1. Supplementary Figure 1. Characterization of KP and KPH2 autochthonous UPS tumors. a) Genotyping of KPH2
More informationTITLE: Insight Into Skin Tumorigenesis Highlighting the Function of Epigenetic Regulators in SCC Formation
AD Award Number: W81XWH-12-1-0463 TITLE: Insight Into Skin Tumorigenesis Highlighting the Function of Epigenetic Regulators in SCC Formation PRINCIPAL INVESTIGATOR: Jisheng Zhang CONTRACTING ORGANIZATION:
More informationSupplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells
Supplementary Figure S1: Defective heterochromatin repair in HGPS progeroid cells Immunofluorescence staining of H3K9me3 and 53BP1 in PH and HGADFN003 (HG003) cells at 24 h after γ-irradiation. Scale bar,
More informationSupplemental Figure 1
Supplemental Figure 1 1a 1c PD-1 MFI fold change 6 5 4 3 2 1 IL-1α IL-2 IL-4 IL-6 IL-1 IL-12 IL-13 IL-15 IL-17 IL-18 IL-21 IL-23 IFN-α Mut Human PD-1 promoter SBE-D 5 -GTCTG- -1.2kb SBE-P -CAGAC- -1.kb
More informationSOPten flox/flox (KO) Pten flox/flox (WT) flox allele 6.0 kb. Pten. Actin. ! allele 2.3 kb. Supplementary Figure S1. Yanagi, et al.
s1 A Pten flox/flox () SOPten flox/flox () flox allele 6. kb B Pten flox/flox () SOPten flox/flox () Pten Actin! allele 2.3 kb Supplementary Figure S1. Yanagi, et al. A B BrdU BrdU positive cells ( ) 3
More informationSupplementary Information
Supplementary Information Supplementary Figure 1! a! b! Nfatc1!! Nfatc1"! P1! P2! pa1! pa2! ex1! ex2! exons 3-9! ex1! ex11!!" #" Nfatc1A!!" Nfatc1B! #"!" Nfatc1C! #" DN1! DN2! DN1!!A! #A!!B! #B!!C! #C!!A!
More informationSoluble ADAM33 initiates airway remodeling to promote susceptibility for. Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David I Wilson,
Revised Suppl. Data: Soluble ADAM33 1 Soluble ADAM33 initiates airway remodeling to promote susceptibility for allergic asthma in early life Elizabeth R. Davies, Joanne F.C. Kelly, Peter H. Howarth, David
More informationSupplemental Information. Menin Deficiency Leads to Depressive-like. Behaviors in Mice by Modulating. Astrocyte-Mediated Neuroinflammation
Neuron, Volume 100 Supplemental Information Menin Deficiency Leads to Depressive-like Behaviors in Mice by Modulating Astrocyte-Mediated Neuroinflammation Lige Leng, Kai Zhuang, Zeyue Liu, Changquan Huang,
More informationGenome Control in Cell Identity and Disease! Development and cell identity Loss of cell identity and disease New diagnostics and therapeutics
Genome Control in Cell Identity and Disease! Development and cell identity Loss of cell identity and disease New diagnostics and therapeutics Development and cell identity! 30,000,000,000 cells!! Control
More informationSupplemental Information. NRF2 Is a Major Target of ARF. in p53-independent Tumor Suppression
Molecular Cell, Volume 68 Supplemental Information NRF2 Is a Major Target of ARF in p53-independent Tumor Suppression Delin Chen, Omid Tavana, Bo Chu, Luke Erber, Yue Chen, Richard Baer, and Wei Gu Figure
More informationSupplementary Materials for
advances.sciencemag.org/cgi/content/full/1/8/e1500296/dc1 Supplementary Materials for Transcriptional regulation of APOBEC3 antiviral immunity through the CBF- /RUNX axis This PDF file includes: Brett
More informationFigure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow
Figure S1 (A) Comparison of body weight and blood glucose levels in male wild-type (WT) and Cre littermates. Mice were maintained on a normal chow diet (n = 7 per genotype). Body weight and fed blood glucose
More informationAn Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice
An Unexpected Function of the Prader-Willi Syndrome Imprinting Center in Maternal Imprinting in Mice Mei-Yi Wu 1 *, Ming Jiang 1, Xiaodong Zhai 2, Arthur L. Beaudet 2, Ray-Chang Wu 1 * 1 Department of
More informationSupplementary Information Titles Journal: Nature Medicine
Supplementary Information Titles Journal: Nature Medicine Article Title: Corresponding Author: Supplementary Item & Number Supplementary Fig.1 Fig.2 Fig.3 Fig.4 Fig.5 Fig.6 Fig.7 Fig.8 Fig.9 Fig. Fig.11
More informationEndocrine System Objectives
Component 3-Terminology in Healthcare and Public Health Settings Unit 7- Endocrine System Lecture 7a-Overview of the Endocrine System, Adrenal Glands and Pancreas This material was developed by The University
More informationSupplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were
Supplementary Figure 1. mrna targets were found in exosomes and absent in free-floating supernatant. Serum exosomes and exosome-free supernatant were separated via ultracentrifugation and lysed to analyze
More informationSupplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets
Supplementary Table 1. Primer sequences for conventional RT-PCR on mouse islets Gene 5 Forward 3 5 Reverse 3.T. Product (bp) ( C) mnox1 GTTCTTGGGCTGCCTTGG GCTGGGGCGGCGG 60 300 mnoxa1 GCTTTGCCGCGTGC GGTTCGGGTCCTTTGTGC
More informationSupplementary Figure 1 IL-27 IL
Tim-3 Supplementary Figure 1 Tc0 49.5 0.6 Tc1 63.5 0.84 Un 49.8 0.16 35.5 0.16 10 4 61.2 5.53 10 3 64.5 5.66 10 2 10 1 10 0 31 2.22 10 0 10 1 10 2 10 3 10 4 IL-10 28.2 1.69 IL-27 Supplementary Figure 1.
More informationSupplementary Figure 1.
Supplementary Figure 1. FGF21 does not exert direct effects on hepatic glucose production. The liver explants from C57BL/6J mice (A, B) or primary rat hepatocytes (C, D) were incubated with rmfgf21 (2
More informationHistone modifications in kidney disease
Histone modifications in kidney disease Masaomi Nangaku Division of Nephrology and Endocrinology The University of Tokyo Graduate School of Medicine Japan Mimura, Tanaka, & Nangaku. Semin Nephrol 2013
More informationGeneral Laboratory methods Plasma analysis: Gene Expression Analysis: Immunoblot analysis: Immunohistochemistry:
General Laboratory methods Plasma analysis: Plasma insulin (Mercodia, Sweden), leptin (duoset, R&D Systems Europe, Abingdon, United Kingdom), IL-6, TNFα and adiponectin levels (Quantikine kits, R&D Systems
More informationSupplementary Materials for. c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration
Supplementary Materials for c-abl Activation Plays a Role in α-synucleinopathy Induced Neurodegeneration Saurav Brahmachari, Preston Ge, Su Hyun Lee, Donghoon Kim, Senthilkumar S. Karuppagounder, Manoj
More informationSupplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic
Supplementary Figure 1: Expression of NFAT proteins in Nfat2-deleted B cells (a+b) Protein expression of NFAT2 (a) and NFAT1 (b) in isolated splenic B cells from WT Nfat2 +/+, TCL1 Nfat2 +/+ and TCL1 Nfat2
More information1.5 ASK1KO fed. fasted 16 hrs w/o water. Fed. 4th. 4th WT ASK1KO N=29, 11(WT), ,5(ASK1KO) ASK1KO ASK1KO **** Time [h]
7: 13: 19: 1: 7: 151117 a 151117 4th 4th b c RQ.95 KO.9.85.8.75.7 light dark light dark.65 7: 19: 7: 19: 7: Means ± SEM, N=6 RQ 1..9.8.7.6.6 KO CL (-) CL (+) ibat weight ratio (/body weight) [%].5.4.3.2.1
More informationSupplementary Information
Supplementary Information TABLE S1. SUBJECT CHARACTERISTICS* Normal Control Subjects Subjects with Asthma p Value Number 23 48 Age (years) 35±10 35±10 0.75 Sex, M:F (% F) 9:12 (57) 17:26 (60) 0.76 FEV1
More informationNature Medicine: doi: /nm.4324
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Supplementary Figure 1. Kinetics of SnCs development in surgically-induced OA and effect of GCV-induced SnC clearance on OA disease progression
More informationEndocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes
Endocannabinoid-activated Nlrp3 inflammasome in infiltrating macrophages mediates β- cell loss in type 2 diabetes T Jourdan, G Godlewski, R Cinar, A Bertola, G Szanda, J Liu, J Tam, T Han, B Mukhopadhyay,
More informationDuctal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids
Ductal pancreatic cancer modeling and drug screening using human pluripotent stem cell and patient-derived tumor organoids Ling Huang 1, Audrey Holtzinger 1,2,11, Ishaan Jagan 1,11, Michael BeGora 1, Ines
More informationSUPPLEMENTARY INFORMATION
doi:10.1038/nature12652 Supplementary Figure 1. PRDM16 interacts with endogenous EHMT1 in brown adipocytes. Immunoprecipitation of PRDM16 complex by flag antibody (M2) followed by Western blot analysis
More informationSupporting Information Table of Contents
Supporting Information Table of Contents Supporting Information Figure 1 Page 2 Supporting Information Figure 2 Page 4 Supporting Information Figure 3 Page 5 Supporting Information Figure 4 Page 6 Supporting
More information