Evaluation of DNA methylation status at differentially methylated regions in IVF-conceived newborn twins

Transcription

1 Evaluation of DNA methylation status at differentially methylated regions in IVF-conceived newborn twins Lei Li, M.D., a Liya Wang, Ph.D., a Fang Le, M.D., a Xiaozhen Liu, M.D., a Ping Yu, Ph.D., b Jiangzhong Sheng, Ph.D., c Hefeng Huang, M.D., a and Fan Jin, M.D. a a Center of Reproductive Medicine, Women s Hospital, School of Medicine, Zhejiang University, b Department of Medical Genetics, School of Medicine, Zhejiang University, and c Department of Pathophysiology, School of Medicine, Zhejiang University, Hangzhou, Zhejiang, People s Republic of China Objective: To examine the effect of assisted reproductive technology on the stability of DNA methylation at differentially methylated regions (DMRs) in twins conceived by IVF. Design: Prospective clinical observational study. Setting: IVF center, university-affiliated teaching hospital. Patient(s): Fifty-nine pairs of twins were recruited, including 29 pairs conceived through IVF and 30 pairs of naturally conceived twins. Intervention(s): Collection of umbilical cord blood samples. Main Outcome Measure(s): DNA was extracted from umbilical cord blood. Two maternally methylated regions (KvDMR1 and PEG1) and one paternally methylated region (H19/IGF2 DMR) were analyzed using bisulfitebased technologies. Result(s): Although H19/IGF2 DMR and KvDMR1 showed slightly more variable levels of methylation in IVF cases than in spontaneous cases, methylation indices did not reveal significant differences at three DMRs between IVF-conceived and naturally conceived twins. Conclusion(s): Our results suggest no significant increase in imprint variability at these DMRs, but the greater variance in the IVF twins has a biologically meaningful consequence and may be a topic for future investigation. Large cohorts are needed to systematically assess the potential epigenetic risk in twins conceived with IVF. (Fertil Steril Ò 2011;95: Ó2011 by American Society for Reproductive Medicine.) Key Words: Assisted reproductive technology, ART, differentially methylated regions, DMRs, in vitro fertilization, IVF, twins Genomic imprinting is an epigenetic phenomenon in which certain genes are expressed in a manner specific to the parent of origin (1). Approximately 80% of imprinted genes are physically linked in clusters with other imprinted genes, and their expression is controlled by common differentially methylated regions (DMRs) and other common regulatory elements (2). Imprint resetting involves erasure of imprints in the primordial germ cells and the acquisition of new, sex-specific imprints during the later germ cell stages. Upon fertilization, genome-wide demethylation occurs followed by a wave of de novo methylation; these epigenetic patterns are usually maintained during development. However, a growing number of studies have suggested that assisted reproductive technologies (ARTs) such as IVF and intracytoplasmic sperm injection (ICSI), both of which involve hormonal stimulation in women to obtain sufficient amounts of mature oocytes followed by in vitro zygotic activation and early cell division might have an influence Received October 9, 2010; revised January 13, 2011; accepted January 31, 2011; published online March 21, Supported by the National Basic Research Program of China, the National Natural Science Foundation of China and the Natural Science Foundation Projects of Zhejiang Province (grant numbers 2007CB948104, , Z207021, and Y ). L.L. has nothing to disclose. L.W. has nothing to disclose. F.L. has nothing to disclose. X.L. has nothing to disclose. P.Y. has nothing to disclose. J.S. has nothing to disclose. H.H. has nothing to disclose. F.J. has nothing to disclose. Reprint requests: Fan Jin, M.D., Women s Hospital, School of Medicine, Zhejiang University, Xueshi Road, Hangzhou, , People s Republic of China ( jinfan@zju.edu.cn). on the zygotic epigenome. Inadequate epigenetic programming, especially improper methylation at one or more DMRs is responsible for some imprinting disorders such as Angelman s syndrome, Beckwith-Wiedemann syndrome (BWS), and Silver-Russell syndrome (3, 4). Some studies have found a more than threefold increased incidence of BWS among children conceived by ART (5), which was further supported by a British survey (6, 7). Gomes et al. (8) demonstrated that there was abnormal methylation at KvDMR1 in clinically normal children conceived by ART (8). Currently, 87.9% of IVF cycles involve the transfer of two or more embryos. The proportion of twin and triplet deliveries after IVF (with or without ICSI) is more than 20.8% (9). Meanwhile, IVF twins were found by McDonald (10) to have an increased risk of preterm birth between 32 and 36 weeks gestation compared with spontaneously conceived twins. An investigation by Ombelet et al. (11) suggested that twin pregnancies resulting from controlled ovarian stimulation along with artificial insemination produced increased rates of neonatal mortality, assisted ventilation, and respiratory distress syndrome. After excluding same-sex twin sets, these twin pregnancies were at increased risk of extreme prematurity and very low birth weight. Twins conceived by ICSI were also observed to have an increased risk of prematurity, low birth weight, and higher perinatal mortality compared with a natural conception control group. To date, no study has addressed the question of whether there exists the same or higher vulnerability for DNA methylation or an increased susceptibility of some genes to epigenetic alterations in ART twins as observed in ART singletons. Therefore, the aim of /$36.00 Fertility and Sterility â Vol. 95, No. 6, May doi: /j.fertnstert Copyright ª2011 American Society for Reproductive Medicine, Published by Elsevier Inc.

2 TABLE 1 Differentially methylated regions and primer sequences used for bisulfite sequencing. Gene Primer sequences (from 5 0 to 3 0 ) PCR (bp) CpG numbers H19/IGF2 DMR 5 0 -TATGGGTATTTTTGGAGGTTTTTT AAATCCCAAACCATAACACTAAAAC PEG AGTTGGGGTTGTTTTTGG TACCAAAATCTAAAAATCCCAATT KvDMR1 outer 5 0 -GTTTTTTGTTAGGTGGGTGGTTTG TTACTAAAAAACTCCCTAAAAATCC-3 0 KvDMR1 inner 5 0 -GTGGTGAATATATTAYGTAGAGAATTGGTT TTCTACCTAAAAACTACRACAACGCTCCGA the present study was to determine methylation changes in DNA extracted from umbilical cord blood in 29 pairs of IVF-conceived twins and compared to 30 pairs of naturally (spontaneously) conceived twins. The three most common imprinting error-related DMRs in BWS and Silver-Russell syndrome were quantitatively assayed by bisulfite sequencing. MATERIALS AND METHODS Sample Collection Institutional review board approval to report this case was obtained from the Research Ethics Committee of Zhejiang University School of Medicine. Between April 2008 and August 2009, 59 pairs of neonatal twins were recruited for this study. All the twins included in this study were delivered by cesarean section at the Women s Hospital (School of Medicine, Zhejiang University), and umbilical cord blood was collected after delivery. The study group included 29 pairs of IVF-conceived twins, and the control group consisted of 30 pairs of naturally conceived twins with normal birth weights. DNA Extraction and Bisulfite Conversion Umbilical cord blood was drawn into Vacutainer tubes containing ethylenediaminetetraacetic acid and stored at 4 C. Genomic DNAwas extracted using QIAamp DNA blood kits (Qiagen, Valencia, CA) according to the manufacturer s instructions. DNA was dissolved in TE (Tris-EDTA) buffer and then quantitated by a measurement of OD260. DNA (1.5 mg) was processed for bisulfite sequencing analysis using the EpiTect Bisulfite Kit (Qiagen) according to the manufacturer s protocol. Unmethylated cytosine was modified to uracil, whereas methylated cytosine remained unchanged. This protocol enables the user to reduce DNA degradation and maximize DNA recovery by reducing the incubation time with bisulfite solution to 5 hours and using an RNA carrier to recover modified DNA. DNA was eluted in 30 ml of elution buffer, with 1 2 ml used for the amplification of each gene. The efficiency of the procedure was ensured by a >95% conversion rate of non-cpg cytosine to uracil. Polymerase Chain Reaction Amplification, Cloning, and Sequencing MethPrimer software was used to identify CpG islands and design primers (12, 13). The CCCTC-binding factor (CTCF) binding site of the unmethylated alleles in the H19/IGF2 DMR (NT_ , ) and the 5 0 CpG island region of PEG1, which contains 15 CpG sites (NT_ , ) and 32 CpG sites located in KvDMR1 (NW_ , ), were analyzed. DNA was amplified in one or two rounds of polymerase chain reaction (PCR) at 25 ml, PCR reactions consisting of 80 to 100 ng of DNA, 2 mmol/l MgCl 2, PCR buffer, 0.2 mmol/l of each oligonucleotide primer (Sangon, Shanghai, China), and 1 IU Hot-Start DNA polymerase (TaKaRa, Japan). Thermocycling conditions consisted of an initial 5-minute denaturation at 94 C, followed by 35 cycles of 94 C for 45 seconds, C for 45 seconds, and 72 C for 45 seconds, and a 10-minute extension at 72 C. Primer sequences for the DMRs are shown in Table 1. PCR products were gel purified and ligated into the pmd19-t Simple Vector (TaKaRa) at 16 C for 2 hours, according to the manufacturer s instructions. Plasmids were transformed into Escherichia coli DH-5a competent cells. Transformed bacteria were spread onto LB agar plates containing 100 mg/ml ampicillin and 50 ml of 10-mg/mL X-gal and incubated overnight at 37 C. A single strain was inoculated into 2 ml LB liquid medium containing 100 mg/ml ampicillin and grown overnight at 37 C. PCR products were cloned using T-vector specific primers, and more than 20 clones in each individual with the expected band size were sequenced. Statistical Analysis All computations were performed with SPSS software (version 17.0 for Windows; SPSS, Chicago, IL). Fisher s exact test, Student s t test, and the chi-square test were used to compare the proportions of outliers between different genes and median methylation values. P values < 0.05 were considered to be statistically significant. RESULTS General Description of the Neonatal Examination No congenital malformations of any kind were found in either cohort. The average birth weights of the IVF-conceived and naturally conceived groups were 2,425.9 and 2,568.2 g, respectively (P¼0.119). The lengths of gestation, mothers ages, and birth weights of the IVF and naturally conceived groups are listed in Table 2. DNA Methylation in Maternally Methylated DMRs Because DNA methylation appears in only one of the two parental alleles, the amount of methylated CpGs should be close to 50% of the total methylated plus nonmethylated CpGs in maternally methylated DMRs tested, which was in agreement with the theoretical value expected for DMRs in the genome. Thirty additional clones were sequenced for individuals with a median methylation percentage exceeding 30% 70% (14). The analyzed DMRs in most of the samples displayed the expected differential methylation. The median methylation percentage of KvDMR1 in IVF-conceived twins and naturally conceived twins were 45.58% and 49.10%, respectively. We found a slightly increased rate of faulty methylation patterns in KvDMR1: there was a trend toward hypomethylation in three children from three separate pairs of twins out of 29 (5.08%) pairs of IVF children who had methylation levels slightly lower than 21% (hypomethylation of KvDMR1; Fig. 1), whereas their siblings showed normal methylation percentages. The other remaining 1976 Li et al. DNA methylation in IVF-conceived twins Vol. 95, No. 6, May 2011

3 TABLE 2 Characteristics of the study population: weeks of gestation, maternal age, and birth weight of the 29 pairs of IVF twins and 30 pairs of naturally conceived twins. Maternal age (y) Gestation (wk) Birth weight (g) Pair A B A B A B , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , 2600 Note: A ¼ IVF-conceived twins; B ¼ naturally conceived twins. IVF twins showed no discordance to each other and had a normal methylation status. An analysis of the percentage of methylation in the controls revealed that one child out of 30 pairs (1.67%) of control children displayed hypomethylation. Although the incidence of aberrant methylation was higher in children conceived via IVF than in those conceived spontaneously (3/58 vs. 1/60), there was no statistically significant difference between the IVF and non-art samples (Fisher s exact test, P¼0.611). Methylation levels at PEG1 varied less than at KvDMR1, and the median methylation percentages of IVF-conceived and naturally conceived twins were 51.14% and 50.67%, respectively. The numbers of methylated CpGs in PEG1 were comparable to naturally conceived controls, and no significant differences were found (P¼0.103; Fig. 1). DNA Methylation in Paternally Methylated H19/IGF2 DMR The 23 CpG sites located in the H19/IGF2 DMR are the CTCF binding site of the unmethylated alleles; they prevent IGF2 from accessing the common enhancers and block IGF2 expression when CTCF binds to the unmethylated maternal DMR. The median methylation percentages at IVF and naturally conceived twins were 45.68% and 42.88%, respectively. Although most of the twins exhibited consistent methylation patterns at these three DMRs, discordant methylation at the H19/IGF2 DMR was found in one pair; one child who was conceived by IVF had an H19/IGF2 DMR methylation level of 68%, higher than that of the child s sibling (48.7%). However, one case with a methylation level slightly higher than 70% was also found among the naturally conceived children. Statistical analysis did not reveal significant differences in the methylation percentages of the H19/IGF2 DMR (P¼0.103). DISCUSSION The concept of epigenetic risk is associated with ART for the disturbances of embryonic development with aberrant DNA methylation at DMRs, which are responsible for some imprinting disorders. Fears of this risk have been supported by reports of an association between IVF-conceived singletons and BWS, which are conditions caused by defects in genomic imprinting (15, 16). In response to these reports, we speculated whether such vulnerability in DNA methylation at DMRs also existed in twins conceived by IVF. Therefore, we performed methylation analyses of the three most investigated DMRs that have been associated with BWS and growth retardation (and possibly Silver-Russell syndrome). Fertility and Sterility â 1977

4 FIGURE 1 A box plot representation of methylation patterns at the H19/IGF2 DMR, PEG1, and KvDMR1 in neonatal umbilical cord blood samples of twins conceived with IVF and naturally conceived twins. The median is represented by horizontal lines. The bottom of the box indicates the 25th percentile and the top indicates the 75th percentile. Outliers are shown as closed circles. Our analyses used a quantitative methylation assay and umbilical cord blood samples from 29 pairs of neonatal IVF twins and compared them to those of 30 pairs of naturally conceived twins. The surveyed regions contained 32 (KvDMR1), 15 (PEG1), and 23 (H19/IGF2 DMR) CpGs sites. Considering that the methylated CpGs should be close to 50% of the total methylated and nonmethylated CpGs, most of the values were within the 40% 60% range. Methylation indices did not reveal significant differences at PEG1 between the two groups. Only one IVF child had abnormal methylation levels at the H19/IGF2 DMR (hypermethylation; Fig. 1). However, one spontaneously conceived child also had methylation levels slightly greater than 70% in this region. Because the majority of ART-conceived twins are dizygotic, this result indicates that a differential imprinting vulnerability may exist between different embryos, suggesting that environmental effects on embryos may generate different consequences. Although some embryos at especially vulnerable stages might be affected, others can resist unfavorable circumstances. The aberration could occur in some cells of the early embryo but not in others, as speculated by Turan et al., and thus result in mosaic individuals with degrees of aberrant methylation that vary between their different tissues (17). The maternally methylated KvDMR1 appears to be more vulnerable than the paternally methylated DMRs. Three of the IVFconceived children showed hypomethylation of KvDMR1. We also found one naturally conceived child with hypomethylation at this locus, and no significant difference in mean DMR methylation in cord blood between IVF and naturally conceived group was found. Although this finding can be explained by a certain degree of interpersonal and individual variation, the present study and Turan et al. (17) appear to show the same trend at some DMRs tested. These results indicate that epigenetic modifications at H19/ IGF2 DMR and KvDMR1 are subject to frequent changes during early development, and the decrease in DNA methylation at KvDMR1 in ART twins is still a source of concern (17). As for the disagreement of our findings with the results of some earlier reports, which suggested an increased susceptibility of maternal imprints to ART-induced methylation changes (8, 18), we reason that not all the epigenetic changes appear to be manifested as significant differences in DNA methylation. DNA methylation differences between IVF and naturally conceived (NC) groups are manifestations of a smaller number of trophoblast stem cells in children from the in vitro group. In addition, the culturing of embryos in an unfavorable medium or for a lengthy time might cause significantly aberrant regulation at one or more of the imprinted genes, whereas optimal medium and manipulation should not affect epigenetic reprogramming and result in normal DNA methylation patterns, development, and morphology (19, 20, 21). Meanwhile, stimulation protocols for ART patients of different ages will exert different effects on gametogenesis. Female germ cells may be more susceptible to epimutations, because they experience more procedures than male germ cells. Hormonal stimulation, gamete exposure, and manipulation in an artificial environment are required for female germ cells, and the correct or incorrect imprinting establishment will result in normal or abnormal methylation in the resulting oocytes. This fact might explain why a higher frequency of aberrant maternal methylation, such as hypomethylation in KvDMR1, in children conceived by ART has been observed by other authors (22, 23, 24). This discrepancy might also be explained by differences in sample sizes or ethnic background. A recently published study by Tierling et al. (25) agrees with our findings. Because studies examining the association of ART and birth outcomes have been inconclusive, and preexisting methylation aberrations in the gametes of infertile patients have not been clearly defined, we cannot solely assign such differences in methylation stability to the ART procedure (26, 27). Although we did not find a significantly increased risk of DNA methylation aberrations at these studied DMRs in the cord blood samples of ART-conceived twins, larger sample studies are needed to assess the potential epigenetic risks in IVF-conceived twins. Imprinting disorders are relatively rare, and accordingly the studies performed thus far have been based only on small numbers of children conceived by IVF. Therefore, the association between ART and abnormal methylation at specific DMRs and the effects of ART procedures on embryo epigenetics call for further investigation (28). Acknowledgment: The authors thank Sean Dowdy, M.D., from the Department of Obstetrics and Gynecology, Mayo Clinic in Rochester, Minnesota for correcting the manuscript. REFERENCES 1. Feinberg AP, Cui H, Ohlsson R. DNA methylation and genomic imprinting: insights from cancer into epigenetic mechanisms. Semin Cancer Biol 2002;12: Reik W, Walter J. Genomic imprinting: parental influence on the genome. Nat Rev Genet 2001;2: DeBaun MR, Niemitz EL, Feinberg AP. Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and H19. Am J Hum Genet 2003;72: Gosden R, Trasler J, Lucifero D, Faddy M. Rare congenital disorders, imprinted genes, and assisted reproductive technology. Lancet 2003;361: Halliday J, Oke K, Breheny S, Algar E, J Amor D. Beckwith-Wiedemann syndrome and IVF: a casecontrol study. Am J Hum Genet 2004;75: Sutcliffe AG, Peters CJ, Bowdin S, Temple K, Reardon W, Wilson L, et al. Assisted reproductive therapies and imprinting disorders a preliminary British survey. Hum Reprod 2006;21: Li et al. DNA methylation in IVF-conceived twins Vol. 95, No. 6, May 2011

5 7. Lim D, Bowdin SC, Tee L, Kirby GA, Blair E, Fryer A, et al. Clinical and molecular genetic features of Beckwith-Wiedemann syndrome associated with assisted reproductive technologies. Hum Reprod 2009;24: Gomes MV, Huber J, Ferriani RA, Amaral Neto AM, Ramos ES. Abnormal methylation at the KvDMR1 imprinting control region in clinically normal children conceived by assisted reproductive technologies. Mol Hum Reprod 2009;15: de Mouzon J, Goossens V, Bhattacharya S, Castilla JA, Ferraretti AP, Korsak V, et al. Assisted reproductive technology in Europe, 2006: results generated from European registers by ESHRE. Hum Reprod 2010;25: McDonald S, Murphy K, Beyene J, Ohlsson A. Perinatal outcomes of invitro fertilization twins: a systematic review and meta-analyses. Am J Obstet Gynecol 2005;193: Ombelet W, Martens G, De Sutter P, Gerris J, Bosmans E, Ruyssinck G, et al. Perinatal outcome of 12,021 singleton and 3108 twin births after non- IVF-assisted reproduction: a cohort study. Hum Reprod 2006;21: Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs. Bioinformatics 2002; 18: Beatty L, Weksberg R, Sadowski PD. Detailed analysis of the methylation patterns of the KvDMR1 imprinting control region of human chromosome 11. Genomics 2006;87: Kobayashi H, Sato A, Otsu E, Hiura H, Tomatsu C, Utsunomiya T, et al. Aberrant DNA methylation of imprinted loci in sperm from oligospermic patients. Hum Mol Genet 2007;16: Cox GF, B urger J, Lip V, Mau UA, Sperling K, Wu BL, et al. Intracytoplasmic sperm injection may increase the risk of imprinting defects. Am J Hum Genet 2002;71: Li T, Vu TH, Ulaner GA, Littman E, Ling JQ, Chen HL, et al. IVF results in de novo DNA methylation and histone methylation at an Igf2-H19 imprinting epigenetic switch. Mol Hum Reprod 2005;11: Turan N, Katari S, Gerson LF, Chalian R, Foster MW, Gaughan JP, et al. Inter- and intra-individual variation in allele-specific DNA methylation and gene expression in children conceived using assisted reproductive technology. PLoS Genet 2010;6:e Amor DJ, Halliday J. A review of known imprinting syndromes and their association with assisted reproduction technologies. Hum Reprod 2008;23: Lane M, Gardner DK. Ammonium induces aberrant blastocyst differentiation, metabolism, ph regulation, gene expression and subsequently alters fetal development in the mouse. Biol Reprod 2003;69: Zander DL, Thompson JG, Lane M. Perturbations in mouse embryo development and viability caused by ammonium are more severe after exposure at the cleavage stages. Biol Reprod 2006;74: Yeo CX, Gilchrist RB, Thompson JG, Lane M. Exogenous growth differentiation factor 9 in oocyte maturation media enhances subsequent embryo development and fetal viability in mice. Hum Reprod 2008;23: DeBaun MR, Niemitz EL, Feinberg AP. Association of in vitro fertilization with Beckwith-Wiedemann syndrome and epigenetic alterations of LIT1 and H19. Am J Hum Genet 2003;72: Chang AS, Moley KH, Wangler M, Feinberg AP, Debaun MR. Association between Beckwith- Wiedemann syndrome and assisted reproductive technology: a case series of 19 patients. Fertil Steril 2005;83: Market-Velker BA, Zhang L, Magri LS, Bonvissuto AC, Mann MR. Dual effects of superovulation: loss of maternal and paternal imprinted methylation in a dosedependent manner. Hum Mol Genet 2010;19: Tierling S, Souren NY, Gries J, Loporto C, Groth M, Lutsik P, et al. Assisted reproductive technologies do not enhance the variability of DNA methylation imprints in human. J Med Genet 2010;47: Marques CJ, Carvalho F, Sousa M, Barros A. Genomic imprinting in disruptive spermatogenesis. Lancet 2004;363: Kobayashi H, Sato A, Otsu E, Hiura H, Tomatsu C, Utsunomiya T, et al. Aberrant DNA methylation of imprinted loci in sperm from oligospermic patients. Hum Mol Genet 2007;16: Marques CJ, Costa P, Vaz B, Carvalho F, Fernandes S, Barros A, et al. Abnormal methylation of imprinted genes in human sperm is associated with oligozoospermia. Mol Hum Reprod 2008;14: Fertility and Sterility â 1979