REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine

Size: px
Start display at page:

Download "REFERENCE INTERVALS. Units Canine Feline Bovine Equine Porcine Ovine"

Transcription

1 REFERENCE INTERVALS Biochemistry Units Canine Feline Bovine Equine Porcine Ovine Sodium mmol/l Potassium mmol/l Chloride mmol/l Calcium mmol/l Phosphorus mmol/l Magnesium mmol/l Urea mmol/l Creatinine μmol/l Glucose mmol/l Cholesterol mmol/l Total Bilirubin μmol/l Direct Bilirubin μmol/l ALP IU/L CK IU/L AST IU/L ALT IU/L GGT IU/L Total g/l Protein Albumin g/l Globulin g/l A/G Ratio Amylase IU/L Lipase IU/L SDH IU/L Blood Gases: ph pco 2 venous mmhg po 2 arterial mmhg HCO 3 mmol/l 24±4 24±4 24±4 24±4 24±4 24±4 Base Excess - 0±3 0±3 0±3 0±3 0±3 0±3

2 Biochemistry and Coagulation Units Canine Feline Bovine Equine Porcine Ovine Protein Electrophoresis (agarose gel) Albumin g/l Alpha 1 g/l Alpha 2 g/l Beta g/l Gamma g/l Iron μmol/l TIBC μmol/l All species Bile Acids (pre) (post) μmol/l μmol/l Osmolarity mosm/kg Fibrinogen g/l - - < 6.0 < PT Range seconds N/A N/A N/A N/A PTT Range seconds N/A N/A N/A N/A

3 Hematology Units Canine Feline Bovine Equine Porcine Ovine HgB G/L Hct L/L RBC X /L MCV FL MCH Pg MCHC G/L Reticulocytes % 0-1 % 0-1.2% 0-0.5% 0% 0-1% 0% X 10 9 /L WBC X 10 9 /L Segmented X 10 9 /L Neutrophils Bands X 10 9 /L Rare Neutrophils Eosinophils X 10 9 /L Basophils X 10 9 /L Lymphocytes X 10 9 /L Monocytes X 10 9 /L Platelets X 10 9 /L

4 Endocrine Test Units Canine Feline Bovine Equine Cortisol Baseline Post-ACTH nmol/l nmol/l (2hrs post) hr hr x Baseline at 8hrs Post Dexa nmol/l <35 (8hrs Post Dex at 0.01mg/kg IV) <35 (8hrs Post Dex at 0.1mg/kg IV) <30 (19 hrs Post Dex at 0.04 mg/kg IM) Estrone Sulfate Pregnant Non-Pregnant/ True Gelding Stallion/ Cryptorchid > 20 (> 90 days) < 5 (> 90 days) > 10 Progesterone Diestrus (luteal) LH Peak Estrus (follicular) Pregnant < > < > < 1.0 > < T3 (triiodothyronine) Baseline nmol/l T4 (thyroxine) Baseline nmol/l Testosterone male TSH < 0.50 Urine Cortisol/ Creatinine Ratio <0.4 bitch or neutered male x x Stallion, breeding season < 1.0 Stallion, non- Breeding Season < 0.3 Mares, Geldings

5 Toxicology Animal Mineral Levels BOVINE ARSENIC Liver Kidney Heparinized Blood Normal High Toxic - acute chronic CADMIUM Liver Kidney Normal High Toxic - chronic - acute > > 200 COPPER (No Selenium Supplement) Serum (Selenium Supplement) Deficient Marginal Adequate High Toxic Liver - Fetal Deficient Marginal Adequate High 200

6 BOVINE LEAD Liver Kidney Heparinized Hair * Bone * Blood Normal High Toxic * ppm dry weight SELENIUM or Plasma (No Supplement) (Se Supplement) Deficient Marginal Adequate High Toxic - chronic - acute ZINC Deficient < Marginal Adequate High Toxic

7 CANINE ARSENIC Liver Kidney Normal < 0.2 < 0.2 Toxic > 10.0 > 10.2 CADMIUM Liver Kidney Normal High Toxic > 200 COPPER Deficient < 20 < 5.0 < 0.20 Normal Toxic > 20 LEAD Liver Kidney Heparinized Hair * Blood Normal High Toxic > 88 * ppm dry weight ZINC Deficient < 15 < Adequate Toxic

8 ARSENIC Liver Kidney Normal < 0.4 < 0.4 High Toxic > 10.0 EQUINE CADMIUM Liver Kidney Normal High Toxic > COPPER Deficient < 3.5 < Adequate High LEAD Liver Kidney Heparinized Brain Bone* Blood Normal High Toxic - chronic acute * ppm dry weight

9 EQUINE SELENIUM Deficient Marginal Adequate High Toxic - chronic acute > 2.5 > 2.0 ZINC Deficient < 0.50 Adequate High Toxic

10 PORCINE ARSENIC Liver Kidney Heparinized Blood Normal CADMIUM Liver Kidney Normal High Toxic > 13 > 270 COPPER Deficient Marginal Adequate High Toxic SELENIUM Deficient Marginal Adequate High Toxic ZINC Deficient Marginal Adequate High > 200 Toxic

11 OVINE ARSENIC Liver Kidney Heparinized Blood Normal High Toxic CADMIUM Liver Kidney Normal High Toxic COPPER Deficient Marginal Adequate High Toxic LEAD Liver Kidney Heparinized Blood Brain Bone (Tibia)* Normal High Toxic > 70 * ppm dry weight

12 OVINE SELENIUM Deficient Marginal Adequate High Toxic > 3.0 Toxic injected (IM) ZINC Deficient Marginal Adequate High Toxic > NOTE: a. Tissue mineral levels are quoted from Mineral Levels in Animal Health, Diagnostic Data by Robert Puls, 3 rd printing, b. Conversion of units between wet and dry weight: Units in dry weight: % dry matter = units in wet weight 100 Units in wet weight: 100 = units in dry weight % dry matter

Tables of Normal Values (As of February 2005)

Tables of Normal Values (As of February 2005) Tables of Normal Values (As of February 2005) Note: Values and units of measurement listed in these Tables are derived from several resources. Substantial variation exists in the ranges quoted as normal

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

Hamilton Regional Laboratory Medicine Program

Hamilton Regional Laboratory Medicine Program Created: April 2002 of Review: February 2004 of Review: June 2006 of Review: July 2007, St. Joseph s Healthcare went live with Meditech as of June18, 2007. of Review: August 2009 of Review: December 2011;

More information

NORMAL LABORATORY VALUES FOR CHILDREN

NORMAL LABORATORY VALUES FOR CHILDREN Pediatric Drug Lookup Normal Laboratory Values for NORMAL LABORATORY VALUES FOR CHILDREN CHEMISTRY Normal Values Albumin 0-1 y 2.0-4.0 g/dl 1 y to adult 3.5-5.5 g/dl Ammonia Newborns 90-150 mcg/dl 40-120

More information

BC Biomedical Laboratories Adult Reference Ranges

BC Biomedical Laboratories Adult Reference Ranges BC Biomedical Laboratories Adult s Name Age 25 OH VITAMIN D Blood B 0-100 nmol/l Interpretation: < 25 Deficient 25-74 Insufficient 75-199 Sufficient > 200 Toxic 5HIAA (CALC) Urine B 0-100

More information

NEW RCPCH REFERENCE RANGES-

NEW RCPCH REFERENCE RANGES- s vary between populations and age groups and it is important to always check the reference Haematology: Haemoglobin Male 130 175 g/l 0 6 days 145-220 g/l Female 115 165 g/l 7 days 140-186 g/l 8 days 3

More information

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy

SydPath Reference Intervals for Clinical Trials (Contract Pathology Unit) Unauthorised Copy HAEMATOLOGY APTT 1 150 M 25 35 sec APTT 1 150 F 25 35 sec Basophils Cord 2 weeks M 0.0 0.4 10^9/L Basophils Cord 2 weeks F 0.0 0.4 10^9/L Basophils 2 wks 3 mths M 0.0 0.2 10^9/L Basophils 2 wks 3 mths

More information

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis.

A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Hair Mineral Analysis A test that can measure the levels of minerals, as well as toxic heavy metals, through a hair mineral analysis. Your hair contains every single mineral that exists in your body. These

More information

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile.

1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. 1.) 3 yr old FS Siamese cat: 3 day history of lethargy, anorexia. Dyspneic, thin, febrile. NUCLEATED CELLS 19.5 High 4.0-14.0 x 10^3/ul METAMYELOCYTES 9 % 1.8 High 0.0-0.0 x 10^3/ul BAND NEUTROPHILS 61

More information

BASIC METABOLIC PANEL

BASIC METABOLIC PANEL Update 2/12/2018 BASIC METABOLIC PANEL CPT 80048 Stability: 3 days at 15-25 C; 7 days at 2-8 C; > 7 days at -70 C Colorimetric Assay, Rate reaction, ISE Components: BUN, Calcium, Chloride, CO2, Creatinine,

More information

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1

Australian and New Zealand College of Veterinary Scientists. Fellowship Examination. Veterinary Clinical Pathology Paper 1 Australian and New Zealand College of Veterinary Scientists Fellowship Examination June 2012 Veterinary Clinical Pathology Paper 1 Perusal time: Twenty (20) minutes Time allowed: Three (3) hours after

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2017 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

Please contact the Client Services Team if you require further information.

Please contact the Client Services Team if you require further information. Reference ranges are quoted on all reports where appropriate for the test carried out. The reference range and reporting units, including any interpretive information, is specific to the methodology used

More information

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE

ROTUNDA HOSPITAL DEPARTMENT OF LABORATORY MEDICINE This active test table informs the user of Biochemistry tests available in house. s referred to other sites are recorded in the Referred Table. Issue date: 4 TH April 2016 Contact Phone Number ext.1345/2522

More information

Authorised: JSWoodford, Lead of Speciality. Biochemistry Reference Intervals, October Page 1 of 5

Authorised: JSWoodford, Lead of Speciality. Biochemistry Reference Intervals, October Page 1 of 5 AFP All All < 15 ug/l Albumin All 0-3M 25-40 g/l Albumin All 3-12M 32-45 g/l Albumin All 1-70Y 34-48 g/l Albumin All >70Y 32-46 g/l Alk Phos All 0-10Y 80-350 U/L Alk Phos M 10-14Y 45-400 U/L Alk Phos F

More information

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON

COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON European Medicines Agency Veterinary Medicines and Inspections London, 20 November 2006 EMEA/CVMP/556/04- Rev.1 COMMITTEE FOR MEDICINAL PRODUCTS FOR VETERINARY USE (CVMP) LIST ON ADDITIONAL CONTROLLED

More information

GRADING CRITERIA for CMS Regulated Analytes

GRADING CRITERIA for CMS Regulated Analytes CLIA '88 AND GRADING The Clinical Laboratory Improvement Amendments of 1988 (CLIA '88) were established by the federal government (CMS) to regulate clinical laboratories and proficiency test providers

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Pathology Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2014 Veterinary Pathology Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

Analyte Specimen Demographic Reference Range Units

Analyte Specimen Demographic Reference Range Units Acetone Negative titer Alanine aminotransferase (ALT/SGPT) 10-49 U/L Albumin 3.2-4.8 g/dl Alcohol < 10 Alpha-fetoprotein (AFP) < 1.3-8.1 ng/ml Alkaline phosphatase 0 7 days 7 30 days 1 3 3 6 6 12 1 3 3

More information

2010 Miniboard Exam- Clinical Pathology

2010 Miniboard Exam- Clinical Pathology 2010 Miniboard Exam- Clinical Pathology 1. All of the following findings are noted in cats with hyperthyroidism EXCEPT: A. Anemia B. Increased creatinine C. Hyperglycemia D. Elevated ALP (bone isoenzyme)

More information

COMPANY OR UNIVERSITY

COMPANY OR UNIVERSITY CONTRIBUTOR NAME Daniel Heinrich, DVM CONTRIBUTOR EMAIL dheinric@umn.edu COAUTHORS Jed Overmann, DVM, DACVP; Davis Seelig DVM, PhD, DACVP & Matthew Sturos, DVM COMPANY OR UNIVERSITY University of Minnesota

More information

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES

Provided by MedicalStudentExams.com NORMAL LABORATORY VALUES NORMAL LABORATORY VALUES 1. BLOOD, PLASMA, SERUM 2. CEREBROSPINAL FLUID 3. HEMATOLOGIC 4. SWEAT 5. URINE 6. SYNOVIAL FLUID 7. TOXIC LEVELS 8. Tumour Markers 9. Differential of Cerebral Spinal Fluid 10.

More information

10 Essential Blood Tests PART 1

10 Essential Blood Tests PART 1 Presents 10 Essential Blood Tests PART 1 The Blood Chemistry Webinars With DR. DICKEN WEATHERBY Creator of the Blood Chemistry Software Essential Blood Test #1: Basic Chem Screen and CBC http://bloodchemsoftware.com

More information

HYPERCALCEMIC GOLDEN RETRIEVER

HYPERCALCEMIC GOLDEN RETRIEVER Presenter: Laura Martínez 1, 2 HYPERCALCEMIC GOLDEN RETRIEVER Contributors: Laia Solano-Gallego 2, Josep Pastor 2, Alberto J. Marco 3, María Cuvertoret-Sanz 3, Rosa Novellas 1,2, Anna Vila 1, 2, Xavier

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 7 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-25 U/L 10-35 U/L 10-30 U/L 10-25 U/L 10-30 U/L 10-35 U/L 10-25 U/L 10-35 U/L 10-25 U/L 10-20 U/L 10-35 U/L Albumin 0-6

More information

Chemistry Reference Ranges and Critical Values

Chemistry Reference Ranges and Critical Values Alanine Aminotransferase (ALT, SGPT) 3-9 years 9-18 years 1-9 years 9-18 years 10-30 U/L 10-30 U/L 10-20 U/L Albumin 0-6 days 6 days - 37 months 37 months - 7 years 7-20 years 2.6-3.6 g/dl 3.4-4.2 g/dl

More information

ENROLLMENT CONFIRMATION

ENROLLMENT CONFIRMATION Step 1: Please review the Facility/Contact information. If any of the information is incorrect, please make the appropriate changes below: Facility/Contact Phone: (850)474-3660 Fax: (850)474-3659 6431

More information

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310)

MEDICAL HISTORY. 23-Jan-2018 to 23-Jan VCA Miller-Robertson Animal Hospital 8807 Melrose Ave, Los Angeles, CA (310) 8807 Melrose Ave, Los Angeles, CA 90069 (310) 657-7050 MEDICAL HISTORY 23-Jan-2018 to 23-Jan-2018 Client Linnea Engdahl (1810) C: Linnea: (310) 351-9547 Patient Abby (6487) Canine Mixed Breed 3y (22-Jan-2015)

More information

Complete Medical History

Complete Medical History Lab Results for Ben Greenfield Last Test Date: Your medical history is not complete. Complete Medical History Complete Medical History What's Next Blood Draw Blood draw scheduled Complete your medical

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

Inspector's Accreditation Unit Activity Menu

Inspector's Accreditation Unit Activity Menu 01/12/20XX 15:58:57 Laboratory Accreditation Program Page 1 of 9 CHEMISTRY 1501 ALT, serum/plasma 1502 Albumin, serum/plasma 1504 Alkaline phosphatase, serum/plasma 1506 Amylase, serum/plasma 1508 Bilirubin,

More information

Specimen Collection Requirements

Specimen Collection Requirements The following is a job aid listing the specimen collection requirements for laboratory testing at Colchester East Hants Health Center. Specimens must be accompanied by the Patient Information Form G09.

More information

ACCREDITATION DOCUMENT

ACCREDITATION DOCUMENT Accreditation No: Awarded to Dow Diagnostic Reference and Research Laboratory (DDRRL), Dow University of Health Sciences Suparco Road Gulzar e Hijri KDA Scheme-35, Karachi, Pakistan. The scope of accreditation

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Test Result Reference Range Flag

Test Result Reference Range Flag Date of Last Result Test Result Reference Range Flag Dec 07, 2016 25-Hydroxy Vitamin D Total 53 ng/ml 30-100 ng/ml Activated Partial Thromboplast Time Alanine Aminotransferase (ALT/SGPT) 25 sec 24-35 sec

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Pathology Laboratory Contact: Gavyn Barrett BMI Blackheath Hospital Tel: +44 (0)20 7307 7373 40-42 Lee Terrace E-Mail: Gavyn.barrett@tdlpathology.com

More information

Clinician Blood Panel Results

Clinician Blood Panel Results Page 1 of 8 Blood Panel - Markers Out of Range and Patterns (Pattern: proprietary formula using one or more Blood Markers) Blood Panel: Check for Markers that are out of Lab Range ***NOTE*** Only one supplement

More information

Laboratory Accreditation Programmes

Laboratory Accreditation Programmes Client No. 1609 LABNET Invermay Limited PO Box 371, Mosgiel, 9053 Puddle Alley, RD 2, Mosgiel, 9092 Telephone 03 489-4600 www.gribblesvets.co.nz Fax 03 489-8576 Authorised Representative Ms Denise Carian-Smith

More information

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair

ASPEN MOUNTAIN MEDICAL CENTER. Lab Health Fair ASPEN MOUNTAIN MEDICAL CENTER Lab Health Fair GENERAL HEALTH PANEL: CMP CMP The Comprehensive Metabolic Panel is used as a broad screening tool to evaluate organ function and check for conditions such

More information

Online catalog

Online catalog This catalog contains information about tests performed at Green Clinic Laboratory. For samples to be sent to Quest Diagnostics or any other reference lab please contact the Green Clinic Laboratory (318-251-6378)

More information

WHAT IS YOUR DIAGNOSIS?

WHAT IS YOUR DIAGNOSIS? WHAT IS YOUR DIAGNOSIS? A 12 year old, female neutered domestic shorthaired cat was presented to the R(D)SVS Feline Clinic with a 6 week history of polydipsia and polyuria, which was not quantified. The

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Small Animal Medicine Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Small Animal Medicine Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours after perusal Answer

More information

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG

Cytochrome-C (rat, mouse) forward GGAGGCAAGCATAAGACTGG. mouse hexokinase 2 gene, intron 9 reverse GGGAACACAAAAGACCTCTTCTGG Supplementary Table 1. The sequences of oligonucleotide primers. Genes Sequence rat actin forward CGAGTACAACCTTCTTGCAG rat actin reverse GAGTCCTTCTGACCCATACC tubulin (rat, mouse) forward TAGCAGAGATCACCAATGCC

More information

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible:

*** To get the most out of this report and the consultation, send us blood test results that cover as many of the following markers as possible: Rick Gold, Certified FDN Practitioner Gold Functional Wellness, Inc. Web: http://goldfunctionalwellness.com/ Phone: (561)270-6364 Email: Rick@goldfunctionalwellness.com Schedule a consultation: https://snapappointments.com/listing/38c

More information

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE

CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE CROATIAN SOCIETY OF MEDICAL BIOCHEMISTRY AND LABORATORY MEDICINE Croatian Centre for Quality Assessment in Laboratory Medicine Dear colleagues, Boskoviceva 18, 10000 Zagreb Croatia Tel/Phone & Fax: +385

More information

SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

SMITH, JOHN D.C. Functional Health Report. Patient Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units SMITH, JOHN D.C. Functional Health Report Patient Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test results.

More information

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units

SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE. Lab Test on Mar 11, 2017 Conventional US Units SMITH, JOHN D.C. Functional Health Report Practitioner Copy JANE DOE Conventional US Units Table of Contents Health Improvement Plan 3 This report shows customized recommendations based on the blood test

More information

LABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and

LABORATORY NORMAL RANGES. Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and Prepared by Date Adopted Supersedes Procedure # / Dated William T. Pope, PhD and 3-31-09 Normal Ranges / 12-30-08 Christy O Brien, MT (ASCP) CHEMISTRY Acetone None detected Albumin, g/dl 3.5-5.0 Adult

More information

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1

Australian and New Zealand College of Veterinary Scientists. Membership Examination. Veterinary Emergency and Critical Care Paper 1 Australian and New Zealand College of Veterinary Scientists Membership Examination June 2018 Veterinary Emergency and Critical Care Paper 1 Perusal time: Fifteen (15) minutes Time allowed: Two (2) hours

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

MEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently.

MEMORANDUM. These reference ranges are effective immediately but sample requirements remain unchanged currently. MEMORANDUM Originating Department Chemical Pathology Issued By: Issued To: Subject: Details: Dr. Shari Srinivasan All Laboratory Service Users Change in Chemical Pathology Analysers Dear Colleague, As

More information

Types of target values, acceptable ranges

Types of target values, acceptable ranges Types of target values, acceptable ranges As the differential of rounding, maximum 1 percent point deviation is allowed from the maximum acceptable range. 100. Clinical chemistry (wet) 1. Calcium RMV 10

More information

The Blood Chemistry Panel Explained

The Blood Chemistry Panel Explained The Blood Chemistry Panel Explained The Senior Profile (for senior and geriatric patients) As our dogs and cats enter their senior years, we recognize that they are more likely to have health problems

More information

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0.

6/3/2018 9:37:00AM 6/3/2018 9:39:05AM 6/3/2018 1:44:56PM A/c Status. Test Name Results Units Bio. Ref. Interval Bilirubin Direct 0. LL - LL-ROHINI (NATIONAL REFERENCE 140222511 Age 45 Years Gender Male 6/3/2018 93700AM 6/3/2018 93905AM 6/3/2018 14456M Ref By Final Swasth lus Tax Saver anel 1 LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

Biochemistry Adult Reference Ranges

Biochemistry Adult Reference Ranges Certified correct on 28/06/2016 Biochemistry Adult Reference Ranges Test Reference range Units Reference range from Traceable to standard reference material Albumin 35 50 g/l Pathology IRMM ERM-DA470k/IFCC

More information

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis

no concerns hepatic shunt, high protein diet, kidney failure, metabolic acidosis TAKING THE WORK OUT OF INTERPRETING LAB WORK CACVT 2017 SPRING CONFERENCE - GREENWOOD VILLAGE, CO Brandy Helewa, CVT, RVT, VTS (ECC) Penn Foster College - Scranton, PA Knowing what the results on your

More information

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO

POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO POSTGRADUATE INSTITUTE OF MEDICINE UNIVERSITY OF COLOMBO Selection Examination for Enrolment to the in-service Training Programme in Postgraduate Certificate in Basic Laboratory Sciences leading to the

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Spire Portsmouth Hospital Bartons Road Havant PO9 5NP United Kingdom Contact: Natalie Peck E-Mail: natalie.peck@spirehealthcare.com Website:

More information

Results Report. Welcome to Your ABT Report!

Results Report. Welcome to Your ABT Report! Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Feb 10, 2018 Panel: ABT Bronze Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be

More information

CERTIFICATE OF ACCREDITATION

CERTIFICATE OF ACCREDITATION CERTIFICATE OF ACCREDITATION In terms of section 22(2) (b) of the Accreditation for Conformity Assessment, Calibration and Good Laboratory Practice Act, 2006 (Act 19 of 2006), read with sections 23(1),

More information

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE-BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

Blood Test Results Report

Blood Test Results Report Blood Test Results Report The Blood Test Results Report lists the results of the patient s Chemistry Screen and CBC and shows you whether or not an individual element is outside of the optimal range and/or

More information

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK

Schedule of Accreditation issued by United Kingdom Accreditation Service 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK 2 Pine Trees, Chertsey Lane, Staines-upon-Thames, TW18 3HR, UK Biochemistry Department University Hospital of North Durham Durham County Durham DH1 5TW Contact: Dr Tim Lang Tel: +44 (0) 191 333 2694 Fax:

More information

Basic Blood Chemistry, by Sharlene Peterson CLASS: G610

Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 Basic Blood Chemistry, by Sharlene Peterson CLASS: G610 This is your test but do not try to fill in the blanks! We created a Test Answer Sheet which is easy to download, fill in the answer, and email.

More information

Total Cholesterol A Type of Fat. LDL "Bad" Cholesterol. HDL "Good" Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest

Total Cholesterol A Type of Fat. LDL Bad Cholesterol. HDL Good Cholesterol. Triglycerides Type of Fat. vldl-c Precursor to LDL Cholest Lab Results for Ben Greenfield Last Test Date: 2013-08-13 Let us know what you think How likely are you to recommend WellnessFX to a friend or colleague? 1 2 3 4 5 6 7 Not at all likely Neutral Extremely

More information

Rapid Laboratories In House Tests

Rapid Laboratories In House Tests Electrolytes CL CL (CHLORIDE) Electrolytes CO2 CO2 (BICARBONATE) Electrolytes K K (POTASSIUM) Electrolytes NA NA (SODIUM) Basic Metabolic Panel (BMP) GLU GLU (GLUCOSE) Basic Metabolic Panel (BMP) CA CA

More information

Kathryn Jones 8/11/2015

Kathryn Jones 8/11/2015 1 of 8 8/11/2015 2:25 PM This informa on is copyrighted 2014 by Balancing Body Chemistry with Nutri on Seminars. No part may be copied or reproduced without wri en approval of Balancing Body Chemistry

More information

Senior Executive Wellness Profile

Senior Executive Wellness Profile Senior Executive Wellness Profile Comprehensive 86 tests from one blood sample to check your current health Patient Name: Elite Business Center, st Floor, # 05 Al Barsha, Behind Mall of Emirates, Dubai,

More information

FBC interpretation. Dr. Gergely Varga

FBC interpretation. Dr. Gergely Varga FBC interpretation Dr. Gergely Varga #1 71 Y/O female, c/o weakness Test Undertaken : FBC (FBC) Sample Type: Whole Blood [ - 26.09.11 14:59] Hb 7.3 g/dl* 12.0-15.5 RBC 3.5 10^12/l * 3.80-5.60 Hct 0.24

More information

WHAT IS YOUR DIAGNOSIS?

WHAT IS YOUR DIAGNOSIS? WHAT IS YOUR DIAGNOSIS? A 1.5 year, male neuter, domestic shorthair cat was presented to the R(D)SVS Internal Medicine Service with a three month history of pica (ingestion of cat litter and licking concrete)

More information

Miniboard Exam 2009 Clinical Pathology

Miniboard Exam 2009 Clinical Pathology Miniboard Exam 2009 Clinical Pathology 1. Blood gas sample from a 10-year-old pony: ph 7.25 (Ref. Int. 7.32-7.44) HCO3 40 meq/l (Ref. Int. 24-30) PCO2 55 mmhg (Ref. Int. 36-46) PO2 88 mmhg (Ref. Int. 94)

More information

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016

Epic Labs Orderable As STAT PRIORITY As of 06/22/2016 ABG+HB(CORDARTERIAL) - BABY A ABG+HB(CORD ARTERIAL)- BABY B ABG+HB(CORD ARTERIAL)- BABY C ACETAMINOPHEN LEVEL ALANINE AMINOTRANSFERASE (ALT) ALBUMIN, FLUID ALBUMIN, PLEURAL FLUID ALBUMIN, SYNOVIAL FLUID

More information

* * Interpretation

* * Interpretation LL - LL-ROHINI (NATIONAL REFERENCE 139242049 Age Unknown Gender Unknown 9/3/2018 120000AM 9/3/2018 40032M 10/3/2018 24647M Ref By Final SUGAR ADVANCE ANEL MICROALBUMIN,1ST MORNING/RANDOM URINE (Immunoturbidimetry,Spectrophotometry)

More information

Date Time By Code Description Qty (Variance) Photo

Date Time By Code Description Qty (Variance) Photo Adobe Animal Hospital 6331 Haven Ave., Suite 4 Rancho Cucamonga, CA 91737 909-483-3535 Patient Chart Printed: 03-16-17 at 9:44a CLIENT INFORMATION Name Ms. Amanda Barber (1394) Address 10850 Church St.

More information

Age: 14 Houston TX 77007

Age: 14 Houston TX 77007 Patient Medical History HEIGHTS HOSPITAL FOR ANIMALS Bernie Rogers Patient: JACK DOB: 08/26/1999 720 Courtlandt St. Species: FELINE Age: 14 Houston TX 77007 Breed: Domestic Shorthair Sex: MN Color: Black

More information

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report

Results Report. Welcome to Your ABT Report! Introduction to the ABT Report Results Report Athlete Name: SHEPPARD, JOSEPH Date of Blood Draw: Dec 08, 2017 Panel: ABT Gold Panel ABT Expert: Dr. Rock Welcome to Your ABT Report! Thank you for trusting AthleteBloodTest.com to be a

More information

Saskatchewan ND Price List

Saskatchewan ND Price List Saskatchewan ND Price List Note: There is a $55 per requisition documentation fee. Prices valid only in Saskatchewan. PANEL Healthy Living Assessment Panel $115.00 Enhanced Healthy Living Assessment Panel

More information

Questionnaire. Traceability in EQA. Traceability

Questionnaire. Traceability in EQA. Traceability Questionnaire in EQA QUESTIONNAIRE ON TRACEABILITY QUESTIONNAIRE ON TRACEABILITY GENERAL INFORMATION Name EQA organisation Country Specify the total number of measurands in the schemes of your EQA organisation

More information

Hematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit

Hematology TOONYA TURNER. IDEXX Services: Senior Profile with Heartworm -Standard CBC. RBC M/µL. Hematocrit TOONYA TURNER PET OWNER: TURNER SPECIES: Cnine BREED: GENDER: Femle AGE: 1 Yers PATIENT ID: 17047 Fmily Pet Helth Cre 3623 Indin Hills Rod Dectur, Albm 35603 256-341-0200 ACCOUNT #: 87040 ATTENDING VET:

More information

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes

Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Comparison of VACUETTE Heparin Gel Tubes for Common Chemistry Analytes Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood collection since 9. The

More information

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval

5/6/ :35:00AM 5/6/ :57:28AM 5/6/2017 3:49:09PM A/c Status. Test Name Results Units Bio. Ref. Interval LL - LL-ROHINI (NATIONAL REFERENCE 136235211 Age Unknown Gender Unknown 5/6/2017 103500AM 5/6/2017 105728AM 5/6/2017 34909M Ref By Final Swasth lus Health Advance anel LIVER & KIDNEY ANEL, SERUM (Spectrophotometry,

More information

DTH Meditech HCIS Reference Intervals

DTH Meditech HCIS Reference Intervals Applicability Purpose This document applies to all Central Zone DTH Meditech HCIS personnel of AHS Laboratory Services and laboratories administered under the Covenant Health Group collectively referred

More information

Glossary of terms used in College examinations. The Royal College of Emergency Medicine

Glossary of terms used in College examinations. The Royal College of Emergency Medicine Glossary of terms used in College examinations The Royal College of Emergency Medicine The CEM uses several terms in examinations that may cause confusion. The following definitions are intended as a guide

More information

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION

SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION SMALL ANIMAL SOFT TISSUE CASE- BASED EXAMINATION CASE-BASED EXAMINATION INSTRUCTIONS The case-based examination measures surgical principles in case management prior to, during, and after surgery. Information

More information

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions

Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Stability of VACUETTE Lithium Heparin Separator tubes with modified centrifugation conditions Background: Greiner-Bio-One, Austria has been selling plastic evacuated tubes (VACUETTE ) for venous blood

More information

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP

Blood Physiology. Rodolfo T. Rafael, M.D.,CFP Blood Physiology Rodolfo T. Rafael, M.D.,CFP http://clinical-updates.blogspot.com rtrafaelmd@gmail.com +639212147558 July 26, 2006 1 Blood Physiology General Consideration Plasma Cellular Elements of the

More information

PRICE LIST August 2017-July 2018

PRICE LIST August 2017-July 2018 PRICE LIST August 2017-July 2018 Necropsy... 1 Cytology... 2 Biopsy... 2 Histology special stains... 3 Small animal profiles... 4 Equine profiles... 5 Large animal profiles... 5 Standard biochemistry s...

More information

* 17.8 DOUGLASS HANLY MOIR PATHOLOGY. "We take it personally"

* 17.8 DOUGLASS HANLY MOIR PATHOLOGY. We take it personally Toll Free: 1800 222 365 Results: 98555 100 Dr EricaAH Dr Karl BAUMGAfr Dr Elizabeth BERM Or Jonathan BLACKV Dr David BLAXlAN Dr Warick oelprado SPECIALIST PATHOLOGISTS Or Colin GOLDSCHMIDT Or Richard HASKELL

More information

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300

ICL Integrative Laboratory Services Test Menu Contact ICL Client Care x300 Alletess Food Sensitivity Fingerstick 96 Foods IgG with or without Wellness Program 184 Foods IgG with or without Wellness Program Alletess Food Allergy/Sensitivity Serum 96 Foods IgG with or without Wellness

More information

JOB AID CRITICAL VALUES AND TESTS W/O MICRO CRITICAL TESTS. Always call results for the following test(s):

JOB AID CRITICAL VALUES AND TESTS W/O MICRO CRITICAL TESTS. Always call results for the following test(s): Facilities: NoCo Laboratories JOB AID CRITICAL VALUES AND TESTS W/O MICRO CRITICAL TESTS Always call results for the following test(s): CONSTITUENT Ethylene Glycol (Performed at CU) Time Interval (from

More information

PRICE LIST August 2018-July 2019

PRICE LIST August 2018-July 2019 PRICE LIST August 2018-July 2019 Necropsy... 1 Cytology... 2 Biopsy... 2 Histology special stains... 3 Small animal profiles... 4 Equine profiles... 5 Large animal profiles... 5 Standard biochemistry s...

More information

Understanding your blood results:

Understanding your blood results: Understanding your blood results: Contents Introduction... 1 Haematology... 2 Biochemistry... 3 MB - 'Electrolytes' (Sodium, Potassium, Chloride, Bicarbonate):... 3 MB - Kidney parameters... 4 MB - Liver

More information

Serodos and Serodos plus

Serodos and Serodos plus Design Verification Serodos and Serodos plus Contents 1 Value Adjustment... 2 2 Target Determination... 2 3 Stability... 2 Real-Time Stability... 3 Stability after Reconstitution... 4 Stability after Reconstitution

More information

Delta Check Calculation Guide

Delta Check Calculation Guide Delta Check Calculation Guide National Technology 2017, All Rights Reserved By Senior Scientific Researcher, Asmaa Taher Table of Contents Definition... 2 Purpose... 2 Delta Check Research Studies... 2

More information

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters

A. Blood is considered connective tissue. RBC. A. Blood volume and composition 1. Volume varies - average adult has 5 liters A. Blood is considered connective tissue. RBC A. Blood volume and composition 1. Volume varies - average adult has 5 liters 2. 45% cells by volume called hematocrit (HCT) a. red blood cells (RBC) mostly

More information

External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA -

External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA - External Quality Assessment for Calibration Laboratories in Laboratory Medicine - RELA - Anja Kessler Bonn, Germany 1 RELA Surveys www.dgkl-rfb.de 2 RELA Annual Process Each participant receives two different

More information

Fullerton Healthcare Screening Centres

Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centres Fullerton Healthcare Screening Centre @ Ngee Ann City The Penthouse, #26-02 Ngee Ann City Tower B, 391B Orchard Road, Singapore 238874 Operating hours: Monday - Friday

More information

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE

ANNUAL HEALTH CHECKUP BASIC HEALTH PACKAGE ANNUAL HEALTH CHECKUP Taking care of your health is our responsibility and to make sure that you remain at a distance from the serious maladies, we also step forward in providing health checkups. This

More information