formance Inflammation Recovery Digestion Fertility Endurance Calm
|
|
- Samson French
- 5 years ago
- Views:
Transcription
1 formance Inflammation Recovery Digestion Fertility Endurance Calm Inflammation Anti-Oxidant Endurance Fitness Performance Calmness
2 erformance Inflammation Recovery Digestion Fertility Endurance Ca EQUI-BOOST PLUS IS A 100% ORGANIC, NATURAL FORMULA SPECIFICALLY DESIGNED TO PROVIDE LONG-TERM DIGESTIVE SYSTEM HEALTH & JOINT SUPPORT WITHOUT ANY SIDE EFFECTS Equi-Boost Plus formula is designed to be an all-inclusive daily supplement to improve health and performance for all horses. It strongly supports digestive wellness, which increases nutrient absorption and helps build a stronger immune system. Our combination of 2 functional oils, Cashew Nut Shell Liquid and Castor Oil, contains active compounds of Ricinoleic Acid, Cardol and Cardanol. These ingredients have a natural anti-microbial effect, which helps to eliminate harmful bacteria and protozoa. The powerful anti-inflammatory properties of our active ingredients benefit all types of joint stiffness and muscular inflammation. BENEFITS (AFTER 21 DAYS OF DAILY SUPPLEMENTATION): Assists with joint pains related to inflammation. Supports an increase in blood oxygen levels resulting in improved fitness, endurance and performance. Supports improved recovery times from exercise, including reduced stiffness. Supports intestinal health resulting in a regular digestive system and greater absorption of nutrients in food. Supports a healthy coat. Supports fertility and increases sperm production in studs. Supports a stronger immune system. Supports balanced PH levels. Strong antioxidant compounds. An increased state of calmness. ALL INGREDIENTS ARE FDA APPROVED AND ARE MANUFACTURED IN THE USA. flammation Anti-Oxidant Endurance Fitness Performance Calmness
3 lmness Anti-oxidant Immunity Fitness Performance Inflammation Re FREQUENTLY ASKED QUESTIONS WHAT IS EQUI-BOOST PLUS MADE OF AND WHAT ARE THE ACTIVE COMPONENTS? Equi-Boost Plus is a combination of two functional oils; castor oil and cashew nut shell liquid (not the nut itself). The active components are ricinoleic acid, cardol, and cardanol. Ricinoleic acid comes from castor oil, with cardol and cardanol coming from cashew nut shell liquid. Vermiculite (silica) is used as a carrier. WHAT ARE THE TARGETED MICROBIAL CHALLENGES THAT EQUI-BOOST PLUS WILL HELP TO ALLEVIATE? The natural antimicrobial activity in Equi-Boost Plus has two modes of action (disrupting both monovalent and divalent cations) to disturb and destroy the cell walls of grampositive bacteria and protozoa. Having two modes of action not only makes the product more effective, but also significantly reduces the chances of resistance developing. Equi-Boost Plus is able to target strains of Eimeria, the protozoa that causes coccidiosis, as well as Clostridium, which causes necrotic enteritis. HOW DO I KNOW THAT THE RESULTS ARE GOING TO BE CONSISTENT? The levels of ricinoleic acid, cardol and cardanol get tested in the raw materials, during manufacturing, and of course in the final product. Using NIRS (near infrared spectroscopy) the levels of these three active components can even be tested after it has been mixed in feed. WHAT KIND OF CERTIFICATIONS ARE ASSOCIATED WITH THE PRODUCT AND ITS MANUFACTURING? Equi-Boost Plus has received the FAMI-QS Certification, a more stringent and feed additive/premix specific version of GMP. HOW IS EQUI-BOOST PLUS DIFFERENT THAN OTHER PHYTOGENICS (ESSENTIAL OILS)? Phytogenics, or essential oils, can be easily confused with Equi-Boost Plus due to the name and that both are plant based. However, phytogenics are made from herbs and spices with some of the most common being: thyme, rosemary, cinnamon, chili, and oregano. The active components of these ingredients are usually not standardized, which results in inconsistent and unreliable performance. The functional oils in Equi-Boost Plus are able to pass through the stomach and target the intestinal tract, where the microbial challenge is, whereas some phytogenics get broken down in the stomach. ARE THERE ANY RISKS OF TOXICITY? There has been no evidence or indications of toxicity or risk with over-dosing with Equi-Boost Plus. The castor bean plant is occasionally associated with the toxin ricin, however ricin is hydrophilic (water affinity) whereas castor oil is lipophilic (oil affinity). The process used to get castor oil eliminates ricin from contaminating the oil. Castor oil is also a common ingredient for many cosmetic products, as well as used as a laxative on its own. Recovery Immunity Digestion Fertility Anti-Oxidant Endurance Fitnes
4 erformance Inflammation Recovery Digestion Fertility Endurance Ca WILL I SEE ANY LAXATIVE EFFECTS? WHAT WILL I NOTICE IN FECES QUALITY? Quite the contrary, there will be a positive effect on feces quality. Equi-Boost Plus has a dosage of castor oil that can maintain its biological activity, without having a laxative effect. Between the decrease in microbial challenge and improved nutrient absorption, the feces will be drier and less odorous. Improvement in feces is commonly the first observed sign of activity after supplementing Equi-Boost Plus. CAN I INCLUDE EQUI-BOOST PLUS WITH OTHER FEED INGREDIENTS? Feed ingredients like acidifiers, pre/pro/syn-biotics, or enzymes can be included at the same time with no counter-indications. If there is a need for antibiotic treatment, the animal s response will be improved with Equi-Boost Plus due to improved overall health and immune response. HOW STABLE ARE THE ACTIVE COMPONENTS OF EQUI-BOOST PLUS? HOW SHOULD IT BE STORED AND WHAT IS THE SHELF LIFE? The activity of Equi-Boost Plus can handle a 3-year shelf life from date of manufacturing. The product should be kept out of direct sunlight and avoid getting wet (high humidity has no effect). The active ingredients can also handle high temperatures and are unaffected by extrusion, even for dog food (at ~150C). Equi-Boost Plus can undergo any processing for feed (pelleting, crumbles, extrusion, etc.) without losing activity or disrupting feed quality. WHAT IS THE RECOMMENDED DOSAGE OF EQUI-BOOST PLUS FOR HORSES? There has been research on the application of Equi-Boost Plus in horses, with a recommended dosage of 10g per day per horse, to be added to their feed as a supplement. WHEN SHOULD EQUI-BOOST PLUS BE INCLUDED IN THE DIET? Equi-Boost Plus should be supplemented to the feed ration of horses at the earliest stage possible. Including the product in the early stages of life will increase the probability of a healthy and well performing animal throughout its lifespan. The longer Equi-Boost Plus is included in the diet, the better performance the animal will have. When added to parent feed rations, the resulting offspring will be healthier and off to a better start. WHAT OTHER COUNTRIES ARE USING THIS PRODUCT? The ingredients of Equi-Boost Plus were developed in Brazil about 10 years ago but have been recently registered and now sold in: Malaysia, Philippines, Indonesia, South Korea, Vietnam, Thailand, South Africa, Colombia, Mexico and Spain. Several other countries are in the registration process with many more intended to begin registration. WHAT KIND OF CERTIFICATIONS ARE ASSOCIATED WITH THE PRODUCT AND IT S MANUFACTURING? The ingredients of Equi-Boost Plus are all FDA approved. Equi-Boost Plus has received the FAMI-QS Certification, a more stringent and feed additive / premix specific version of GMP. flammation Anti-Oxidant Endurance Fitness Performance Calmness
5 lmness Anti-oxidant Immunity Fitness Performance Inflammation Re EQUI-BOOST PLUS MODE OF ACTION Shown by own research Field trial observations backed by other research INTESTINAL FLORA METABOLISM Anti-Gram Positive Bacteria Enhanced Fibrolytic Microflora Improved Vasodilation Anti- Inflammatory Anti-Diaretic Anti-Oxidant Immunostimulant Less Acidosis No Glucose Peaks Better Cell Integrity Reduced Endotoxin Production Better Fiber Digestion Better Nutrient Absorption Better Heat Dissipation Reduced Laminitis Better Digestibility Better Carbohydrate Utilization Less Colic Less Colitis More Muscle Mass Less Muscle Problems Better Disease Resistance Recovery Immunity Digestion Fertility Anti-Oxidant Endurance Fitnes
6 erformance Inflammation Recovery Digestion Fertility Endurance Ca INTERNAL RESEARCH EFFECTS OF EQUI-BOOST PLUS SUPPLEMENTATION ON BLOOD PARAMETERS IN THOROUGHBRED HORSES UNDER HEAVY TRAINING OBJECTIVES To evaluate the effects of the supplementation of Equi-Boost Plus (composition: castor oil, cashew nut shell oil and carrier) in horses submitted to strenuous physical exercise. MATERIALS AND METHODS Seven Throughbred horses under heavy training were supplemented with 10 g/day of Equi-Boost Plus during 21 days. Blood samples were taken at the beginning and the end of the experiment and the following parameters were analyzed: white blood cells (WBC), red blood cells (RBC), hematocrit (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), platelets, neutrophyls, lymphocytes, monocytes, eosinophyls, basophyls, sodium, potassium, chlorine, glucose, blood urea nitrogen (BUN), creatinine, calcium, phosphorus, total protein, albumin, AST, alkaline phosphatase, total bilirrubin, CGTP and CPK. Statistics. An ancova was done using Equi-Boost Plus supplementation and animal as discreet variables and serum albumin concentration as a covariate. Serum albumin gives an indication of the hydration state of the animals. RESULTS AND DISCUSSION Mean corpuscular volume and calcium significantly increased (P < 0.05) and phosphorus decreased (P < 0.01) after supplementation. There was a tendency (P < 0.1) for a decrease in sodium and CPK. Mean corpuscular volume is a measure of the average red blood cell volume, which would indicate higher oxygen transport capacity in the animals after supplementation. Equi-Boost Plus antioxidant activity might be increasing the red blood cells life span, increasing the final total number. Other values related to MCV like RBC or HCT were numerically higher for the horses after supplementation. Phosphorus is one of the main buffering systems in the blood and lower numbers indicate less need for buffering. This would indicate an improved energy metabolism and lower metabolic acidosis. An improved energy metabolism would also result in less oxidative stress and would relate to the lower CPK levels. As CPK indicates tissue destruction, lowers levels indicate better cell membrane integrity. Again, this indicates either a better antioxidant capacity, a more efficient energy production system or both. flammation Anti-Oxidant Endurance Fitness Performance Calmness
7 lmness Anti-oxidant Immunity Fitness Performance Inflammation Re CONCLUSION Equi-Boost Plus supplementation improved the antioxidant capacity and energy metabolism of training Thoroughbred Horses. Baseline After 21 days of supplementation a 44.73b RBC HGB MCV FIGURE 1. Red blood cell (RBC), hemoglobin (HBG) and mean corpuscular volume (MCV) before and after 21 days of Equi-Boost Plus supplementation Baseline After 21 days FIGURE 2. Creatine Phospokinase levels before and after 21 days of Equi-Boost Plus supplementation. Recovery Immunity Digestion Fertility Anti-Oxidant Endurance Fitnes
8 Feeding for Performance Inflammation Anti-Oxidant Endurance Fitness Performance Calmness
Understanding Blood Tests
PATIENT EDUCATION patienteducation.osumc.edu Your heart pumps the blood in your body through a system of blood vessels. Blood delivers oxygen and nutrients to all parts of the body. It also carries away
More informationClinician Blood Panel Results
Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More information10 Essential Blood Tests PART 1
Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com
More informationMultiphasic Blood Analysis
Understanding Your Multiphasic Blood Analysis Test Results Mon General thanks you for participating in the multiphasic blood analysis. This test can be an early warning of health problems, including coronary
More informationIs Your Feeding Program up to Snuff?
Is Your Feeding Program up to Snuff? By Amy M Gill, PhD When was the last time you evaluated what your horse is being fed? The nutritional needs of horses actually change quite frequently, and I always
More informationHEMOTOLOGY. B. Helps stabilize body temperature -heats up and cools down slowly which moderates body temp
I. Body H 2 O = HEMOTOLOGY A. Variable quantities 1. sweating and urination ( ) decreases H 2 O 2. drinking H 2 O increases B. Water is found in two compartments 1. contains 2/3 of all water in your body
More informationRoutine Clinic Lab Studies
Routine Lab Studies Routine Clinic Lab Studies With all lab studies, a Tacrolimus level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not too much anti-rejection
More informationThe Blood Chemistry Panel Explained
The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems
More informationBlood Test Results Report
Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or
More informationM.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017
M.D.IPA, M.D.IPA Preferred, Optimum Choice and Optimum Choice Preferred STAT Laboratory List Revised Jan. 5, 2017 If laboratory results are required on a STAT basis, the designated commercial medical laboratory
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationGastrointestinal Markers
Gastrointestinal Markers Session 2 Gastrointestinal System Reference Ranges Optimal Range Ttl Total Protein ti 69 6.9 74 7.4 Globulin 2.4 2.8 BUN 10 16 Creatinine 0.8 1.1 Phosphorous 3.0 4.0 Eosinophils
More informationResults Report. Welcome to Your ABT Report!
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be
More informationComplete Medical History
Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical
More informationUNDERSTANDING YOUR WATER PROFILE PRESENTED BY POULTRY PARTNERS AND AHPD
UNDERSTANDING YOUR WATER PROFILE PRESENTED BY POULTRY PARTNERS AND AHPD WHY DOES IT MATTER? Water intake for commercial poultry breeds is 1.5-2x greater than feed intake Commercial birds drink more now
More informationGet to know yourself better. Attend our health screening event.
Gateway Technical College Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening
More informationChapter 15 Food and Digestion
Chapter 15 Food and Digestion 15.1A Food and Energy Functions of Nutrients 1. 2. 3. 4. Calories = amt. of energy in food RDA depends on age, gender, size and activity level Types of Nutrients (includes
More informationRapid Laboratories In House Tests
Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA
More informationBuckeye Nutrition Products
Buckeye Nutrition Products Horseman s Select 12% Sweet Textured feed for mature horses $11.99 12% Protein 3% Fat 12% Fiber Feed to meet desired body condition Supreme 14 Supreme 14 by BUCKEYE Nutrition
More informationPremium E & Se Powder
Premium E & Se PREMIUM E & Se : Scientifically formulated Vitamin E, Ester C TM, Essential B Group Vitamins and chelated Selenium with essential amino acids for a powerful anti-oxidant effect for all ages
More informationCULINARY HERBS AND SPICES
CULINARY HERBS AND SPICES Using Culinary Herbs and Spices Flavour and texture are a huge issue when it comes to introducing new foods to a client Herb and spices can help make a new food seem like an old
More informationBurak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1
Burak DiK 1, Emre BAHCIVAN 1,2, Hatice ESER 1,3, Kamil UNEY 1 1 Selcuk University Faculty of Veterinary Medicine, Pharmacology and Toxicology Department, Konya, TURKEY 2 Kafkas University Faculty of Veterinary
More informationTABLE OF CONTENTS. Introduction...5 What the Wrong Kind of Water...5 Benefits of Alkaline Water...8
TABLE OF CONTENTS Introduction...5 What the Wrong Kind of Water...5 Benefits of Alkaline Water...8 10 Reasons to Drink Alkaline Ionized Every Day...10 #1 Hydration...11 #2 Detoxification (Cleansing)...13
More informationDelta Check Calculation Guide
Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2
More informationUpdate nutrition technology that s made. promoter or without additional hormone
Update nutrition technology that s made poultry growth without antibiotic growth promoter or without additional hormone Yuwares Ruangpanit, Ph.D. Nutrition DepartmentofAnimal Science, Faculty of Agriculture
More informationTEST NAME:Cells and Health TEST ID: GRADE:08 - Eighth Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: School Assessment
TEST NAME:Cells and Health TEST ID:1326431 GRADE:08 - Eighth Grade SUBJECT:Life and Physical Sciences TEST CATEGORY: School Assessment Cells and Health Page 1 of 15 Student: Class: Date: 1. Which best
More informationChickens for Fattening Tolerate Nonanoic Acid Added to Diet at Levels up to 1000 mg/kg Feed
Chickens for Fattening Tolerate Nonanoic Acid Added to Diet at Levels up to 1000 mg/kg Feed Feed Additive Conference Frankfurt, Germany 29 September 2017 Loretta Hunter Global Compliance Director, Anitox
More informationResults Report. Welcome to Your ABT Report! Introduction to the ABT Report
Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a
More informationZOOLOGY/SCIENCE OF ANIMAL NUTRITION AG
Student's Name ZOOLOGY/SCIENCE OF ANIMAL NUTRITION AG 0532 Directions: Rating Scale: Evaluate the trainee using the rating scale below and check the appropriate number to indicate the degree of competency
More informationGet to know yourself better. Attend our health screening event.
Get to know yourself better. Attend our health screening event. Putting your knowledge to action is Powerful. Get the information and guidance you need with the Wellness Screening Program. 1 SIMPLE ACTION
More informationWhat Does My Blood Test Mean
What Does My Blood Test Mean CBC with Differential This means that your doctor wants to know the amounts and proportions among the various components of your blood, explained below. The term differential
More informationVITAMINS, MINERALS AND THE GUT
VITAMINS, MINERALS AND THE GUT Nutrients Looking at individual nutrients that are involved with gut health can be misleading This is not about taking individual nutrients It supports more a whole food
More informationTopic 3.1 Nutrients. - Lipids are an essential part of the and are a part of cell in the body.
Name: Topic 3.1 Nutrients Date: IB SEHS 3.1.1. List the macronutrients and micronutrients Macronutrients: - lipid (fat) - carbohydrate - protein - water (says the book) Micronutrients: - vitamins - minerals
More informationWhat is PlaqueOff (PO)? A new study in Beagle dogs. Oral effects of
Oral effects of What is? PO is a dry food supplement. Sprinkle it onto your pet s food daily. PO is an algae that has been harvested in the Atlantic ocean in northern Norway and contains nothing else such
More informationClinician Blood Panel Results
Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement
More informationAnimal Digestion and Nutrition. Objective 7.02: Understand the digestive process
Animal Digestion and Nutrition Objective 7.02: Understand the digestive process RUMINANTS Ruminant Animals Animals with complex digestive systems Capable of digesting material with a high fiber concentration
More informationEFFECT OF AN ALUMINUM SUPPLEMENT ON NUTRIENT DIGESTIBILITY AND MINERAL METABOLISM IN THOROUGHBRED HORSES
K.A. Roose et al. 119 EFFECT OF AN ALUMINUM SUPPLEMENT ON NUTRIENT DIGESTIBILITY AND MINERAL METABOLISM IN THOROUGHBRED HORSES K. A. ROOSE, K. E. HOEKSTRA, J. D. PAGAN, R. J. GEOR Kentucky Equine Research,
More informationArbonne PhytoSport. Collection Focus Guide. Did You Know? SCIENCE AND EDUCATION. Carbohydrates. Proteins
Arbonne PhytoSport Collection Focus Guide Did You Know? All of the energy we need for life, as well as for exercise, comes from the foods we eat and the fluids we drink. To perform at your body s peak
More informationAnimal Digestion and Nutrition
Animal Digestion and Nutrition Competency: Analyze the parts and functions of the digestive system of farm animals By : ARI WIBOWO, S.Pt.,M.Si & SUHARDI, S.Pt.,MP Ruminants Objective: Describe the function
More informationLOOK, FEEL AND LIVE BETTER
LOOK, FEEL AND LIVE BETTER 1 2 Look, Feel & Live Better with Pycnogenol With the variety of natural supplements available today, it s important to choose wisely and select one that is proven effective
More information*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:
Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c
More informationno concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis
TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your
More informationNutrition and Energy 1
Nutrition and Energy 1 Food Energy The ingestion of food serves two primary functions: 1. it provides a source of energy 2. it provides raw materials the animal is unable to manufacture for itself. 2 Basal
More informationUnit Seven Blood and Immunity
Unit Seven Blood and Immunity I. Introduction A. Definition Blood is a sticky fluid that is heavier and thicker than water. Blood is a type of, whose cells and suspended in a liquid intercellular material.
More informationBENEFITS OF STOP HUNGER NOW MEALS TO CHILDREN
BENEFITS OF STOP HUNGER NOW MEALS TO CHILDREN CONTENT PER ONE (1) CUP SERVING RECOMMENDED ENERGY & NUTRIENT INTAKES FOR FILIPINO CHILDREN Percent Contribution BENEFITS TO CHILDREN CALORIES 250 kcal Male:
More informationChapter 15 Food and Digestion
Chapter 15 Food and Digestion Activity: Use Qualitative Observations (5 senses) to describe: What happens when you see candy? How does it smell? How do you chomp it into smaller pieces or swallow candy
More informationChapter 11: Range Animal Nutrition
Chapter 11: Range Animal Nutrition 1. Nutritional Components of Forages a. Protein b. Energy c. Phosphorus d. Vitamin A 2. Comparative Nutrition of Forages a. Grasses b. Forbs c. Shrubs 3. Comparative
More informationLaboratory Accreditation Programmes
Client No. 1609 LABNET Invermay Limited PO Box 371, Mosgiel, 9053 Puddle Alley, RD 2, Mosgiel, 9092 Telephone 03 489-4600 www.gribblesvets.co.nz Fax 03 489-8576 Authorised Representative Ms Denise Carian-Smith
More informationWELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL
WELLNESS LABS EXPLANATION OF RESULTS BASIC METABOLIC PANEL BUN Blood Urea Nitrogen (BUN) is a waste product of protein breakdown and is produced when excess protein in your body is broken down and used
More informationREFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine
REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l 144-151 149-156 135-151 135-148 140-150 143-151 Potassium mmol/l 3.9-5.3 3.3-5.2 3.9-5.9 3.0-5.0 4.7-7.1 4.6-7.0
More information6 Nutrients Essential for Life
6 Nutrients Essential for Life Mind Moo-Ver SWBAT identify the 6 essential nutrients for life QOD: What does ph measure Give an example of an acidic substance, a basic substance and a neutral substance
More informationNutrition #3 Created for Canadian Pony Club Education By Lezah Williamson
Nutrition #3 Created for Canadian Pony Club Education By Lezah Williamson 1. Feed little and often 2. Feed plenty of bulk food 3. Feed according to size, age, breed, temperament, condition, season and
More informationArbonne PhytoSport. Collection Focus Guide. Did You Know? SCIENCE AND EDUCATION. Carbohydrates. Proteins
Arbonne PhytoSport Collection Focus Guide Did You Know? All of the energy we need for life, as well as for exercise, comes from the foods we eat and the fluids we drink. To perform at your body s peak
More informationNORMAL LABORATORY VALUES FOR CHILDREN
Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120
More informationRuminant Health, Vitamin, Minerals & Nutrition. Presented by Marty Ulrich
Ruminant Health, Vitamin, Minerals & Nutrition Presented by Marty Ulrich Ruminants require a number of minerals for optimal growth and reproduction. Selecting the correct mineral supplement is important
More informationAdams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS
Adams Memorial Hospital Decatur, Indiana EXPLANATION OF LABORATORY TESTS Your health is important to us! The test descriptions listed below are for educational purposes only. Laboratory test interpretation
More informationCULINARY HERBS AND SPICES
CULINARY HERBS AND SPICES Using Culinary Herbs and Spices Flavour and texture are a huge issue when it comes to introducing new foods to your diet Herb and spices can help make a new food seem like an
More informationNutrition. University of Wyoming D. Karen Hansen, PhD 2007 Stephen R. Schafer, EdD
Nutrition 2001 D. Karen Hansen, PhD 2007 Stephen R. Schafer, EdD Feeding Management Feed at the same time each day Feed horses on an individual basis Feed horses at least twice daily or if confined, allow
More informationKathryn Jones 8/11/2015
1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry
More informationBC Biomedical Laboratories Adult Reference Ranges
BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100
More informationBioavailability of Low Dose Plant Derived Minerals and Amino Acids, ph BALM (ph balanced, Bio Available Living Minerals)
REPORT PREPARED FOR MINERALSTAR Bioavailability of Low Dose Plant Derived Minerals and Amino Acids, ph BALM (ph balanced, Bio Available Living Minerals) Prepared by WILLIAM V. JUDY, PHD 23 January 2006
More informationEXSC- STANDARD 14. Nutrients
SPORTS NUTRITION EXSC- STANDARD 14 Nutrients Standard 14 Gather relevant information from multiple authoritative print and digital sources related to the importance of a balanced diet in the achievement
More informationCytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG
Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC
More informationSMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.
More informationROUTINE LAB STUDIES. Routine Clinic Lab Studies
ROUTINE LAB STUDIES Routine Clinic Lab Studies With all lab studies, a tacrolimus or cyclosporine level will be obtained. These drug levels are routinely assessed to ensure that there is enough or not
More informationa) Determine the HgB values for the patient samples to fill in the table below. (15 points total) (g/dl) (%) 1 (Female)
Week 4 - PROBLEM SET ( 200 points ) INSTRUCTIONS: Report all numerical answers to 1 decimal place. Do not round values used for calculations. Must show calculations and units for full credit. (1) A standard
More informationA test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.
Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These
More informationFulvicForce offers an ideal replacement for. creatine. FulvicForce boosts immune system and fights. inflammation. FulvicForce is effective in weight
FulvicForce fulvic acid in Sport and Training Research confirms that fulvic acid possesses truly remarkable biological, nutritional and remedial properties. It is these same properties, which make FulvicForce
More informationSection 5 Feeds and Feeding of Commercial Poultry Notes
Section 5 Feeds and Feeding of Commercial Poultry Notes Slide 2 Nutrition is a huge component of production cost! The knowledge of nutrient requirements for chickens is astounding. Commercial poultry strains
More informationName Date Class. 2. Is the following sentence true or false? Food is required for the body to. maintain homeostasis, keeping a steady internal state.
CHAPTER 11 FOOD AND DIGESTION SECTION 11 1 Food and Energy (pages 370-380) This section tells about the six nutrients needed by the body. It also describes the Food Guide Pyramid and how to read labels
More informationCPT David J. Licciardello, DVM Veterinary Advisor
CPT David J. Licciardello, DVM Veterinary Advisor Carbohydrates Fats (Fatty Acids) Minerals Proteins (Amino Acids) Vitamins Water Referred to as Fiber Made up of the forage portion of a diet In a complete
More informationModified Monogastric Digestive System
Modified Monogastric Digestive System Digestive System of the Horse 8/7/2014 1 The Digestive Tract Horses and rabbits are modified monogastric herbivores. Horses are able to utilize large amounts of roughage
More informationPigeon Health & Performance Products. Product information Instructions for use & dosage.
Pigeon Health & Performance Products Product information Instructions for use & dosage S Premium Nutrition Supplements S Maintaining Good Health S Ensuring Top Performance S Used & Recommended by S Made
More informationEquuSSource Webinar. Welcome to the EquuSSource Webinar. We will be starting shortly.
EquuSSource Webinar Welcome to the EquuSSource Webinar We will be starting shortly. To hear audio, please turn on your computer speakers or connect to the conference number: (484) 589-1010 Code: 672935340
More informationFeed Supplements and Veterinary Products
Sel E Pro Water Soluble Powder Containing Vitamin E, Selenium & Biotin Vitamin E is a fat soluble intracellular antioxidant, involved in stabilising unsaturated fatty acids. The main antioxidant property
More informationArbonne, PhytoSportM. Collection Focus Guide. Did You Know? SCIENCE AND EDUCATION ARBONNE. Carbohydrates. Proteins
ARBONNE I, Arbonne, PhytoSportM Collection Focus Guide Did You Know? All of the energy we need for life, as well as for exercise, comes from the foods we eat and the fluids we drink. To perform at your
More informationNutrition is the study of the nutrients in food and how they nourish the body.
Chapter 2 Nutrients Copyright 2011 by the National Restaurant Association Educational Foundation (NRAEF) and published by Pearson Education, Inc. All rights reserved. People need certain nutrients on a
More informationTotal Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest
Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely
More informationSMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units
SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test
More informationThere are six general classes of nutrients needed in the horse s diet: water carbohydrates fats protein minerals vitamins.
HORSE NUTRITION Nutrients A nutrient is defined as any feed constituent that is necessary to support life. The following is a list of functions that nutrients perform in the horse's body: source of energy
More informationDEVELOPMENT OF BEVERAGE PRODUCTS FROM YACON (Smallanthus sonchifolius)
DEVELOPMENT OF BEVERAGE PRODUCTS FROM YACON (Smallanthus sonchifolius) Rosemarie G. Garcia (MS Food Sci Tech), Ma. Elena G. Fernandez (M App Sci Food Tech), Dahlia A. Diaz,Honeylet S. Ochangco, Alex M.
More informationStudy Report Effects of Corn Distillers Dried Grains with Solubles (DDGS) Under Hot Summer Conditions in Lactating Dairy Cows
Study Report Effects of Corn Distillers Dried Grains with Solubles (DDGS) Under Hot Summer Conditions in Lactating Dairy Cows Masahito Tanaka Chief, Research Team for Effects of Climate Change on Agriculture
More informationMEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)
8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)
More informationSMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION
SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information
More informationCHARACTERISTICS. Recovery rate. Spore of Bacillus licheniformis
Targeted protection B-Act is a probiotic feed additive consisting of viable spores of a unique Bacillus licheniformis strain (Strain Identification Number DSM 2871). CHARACTERISTICS Bacillus licheniformis
More informationCONCEIVED, RESEARCHED & FORMULATED BY TEXANS
CONCEIVED, RESEARCHED & FORMULATED BY TEXANS BUCKS OF LIVENGOOD As you know inadequate nutrition leads to weight loss, poor conception rates, lower fawn survival, poor antler development and increased
More informationBUILDING HEALTHY SOILS AND PLANTS. Summary
BUILDING HEALTHY SOILS AND PLANTS Summary All essential nutrients are needed to produce one plant cell. Productivity of soil is limited by the least available nutrient. Measurement of Soil Cation Exchange
More informationSAFETY ASPECTS OF MIDAZOLAM
Br. J. clin. Pharmac. (1983), 16, 37S-41S Biological Pharmaceutical Research Department, F. Hoffmann-La Roche & Co Ltd, CH-4002 Basle, Switzerland 1 The LD50 in the rat and the mouse is about 1600 mg/kg
More informationFrequently Asked Questions (FAQs)
Frequently Asked Questions (FAQs) 1. What is ST-5 with MigraStem? ST-5 with MigraStem is a delicious and convenient nutrient boost to your favorite beverage that provides scientifically advanced nutrition
More informationCapillary Action and Blood Components. Biology 20 Unit D: Body Systems Circulation
Capillary Action and Blood Components Biology 20 Unit D: Body Systems Circulation 1 Remember. Capillaries are so small that blood cells can only pass through single file Important because they are the
More informationBiacid: A EU approved natural growth promoter for Broilers
Biacid is a blend of calcium salts of organic acids and essential oils. Through the optimal combination of calcium salts of organic acids and essential oils, it enhances broiler microflora within the gut
More informationINTERPRETING FORAGE QUALITY TEST REPORTS
INTERPRETING FORAGE QUALITY TEST REPORTS Donna M. Amaral-Phillips, Ph.D. Department of Animal and Food Sciences University of Kentucky Forages are the foundation for building diets for beef and dairy cattle,
More informationBARIKI ORGANICS 2015
BARIKI ORGANICS 2015 BARIKI ORGANICS TM BARIKI ORGANICS TM products are extremely powerful. Using the best all-inone ingredients that are full of antioxidants. We combine them with a Probiotic Fermentation
More informationBASIC METABOLIC PANEL
Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,
More informationMUNs - It s only a Piece of the Puzzle!
MUNs - It s only a Piece of the Puzzle! With the recent introduction of milk urea nitrogen (MUN) testing by Ontario DHI, there has been some confusion over the interpretation of the new reports. This article
More informationFighting Inflammation, Naturally
Fighting Inflammation, Naturally Mandy Katz, MS, RD, CLC, LDN In-Store Nutritionist, Giant Food Coletta Meyer, MS, MCHES, CWPC Health & Wellness Strategist, GEHA 3 Welcome from GEHA Government Employees
More informationOnline catalog
This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)
More informationSection 4: Exercise Physiology. Diet and nutrition and their effect on physical activity and performance
Section 4: Exercise Physiology Diet and nutrition and their effect on physical activity and performance Learning Objectives 1. Identify the seven classes of food as: carbohydrates, fats, proteins, vitamins,
More informationArchival copy: for current recommendations see or your local extension office.
NAME ADDRESS CLUB 4-H HORSE PROGRAM HORSE SCIENCE This educational material has been prepared for 4-H use by the Cooperative Extension Services of the U.S. Department of Agriculture and State Land-Grant
More information